CN106916846A - Improve drought-enduring and antiweed performance the method for soybean - Google Patents

Improve drought-enduring and antiweed performance the method for soybean Download PDF

Info

Publication number
CN106916846A
CN106916846A CN201710142894.1A CN201710142894A CN106916846A CN 106916846 A CN106916846 A CN 106916846A CN 201710142894 A CN201710142894 A CN 201710142894A CN 106916846 A CN106916846 A CN 106916846A
Authority
CN
China
Prior art keywords
soybean
drought
fvc5sd
enduring
antiweed
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201710142894.1A
Other languages
Chinese (zh)
Inventor
张玲
王阳
张原宇
董英山
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Jilin Academy of Agricultural Sciences
Original Assignee
Jilin Academy of Agricultural Sciences
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Jilin Academy of Agricultural Sciences filed Critical Jilin Academy of Agricultural Sciences
Priority to CN201710142894.1A priority Critical patent/CN106916846A/en
Publication of CN106916846A publication Critical patent/CN106916846A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8273—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for drought, cold, salt resistance
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
    • C12N15/8205—Agrobacterium mediated transformation
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8274—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for herbicide resistance
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/10—Plasmid DNA
    • C12N2800/101—Plasmid DNA for bacteria

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Chemical & Material Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

The present invention provides a kind of raising soybean drought-enduring and antiweed performance method.The present invention carries out SpeI and SacI double digestions to FvC5SD genes complete sequence, and is cloned into the T region of DNA MCSs of carrier is carrier pYL, obtains the plant expression vector pYL FvC5SD containing FvC5SD genes.Expression vector pYL FvC5SD are transferred in the genome of soybean acceptor kind Williams82 using Agrobacterium tumefaciens mediated soybean cotyledon node genetic transformation, due to containing herbicide phosphine oxamate marker gene bar on the binary expression vector of selection, we have obtained possessing drought-enduring and antiweed complex character genetically engineered soybean.This method is one of effective way of the factor influence soybean growth such as following reply drought and water shortage, with important economic worth and wide application prospect.

Description

Improve drought-enduring and antiweed performance the method for soybean
Technical field
The invention belongs to field of plant genetic, and in particular to one kind obtains drought-enduring soybean using transgenic technology The method of new material.
Background technology
Soybean originates in China, and cultivation history is long, is one of main source of protein and oil plant.Arid, salt damage etc. Abiotic stress is larger to the Influence of production of soybean, therefore, carry out the functional study of soybean drought resisting stress-related genes, to disclosing Soybean drought resisting mechanism, cultivation soybean drought resisting kind have great theory and application value.China's major soybean production areas are mainly distributed In arid, saline and alkaline, extremely frigid zones.Severe growing environment particularly arid and the salinization of soil are brought sternly to soybean in China Threaten again.According to incompletely statistics, the soybean yield loss every year caused by arid and salinization of soil reaches 50% or so.Therefore, such as What effectively reduces the abiotic stress such as arid, saline and alkaline influences on crops such as soybean, for improving soybean total grain output, extenuates me State's soybean crisis has great importance.
At present, the cultivation of drought resisting new soybean varieties is mainly is carried out by conventional breeding methods, but efficient due to lacking Drought resisting Soybean Germplasm, carries out drought resisting new soybean varieties cultivation more difficult, and be often difficult to and produce using routine techniques The proterties such as amount, quality carry out comprehensive coordination improvement.Drought resisting genetically engineered soybean new germ plasm is cultivated using transgenic technology, it is on the one hand prominent The reproduction isolation between different plant species, some extreme drought-resistant plant such as switchgrasses, saline land alkali paulin, salt mustard and some special lifes are broken The favourable resistant gene of border microorganism can also be imported in soybean by transgenic technology, so as to greatly widen drought resisting, resistance to Saline and alkaline new soybean varieties cultivates necessary genetics of resistance resource.On the other hand, transgenic technology realize one or a few The orientation of beneficial gene is imported, so as to efficiently solve the problems, such as the proterties comprehensive improvement such as yield, quality, resistance.Therefore, pass through The effective integration of transgenic technology and conventional breeding, is to solve China's drought resisting soybean breeder difficulty, and lifting China soybean Science Research is educated The important means of the level of kind.
With continuing to develop for transgenic technology, increasing genetically modified crops realize industrialization.But unisexuality shape The genetically modified crops demand that cannot meet agricultural development slowly, and complex character genetically modified crops have widened transgenosis The function of crop, improves the utilization rate of resource, meets peasant's multiple demand, has broad application prospects, and is to turn base Because of the new direction of plant development.Complex character genetically modified crops refer to containing two kinds and two or more in same genetically modified plants Different target proterties.Such as simultaneously herbicide-resistant and pest-resistant transgene cotton, while disease-resistant and pest-resistant transgenosis Ma Ling Potato, oil content genetically engineered soybean high and herbicide-resistant, while change the Transgenic carnation of pattern and herbicide-resistant, while increasing Plus lysine content and pest-resistant transgenic corns etc. are all complex character genetically modified crops.Multiple characters polymerization is genetically modified crops The trend of development.According to statistics by 2010, the U.S. plantation genetically modified crops in 41% have complex character, including 78% turn Gene corn and 67% transgene cotton.
In present study, the C-5 sterol that inventor will clone from edible fungi Flammulina velutipes Dehydrogenase gene (FvC5SD) is transferred in soybean, it is intended to the effective drought resistance for improving soybean, additionally, the double base expression selected is carried Contain herbicide phosphine oxamate marker gene bar on body, therefore we have obtained possessing turning for drought-enduring and antiweed complex character Transgenic soybean, by further Optimal Experimental step, is formd one kind and is removed with anti-using transgenic technology raising soybean drought tolerance The method of careless agent performance.Wherein FvC5SD genes are transferred to tomato by forefathers, obtain drought-enduring transgene tomato, but not See the report for having and FvC5SD genes being transferred in soybean.
The content of the invention
The present invention provides to obtain possesses drought-enduring and antiweed complex character genetically engineered soybean method, can effectively promote Enter the development of Soybean Industry.
To achieve the above object, the technical solution adopted in the present invention is as follows：
A kind of plant expression vector pYL-FvC5SD containing FvC5SD genes is provided, the expression vector is by basis Carrier pYL carries out SpeI and SacI double digestions, and the T-DNA areas that FvC5SD gene cDNA sequences are cloned into carrier is carrier pYL are more Cloning site and obtain.The expression vector contains a screening-gene bar, is on the one hand conducive to the screening of transformant, after reduction Phase detects workload, further proves that genes of interest has been transferred to recipient plant by detecting bar genes.On the other hand can make The function of antiweed is provided simultaneously with progeny transgenic plant.
A kind of breeding method for turning the drought-enduring soybean of FvC5SD genes is provided, the method first by FvC5SD gene clonings build to In expression vector pYL, recycle Agrobacterium tumefaciens mediated soybean cotyledon node genetic transformation that FvC5SD genes are transferred into soybean In the genome of acceptor kind Williams82, drought-enduring genetically engineered soybean material is finally given.But the method that this experiment is provided This is not limited only to, the recombinant expression carrier that any method for transformation can provide the present invention is imported in soybean gene group all fits With.
The breeding method for turning the drought-enduring soybean of FvC5SD genes, comprises the following steps：
(1) agriculture bacillus mediated Genetic Transformation of Soybean：By the plant expression vector pYL-FvC5SD containing FvC5SD genes, Imported in the genome of soybean acceptor kind using Agrobacterium tumefaciens mediated soybean cotyledon node genetic transformation, obtain T0 generations turn Change plant；
(2) screening of FvC5SD transgenic soybean materials is turned：Smeared using bar ELISA test strips, phosphine oxamate herbicide, The methods such as FvC5SD gene PCRs amplification carry out Screening and Identification to T0 for transformed plant, obtain positive plant.Carry out selfing and obtain T1 For seed；Molecular Detection is carried out for positive plant to T1；
(3) the drought tolerance identification of FvC5SD transgenic soybean materials is turned：It is right by two ways (PEG is coerced and soil drought) The T1 of the positive transgenic soybean detected through PCR carries out soybean seedling drought tolerance identification for the seed of strain, must turn FvC5SD bases Because of drought-enduring soybean material.
The whole features turned during the drought-enduring soybean of FvC5SD genes has following (1) and (2)：
(1) compared with the acceptor soybean, drought tolerance is significantly improved the genetically engineered soybean；
(2) compared with the acceptor soybean, antiweed effect is significant is improved the genetically engineered soybean.
It is demonstrated experimentally that the method provided using the present invention, can obtain antiweed and drought-enduring genetically engineered soybean material simultaneously Material, compared with acceptor soybean, the drought-enduring genetically engineered soybean that the method provided using the present invention is cultivated is not only to herbicide phosphine oxamate There is obvious resistance, and drought tolerance is significantly improved.The drought-enduring genetically engineered soybean material obtained using this method is that following reply is dry One of the effective way of the factors such as non-irrigated water shortage influence soybean the problems such as grow, has important economic worth and wide to agricultural production Wealthy application prospect.
Brief description of the drawings
Fig. 1 is FvC5SD expression vectors collection of illustrative plates and vector construction electrophoresis detection result figure, and wherein A is pYL-FvC5SD Expression vector collection of illustrative plates, B is respective carrier restriction enzyme digestion and electrophoresis testing result figure.
Fig. 2 is agriculture bacillus mediated soybean cotyledon node genetic transformation procedure chart.
Fig. 3 is transgenic progeny herbicide marker gene bar testing result figures.
Fig. 4 is to detect transgenic progeny electrophoresis result figure using PCR method.
Fig. 5 is the drought tolerance qualification result figure that T1 generations turn FvC5SD transgenic soybean plant.
Specific embodiment
The present invention is further described in detail with reference to specific embodiment, the embodiment for being given is only for explaining The bright present invention, rather than in order to limit the scope of the present invention.
Experimental technique in following embodiments, unless otherwise specified, is conventional method.
Material used, reagent etc. in following embodiments, unless otherwise specified, commercially obtain.
The plant expression vector construction of embodiment 1
The nucleotide sequence of FvC5SD genes (GenBank accession number JN696291.1), is shown in sequence according to disclosed on NCBI Row SEQ ID NO：1, according to the artificial synthesized FvC5SD genes of plant codon-bias.According to many grams of plant binary expression vector Grand site characterization of molecules, introduces restriction endonuclease SpeI restriction enzyme sites in FvC5SD upstream region of gene respectively, and downstream introduces restriction endonuclease SacI Restriction enzyme site.Expanded by PCR method and obtain FvC5SD full length genes sequence (891bp), and entered by double methods for cutting doubly-linked After row SpeI and SacI digestion, FvC5SD genes are connected to expression vector pYL- is obtained on pYL carriers (commercially available acquisition) FvC5SD (Figure 1A) is shown in sequence SEQ ID NO：2, the plasmid for building is correct by checking through sequencing and digestion detection (Figure 1B) Plant expression vector is transferred in Agrobacterium EHA101, for next step Genetic Transformation of Soybean.
The agriculture bacillus mediated Genetic Transformation of Soybean of embodiment 2
In our current research, agrobacterium strains EHA101 of the selection with genes of interest FvC5SD, is situated between using Agrobacterium tumefaciems The soybean cotyledon node genetic transformation led carries out genetic transformation to soybean acceptor kind Williams82.Agriculture bacillus mediated big bean or pea The process of leaf segment conversion method is shown in Fig. 2, and basic procedure is as follows：
(1) collects thalline after 28 DEG C of culture 16h of Agrobacterium, is transferred in YEP fluid nutrient mediums, until OD600 values 0.5~ 0.7 is standby；
(2) soybean acceptor kind Williams82 mature seeds, chlorination 16h are chosen.Seed is put into GM and sprouts after sterilizing Hair culture medium (culture medium prescription is with reference to OLHOFT etc.) dim light sprouts 16h；
(3) cotyledonary node is cut, soya seeds are divided into two from plumular axis, point of a knife dips in engineering bacterium solution when cutting.After incision Cotyledonary node is put into engineering bacterium solution, softly rocks 30min, is transferred in co-cultivation base, lucifuge culture (23 DEG C, 3~5d)；
(4) after co-culturing, the plumular axis of elongation is cut about 2/3, retains the plumular axis of about 5mm, insertion adds the SIM of selective agent to stretch In culture medium long, induction Multiple Buds growth, 25 DEG C of condition of culture, illumination 16h/d, intensity of illumination 2000lx；
(5) after cultivating 7d in SIM culture mediums, it is transferred in SEM screening and culturing mediums, is spaced 15d subcultures 1 time, screening 3~4 Wheel, obtains mitogenetic seedling；
(6) the mitogenetic seedling that will have been extended cuts from external body, is transferred in root media and takes root；
(7) take root sound transformation seedlings, moved into after hardening (3~5d) and cultivate in basin.
We are prepared for 849 soybean explants altogether in this experiment, and the explant for inducing has 354, final To T0 for 40 plants of transgenic regenerated plant, wherein it is 28 plants to be positive through Bar ELISA test strips, conversion ratio is close to 11.3%.
The detection of the marker gene test strips of the transfer-gen plant of embodiment 3
Because the marker gene on the plant expression vector pYL used in this research is the antiweed of streptomyces hygroscopicus Bar gene, therefore we can be by commercialized bar genes test strips (EnviroLogix, USA, article No.：010475) make It is that T0 is detected for the protein immunization of transgenic seedling marker gene.Application method takes out detector bar, and hand-held detector bar top is done Good detection mark.Diaphragm should not be removed.Keep detector bar vertical, during the end of mark is inserted into centrifuge tube or bag for extracting. Insertion portion does not exceed 0.5cm.Insert state is remained in detection process.There is nature controlling line in 3-5 minutes, it is most long anti- It it is 30 minutes between seasonable, now detector bar can be taken off.Nature controlling line is the accuracy for ensuring result of the test.If nature controlling line does not have Occur, it is invalid to detect.Because the mobility of sample is different, produce the time of signal also different.If sample is positive, inspection Survey line will appear from.If sample is negative, detection line will be occurred without.If it is desired to preserving testing result for a long time, sample can be cut Pad, is blotted with paper handkerchief, and this will prevent the liquid of remaining from disturbing result.The depth of detection line has reacted the content of detected albumen (Fig. 3).
The T0 of embodiment 4 is detected for the PCR of transfer-gen plant
Full length gene detection primer is designed according to FvC5SD gene orders, primer sequence is as follows：
Primer 1 (sense primer)：ATGGACGTCGTTCTCAACATCGCC；
Primer 2 (anti-sense primer)：TCAATCCAGTCGGAGAGCTGTGT.
Transformed soybean plant is extracted using CTAB methods and acceptor compares the genomic DNA of Williams82.
Using 28 T0 of above-mentioned primer pair inspection is expanded for the PCR that transformed plant genomic DNA carries out genes of interest FvC5SD Survey.
PCR reaction systems (20 μ l)：μ l, 2.5mM dNTPs2 the μ l of DNA profiling 50ng, 10 × buffer 2.0,10 μM are drawn Each μ l of 0.5 μ l, 5U/ μ l Taq enzymes 0.2 of thing, plus ddH2The μ of O to 20 l.PCR response procedures：95 DEG C of predegeneration 5min；94 DEG C of denaturation 30s, 56 DEG C of annealing 30s, 72 DEG C of extension 1min, 30 circulations；72 DEG C of extension 5min.
Pcr amplification product is separated by 1% agarose gel electrophoresis, and electrophoresis result is taken pictures using gel imaging system And analysis.
The PCR amplifications of FvC5SD genes in 28 T0 are for transformed plant as shown in figure 4, have 22 plants containing purposeful base Because of FvC5SD.
The genetically engineered soybean material drought tolerance of embodiment 5 is identified
We take the T1 generations of positive transgenic soybean of the two ways (PEG is coerced and soil drought) to being detected through PCR The seed of strain, carries out soybean seedling drought tolerance identification.
Wherein 1) method identified of PEG stress is：The seed of mature and plump is respectively put into seed soaking bag, will be planted with ultra-pure water Floating ash is removed in son cleaning, then with 75% alcohol disinfecting 1 minute (immersion)；Cleaned with ultra-pure water 2 times；0.1% mercury chloride sterilizing 10 Minute；2 times are cleaned with ultra-pure water and surface moisture is removed.Acceptor material and transgenic line seed are put into 9 centimetres of glass of diameter Put in glass culture dish it is neat, using two layers of filter paper as culture bed.Each culture dish puts 10 materials, using ultra-pure water as blank Control group, the PEG6000 stress with -0.5Mpa is treatment group, is cultivated in artificial climate culturing room, sets temperature 25 DEG C, dark condition treatment, humidity 70%, incubation time is 8 days.We from Fig. 5 (on) in it can be seen that same PEG under the conditions of, Germination percentage is higher than control CK in turning FvC5SD materials.
2) Soil Drought Stress：The transgenic line germinateed after PEG stress, with ultrapure water PEG solution and uses paper Root moisture is blotted, seedling is transplanted in planting pot, soil moisture content was 15% or so (enabling seedling transplanting survival).In moisture 1% (being measured using soil water-containing instrument) is reduced to, keeps soil Severe drought to coerce 7 days, rehydration makes soil water content normal Afterwards, it has been found that in transgenosis FvC5SD materials can also normal growth survive, and it is dead to compare non-transgenic material (CK).Pass through This authentication method, the transgenic line that we can obtain survival is drought-enduring transgenic line.
It should be noted that above-described embodiment is specific implementation example of the invention, but embodiments of the present invention are not It is restricted to the described embodiments, those skilled in the art can directly derive from present disclosure or all changing of associating Enter and change, be considered as protection scope of the present invention.
SEQ ID NO：1
<110>Jilin Academy of Agricultural Science
<120>Improve drought-enduring and antiweed performance the method for soybean
<130> 1
<160> 1
<170> PatentIn version 3.3
<210> 1
<211> 891
<212> DNA
<213>Flammulina velutipes
<400> 1
atggacgtcg ttctcaacat cgccgacgac tacgttctcg acaaagtctg gtcgtacata 60
gtgcccttga cgacgaacgc gacgcactgg gagccagcca gcaatactac cctcaccgtg 120
tctgcatggc ctcgcgacta cattccgcgc cagctggtct ctctctgcac aataacgctc 180
atcggcatcc atattctcta ttttgccttt gcatacgcat cctacaaatg gatatttaac 240
cacgacatga tgcgccatcc acgctttcta aagaaccaag tccgccttga gattatgacc 300
agcctcaagg cattccccgg gatgatgctc ttgactttac catggttcca ggcggaggtc 360
atgggctaca gcagactgta cgagggattg gacacatacg gctacactta ccttgtcctg 420
agcgtaccat tgttcctcct ctttacagac tacctcgtct actgggtgca cagaatacta 480
cacgttccag tgttttacaa ggctttgcac aagcctcatc ataaatggat cattcctaca 540
ccattcgcat cgcatgcttt ccaccccgtc gacggctatc ttcaatccat cccatatcat 600
cttttcgtct tcatattccc tctccatcgc attctctatc ttattctttt cgtggcggtc 660
aacttttgga ccatccttat tcacgactcc gacatgatca ccgggcaccc gctcgaaacc 720
ctcatcaatg gcccagcgca ccatacccta caccacatct attttacggt caactatggc 780
cagtacttca cctgggcgga tcgggccgga aactcgtatc gccagccaga aaagcacctc 840
gatcctttac tcgaagtgca agccttggga aaggaggaga aggtcgagta g 891
SEQ ID NO:2
<110>Jilin Academy of Agricultural Science
<120>Improve drought-enduring and antiweed performance the method for soybean
<130> 2
<160> 1
<170> PatentIn version 3.3
<210> 1
<211> 11219
<212> DNA
<213>Artificial sequence
<400> 1
agtactttaa agtactttaa agtactttaa agtactttga tccaacccct ccgctgctat 60
agtgcagtcg gcttctgacg ttcagtgcag ccgtcttctg aaaacgacat gtcgcacaag 120
tcctaagtta cgcgacaggc tgccgccctg cccttttcct ggcgttttct tgtcgcgtgt 180
tttagtcgca taaagtagaa tacttgcgac tagaaccgga gacattacgc catgaacaag 240
agcgccgccg ctggcctgct gggctatgcc cgcgtcagca ccgacgacca ggacttgacc 300
aaccaacggg ccgaactgca cgcggccggc tgcaccaagc tgttttccga gaagatcacc 360
ggcaccaggc gcgaccgccc ggagctggcc aggatgcttg accacctacg ccctggcgac 420
gttgtgacag tgaccaggct agaccgcctg gcccgcagca cccgcgacct actggacatt 480
gccgagcgca tccaggaggc cggcgcgggc ctgcgtagcc tggcagagcc gtgggccgac 540
accaccacgc cggccggccg catggtgttg accgtgttcg ccggcattgc cgagttcgag 600
cgttccctaa tcatcgaccg cacccggagc gggcgcgagg ccgccaaggc ccgaggcgtg 660
aagtttggcc cccgccctac cctcaccccg gcacagatcg cgcacgcccg cgagctgatc 720
gaccaggaag gccgcaccgt gaaagaggcg gctgcactgc ttggcgtgca tcgctcgacc 780
ctgtaccgcg cacttgagcg cagcgaggaa gtgacgccca ccgaggccag gcggcgcggt 840
gccttccgtg aggacgcatt gaccgaggcc gacgccctgg cggccgccga gaatgaacgc 900
caagaggaac aagcatgaaa ccgcaccagg acggccagga cgaaccgttt ttcattaccg 960
aagagatcga ggcggagatg atcgcggccg ggtacgtgtt cgagccgccc gcgcacgtct 1020
caaccgtgcg gctgcatgaa atcctggccg gtttgtctga tgccaagctg gcggcctggc 1080
cggccagctt ggccgctgaa gaaaccgagc gccgccgtct aaaaaggtga tgtgtatttg 1140
agtaaaacag cttgcgtcat gcggtcgctg cgtatatgat gcgatgagta aataaacaaa 1200
tacgcaaggg gaacgcatga aggttatcgc tgtacttaac cagaaaggcg ggtcaggcaa 1260
gacgaccatc gcaacccatc tagcccgcgc cctgcaactc gccggggccg atgttctgtt 1320
agtcgattcc gatccccagg gcagtgcccg cgattgggcg gccgtgcggg aagatcaacc 1380
gctaaccgtt gtcggcatcg accgcccgac gattgaccgc gacgtgaagg ccatcggccg 1440
gcgcgacttc gtagtgatcg acggagcgcc ccaggcggcg gacttggctg tgtccgcgat 1500
caaggcagcc gacttcgtgc tgattccggt gcagccaagc ccttacgaca tatgggccac 1560
cgccgacctg gtggagctgg ttaagcagcg cattgaggtc acggatggaa ggctacaagc 1620
ggcctttgtc gtgtcgcggg cgatcaaagg cacgcgcatc ggcggtgagg ttgccgaggc 1680
gctggccggg tacgagctgc ccattcttga gtcccgtatc acgcagcgcg tgagctaccc 1740
aggcactgcc gccgccggca caaccgttct tgaatcagaa cccgagggcg acgctgcccg 1800
cgaggtccag gcgctggccg ctgaaattaa atcaaaactc atttgagtta atgaggtaaa 1860
gagaaaatga gcaaaagcac aaacacgcta agtgccggcc gtccgagcgc acgcagcagc 1920
aaggctgcaa cgttggccag cctggcagac acgccagcca tgaagcgggt caactttcag 1980
ttgccggcgg aggatcacac caagctgaag atgtacgcgg tacgccaagg caagaccatt 2040
accgagctgc tatctgaata catcgcgcag ctaccagagt aaatgagcaa atgaataaat 2100
gagtagatga attttagcgg ctaaaggagg cggcatggaa aatcaagaac aaccaggcac 2160
cgacgccgtg gaatgcccca tgtgtggagg aacgggcggt tggccaggcg taagcggctg 2220
ggttgtctgc cggccctgca atggcactgg aacccccaag cccgaggaat cggcgtgagc 2280
ggtcgcaaac catccggccc ggtacaaatc ggcgcggcgc tgggtgatga cctggtggag 2340
aagttgaagg ccgcgcaggc cgcccagcgg caacgcatcg aggcagaagc acgccccggt 2400
gaatcgtggc aagcggccgc tgatcgaatc cgcaaagaat cccggcaacc gccggcagcc 2460
ggtgcgccgt cgattaggaa gccgcccaag ggcgacgagc aaccagattt tttcgttccg 2520
atgctctatg acgtgggcac ccgcgatagt cgcagcatca tggacgtggc cgttttccgt 2580
ctgtcgaagc gtgaccgacg agctggcgag gtgatccgct acgagcttcc agacgggcac 2640
gtagaggttt ccgcagggcc ggccggcatg gccagtgtgt gggattacga cctggtactg 2700
atggcggttt cccatctaac cgaatccatg aaccgatacc gggaagggaa gggagacaag 2760
cccggccgcg tgttccgtcc acacgttgcg gacgtactca agttctgccg gcgagccgat 2820
ggcggaaagc agaaagacga cctggtagaa acctgcattc ggttaaacac cacgcacgtt 2880
gccatgcagc gtacgaagaa ggccaagaac ggccgcctgg tgacggtatc cgagggtgaa 2940
gccttgatta gccgctacaa gatcgtaaag agcgaaaccg ggcggccgga gtacatcgag 3000
atcgagctag ctgattggat gtaccgcgag atcacagaag gcaagaaccc ggacgtgctg 3060
acggttcacc ccgattactt tttgatcgat cccggcatcg gccgttttct ctaccgcctg 3120
gcacgccgcg ccgcaggcaa ggcagaagcc agatggttgt tcaagacgat ctacgaacgc 3180
agtggcagcg ccggagagtt caagaagttc tgtttcaccg tgcgcaagct gatcgggtca 3240
aatgacctgc cggagtacga tttgaaggag gaggcggggc aggctggccc gatcctagtc 3300
atgcgctacc gcaacctgat cgagggcgaa gcatccgccg gttcctaatg tacggagcag 3360
atgctagggc aaattgccct agcaggggaa aaaggtcgaa aaggtctctt tcctgtggat 3420
agcacgtaca ttgggaaccc aaagccgtac attgggaacc ggaacccgta cattgggaac 3480
ccaaagccgt acattgggaa ccggtcacac atgtaagtga ctgatataaa agagaaaaaa 3540
ggcgattttt ccgcctaaaa ctctttaaaa cttattaaaa ctcttaaaac ccgcctggcc 3600
tgtgcataac tgtctggcca gcgcacagcc gaagagctgc aaaaagcgcc tacccttcgg 3660
tcgctgcgct ccctacgccc cgccgcttcg cgtcggccta tcgcggccgc tggccgctca 3720
aaaatggctg gcctacggcc aggcaatcta ccagggcgcg gacaagccgc gccgtcgcca 3780
ctcgaccgcc ggcgcccaca tcaaggcacc ctgcctcgcg cgtttcggtg atgacggtga 3840
aaacctctga cacatgcagc tcccggagac ggtcacagct tgtctgtaag cggatgccgg 3900
gagcagacaa gcccgtcagg gcgcgtcagc gggtgttggc gggtgtcggg gcgcagccat 3960
gacccagtca cgtagcgata gcggagtgta tactggctta actatgcggc atcagagcag 4020
attgtactga gagtgcacca tatgcggtgt gaaataccgc acagatgcgt aaggagaaaa 4080
taccgcatca ggcgctcttc cgcttcctcg ctcactgact cgctgcgctc ggtcgttcgg 4140
ctgcggcgag cggtatcagc tcactcaaag gcggtaatac ggttatccac agaatcaggg 4200
gataacgcag gaaagaacat gtgagcaaaa ggccagcaaa aggccaggaa ccgtaaaaag 4260
gccgcgttgc tggcgttttt ccataggctc cgcccccctg acgagcatca caaaaatcga 4320
cgctcaagtc agaggtggcg aaacccgaca ggactataaa gataccaggc gtttccccct 4380
ggaagctccc tcgtgcgctc tcctgttccg accctgccgc ttaccggata cctgtccgcc 4440
tttctccctt cgggaagcgt ggcgctttct catagctcac gctgtaggta tctcagttcg 4500
gtgtaggtcg ttcgctccaa gctgggctgt gtgcacgaac cccccgttca gcccgaccgc 4560
tgcgccttat ccggtaacta tcgtcttgag tccaacccgg taagacacga cttatcgcca 4620
ctggcagcag ccactggtaa caggattagc agagcgaggt atgtaggcgg tgctacagag 4680
ttcttgaagt ggtggcctaa ctacggctac actagaagga cagtatttgg tatctgcgct 4740
ctgctgaagc cagttacctt cggaaaaaga gttggtagct cttgatccgg caaacaaacc 4800
accgctggta gcggtggttt ttttgtttgc aagcagcaga ttacgcgcag aaaaaaagga 4860
tctcaagaag atcctttgat cttttctacg gggtctgacg ctcagtggaa cgaaaactca 4920
cgttaaggga ttttggtcat gcatgatata tctcccaatt tgtgtagggc ttattatgca 4980
cgcttaaaaa taataaaagc agacttgacc tgatagtttg gctgtgagca attatgtgct 5040
tagtgcatct aacgcttgag ttaagccgcg ccgcgaagcg gcgtcggctt gaacgaattt 5100
ctagctagac attatttgcc gactaccttg gtgatctcgc ctttcacgta gtggacaaat 5160
tcttccaact gatctgcgcg cgaggccaag cgatcttctt cttgtccaag ataagcctgt 5220
ctagcttcaa gtatgacggg ctgatactgg gccggcaggc gctccattgc ccagtcggca 5280
gcgacatcct tcggcgcgat tttgccggtt actgcgctgt accaaatgcg ggacaacgta 5340
agcactacat ttcgctcatc gccagcccag tcgggcggcg agttccatag cgttaaggtt 5400
tcatttagcg cctcaaatag atcctgttca ggaaccggat caaagagttc ctccgccgct 5460
ggacctacca aggcaacgct atgttctctt gcttttgtca gcaagatagc cagatcaatg 5520
tcgatcgtgg ctggctcgaa gatacctgca agaatgtcat tgcgctgcca ttctccaaat 5580
tgcagttcgc gcttagctgg ataacgccac ggaatgatgt cgtcgtgcac aacaatggtg 5640
acttctacag cgcggagaat ctcgctctct ccaggggaag ccgaagtttc caaaaggtcg 5700
ttgatcaaag ctcgccgcgt tgtttcatca agccttacgg tcaccgtaac cagcaaatca 5760
atatcactgt gtggcttcag gccgccatcc actgcggagc cgtacaaatg tacggccagc 5820
aacgtcggtt cgagatggcg ctcgatgacg ccaactacct ctgatagttg agtcgatact 5880
tcggcgatca ccgcttcccc catgatgttt aactttgttt tagggcgact gccctgctgc 5940
gtaacatcgt tgctgctcca taacatcaaa catcgaccca cggcgtaacg cgcttgctgc 6000
ttggatgccc gaggcataga ctgtacccca aaaaaacagt cataacaagc catgaaaacc 6060
gccactgcgc cgttaccacc gctgcgttcg gtcaaggttc tggaccagtt gcgtgacggc 6120
agttacgcta cttgcattac agcttacgaa ccgaacgagg cttatgtcca ctgggttcgt 6180
gcccgaattg atcacaggca gcaacgctct gtcatcgtta caatcaacat gctaccctcc 6240
gcgagatcat ccgtgtttca aacccggcag cttagttgcc gttcttccga atagcatcgg 6300
taacatgagc aaagtctgcc gccttacaac ggctctcccg ctgacgccgt cccggactga 6360
tgggctgcct gtatcgagtg gtgattttgt gccgagctgc cggtcgggga gctgttggct 6420
ggctggtggc aggatatatt gtggtgtaaa caaattgacg cttagacaac ttaataacac 6480
attgcggacg tttttaatgt actgaattaa cgccgaattg ctctagcatt cgccattcag 6540
gctgcgcaac tgttgggaag ggcgatcggt gcgggcctct tcgctattac gccagctggc 6600
gaaaggggga tgtgctgcaa ggcgattaag ttgggtaacg ccagggtttt cccagtcacg 6660
acgttgtaaa acgacggcca gtgccaagct aattcgcttc aagacgtgct caaatcacta 6720
tttccacacc cctatatttc tattgcactc ccttttaact gttttttatt acaaaaatgc 6780
cctggaaaat gcactccctt tttgtgtttg tttttttgtg aaacgatgtt gtcaggtaat 6840
ttatttgtca gtctactatg gtggcccatt atattaatag caactgtcgg tccaatagac 6900
gacgtcgatt ttctgcattt gtttaaccac gtggatttta tgacatttta tattagttaa 6960
tttgtaaaac ctacccaatt aaagacctca tatgttctaa agactaatac ttaatgataa 7020
caattttctt ttagtgaaga aagggataat tagtaaatat ggaacaaggg cagaagattt 7080
attaaagccg cggtaagaga caacaagtag gtacgtggag tgtcttaggt gacttaccca 7140
cataacataa agtgacatta acaaacatag ctaatgctcc tatttgaata gtgcatatca 7200
gcatacctta ttacatatag ataggagcaa actctagcta gattgttgag cagatctcgg 7260
tgacgggcag gaccggacgg ggcggtaccg gcaggctgaa gtccagctgc cagaaaccca 7320
cgtcatgcca gttcccgtgc ttgaagccgg ccgcccgcag catgccgcgg ggggcatatc 7380
cgagcgcctc gtgcatgcgc acgctcgggt cgttgggcag cccgatgaca gcgaccacgc 7440
tcttgaagcc ctgtgcctcc agggacttca gcaggtgggt gtagagcgtg gagcccagtc 7500
ccgtccgctg gtggcggggg gagacgtaca cggtcgactc ggccgtccag tcgtaggcgt 7560
tgcgtgcctt ccaggggccc gcgtaggcga tgccggcgac ctcgccgtcc acctcggcga 7620
cgagccaggg atagcgctcc cgcagacgga cgaggtcgtc cgtccactcc tgcggttcct 7680
gcggctcggt acggaagttg accgtgcttg tctcgatgta gtggttgacg atggtgcaga 7740
ccgccggcat gtccgcctcg gtggcacggc ggatgtcggc cgggcgtcgt tctgggctca 7800
tggtagatcc cccgttcgta aatggtgaaa attttcagaa aattgctttt gctttaaaag 7860
aaatgattta aattgctgca atagaagtag aatgcttgat tgcttgagat tcgtttgttt 7920
tgtatatgtt gtgttgagaa ttaattctcg aggtcctctc caaatgaaat gaacttcctt 7980
atatagagga agggtcttgc gaaggatagt gggattgtgc gtcatccctt acgtcagtgg 8040
agatatcaca tcaatccact tgctttgaag acgtggttgg aacgtcttct ttttccacga 8100
tgctcctcgt gggtgggggt ccatctttgg gaccactgtc ggtagaggca tcttgaacga 8160
tagcctttcc tttatcgcaa tgatggcatt tgtaggagcc accttccttt tccactatct 8220
tcacaataaa gtgacagata gctgggcaat ggaatccgag gaggtttccg gatattaccc 8280
tttgttgaaa agtctcaatt gccctttggt cttctgagac tgtatctttg atatttttgg 8340
agtagacaag tgtgtcgtgc tccaccatgt tatcacatca atccacttgc tttgaagacg 8400
tggttggaac gtcttctttt tccacgatgc tcctcgtggg tgggggtcca tctttgggac 8460
cactgtcggc agaggcatct tcaacgatgg cctttccttt atcgcaatga tggcatttgt 8520
aggagccacc ttccttttcc actatcttca caataaagtg acagatagct gggcaatgga 8580
atccgaggag gtttccggat attacccttt gttgaaaagt ctcaattgcc ctttggtctt 8640
ctgagactgt atctttgata tttttggagt agacaagtgt gtcgtgctcc accatgttga 8700
cctgcaggca tgcaagcttg catgcctgca ggtccccaga ttagcctttt caatttcaga 8760
aagaatgcta acccacagat ggttagagag gcttacgcag caggtctcat caagacgatc 8820
tacccgagca ataatctcca ggaaatcaaa taccttccca agaaggttaa agatgcagtc 8880
aaaagattca ggactaactg catcaagaac acagagaaag atatatttct caagatcaga 8940
agtactattc cagtatggac gattcaaggc ttgcttcaca aaccaaggca agtaatagag 9000
attggagtct ctaaaaaggt agttcccact gaatcaaagg ccatggagtc aaagattcaa 9060
atagaggacc taacagaact cgccgtaaag actggcgaac agttcataca gagtctctta 9120
cgactcaatg acaagaagaa aatcttcgtc aacatggtgg agcacgacac acttgtctac 9180
tccaaaaata tcaaagatac agtctcagaa gaccaaaggg caattgagac ttttcaacaa 9240
agggtaatat ccggaaacct cctcggattc cattgcccag ctatctgtca ctttattgtg 9300
aagatagtgg aaaaggaagg tggctcctac aaatgccatc attgcgataa aggaaaggcc 9360
atcgttgaag atgcctctgc cgacagtggt cccaaagatg gacccccacc cacgaggagc 9420
atcgtggaaa aagaagacgt tccaaccacg tcttcaaagc aagtggattg atgtgatatc 9480
tccactgacg taagggatga cgcacaatcc cactatcctt cgcaagaccc ttcctctata 9540
taaggaagtt catttcattt ggagagaaca cgggggactc tagaaacaga ggatccaaca 9600
gccccgggaa cagcctgcag aacagcacta gtatggacgt cgttctcaac atcgccgacg 9660
actacgttct cgacaaagtc tggtcgtaca tagtgccctt gacgacgaac gcgacgcact 9720
gggagccagc cagcaatact accctcaccg tgtctgcatg gcctcgcgac tacattccgc 9780
gccagctggt ctctctctgc acaataacgc tcatcggcat ccatattctc tattttgcct 9840
ttgcatacgc atcctacaaa tggatattta accacgacat gatgcgccat ccacgctttc 9900
taaagaacca agtccgcctt gagattatga ccagcctcaa ggcattcccc gggatgatgc 9960
tcttgacttt accatggttc caggcggagg tcatgggcta cagcagactg tacgagggat 10020
tggacacata cggctacact taccttgtcc tgagcgtacc attgttcctc ctctttacag 10080
actacctcgt ctactgggtg cacagaatac tacacgttcc agtgttttac aaggctttgc 10140
acaagcctca tcataaatgg atcattccta caccattcgc atcgcatgct ttccaccccg 10200
tcgacggcta tcttcaatcc atcccatatc atcttttcgt cttcatattc cctctccatc 10260
gcattctcta tcttattctt ttcgtggcgg tcaacttttg gaccatcctt attcacgact 10320
ccgacatgat caccgggcac ccgctcgaaa ccctcatcaa tggcccagcg caccataccc 10380
tacaccacat ctattttacg gtcaactatg gccagtactt cacctgggcg gatcgggccg 10440
gaaactcgta tcgccagcca gaaaagcacc tcgatccttt actcgaagtg caagccttgg 10500
gaaaggagga gaaggtcgag taggagctcg aatttccccg atcgttcaaa catttggcaa 10560
taaagtttct taagattgaa tcctgttgcc ggtcttgcga tgattatcat ataatttctg 10620
ttgaattacg ttaagcatgt aataattaac atgtaatgca tgacgttatt tatgagatgg 10680
gtttttatga ttagagtccc gcaattatac atttaatacg cgatagaaaa caaaatatag 10740
cgcgcaaact aggataaatt atcgcgcgcg gtgtcatcta tgttactaga tcgggaattc 10800
gtaatcatgt catagctgtt tcctgtgtga aattgttatc cgctcacaat tccacacaac 10860
atacgagccg gaagcataaa gtgtaaagcc tggggtgcct aatgagtgag ctaactcaca 10920
ttaattgcgt tgcgctcact gcccgctttc cagtcgggaa acctgtcgtg ccagctgcat 10980
taatgaatcg gccaacgcgc ggggagaggc ggtttgcgta ttggagcttg agcttggatc 11040
agattgtcgt ttcccgcctt cagtttaaac tatcagtgtt tgacaggata tattggcggg 11100
taaacctaag agaaaagagc gtttattaga ataatcggat atttaaaagg gcgtgaaaag 11160
gtttatccgt tcgtccattt gtatgtgcat gccaaccaca gggttcccct cgggatcaa 11219

Claims (11)

1. the DNA of plants containing genes of interest recombinates binary expression vector, it is characterized in that, introduced in FvC5SD upstream region of gene respectively Restriction endonuclease SpeI restriction enzyme sites, downstream introduce restriction endonuclease SacI restriction enzyme sites, by double methods for cutting doubly-linked carry out SpeI and After SacI digestions, it is connected to pYL plasmids and obtains.
2. the DNA of plants containing genes of interest recombinates binary expression vector according to claim 1, it is characterized in that, it is described FvC5SD comes from mushroom, sequence 891bp, its sequence such as SEQ ID NO：Shown in 1.
3. DNA of plants recombinates binary expression vector according to claim 1, it is characterized in that, the carrier full length sequence such as SEQ ID NO:Shown in 2.
4. the binary expression vector containing genes of interest described in claim 1 is improving answering for Genes For Plant Tolerance herbicide aspect of performance With.
5. the binary expression vector containing genes of interest according to claim 1 is improving Soybean Resistance herbicide aspect of performance Application.
6. a kind of transgenic engineering bacterial strain, is characterised by, is as the DNA of plants weight containing genes of interest described in claim 1 Group binary expression vector is obtained in being transferred to Agrobacterium EHA101.
7. a kind of utilization transgenic technology improves drought-enduring and antiweed performance the method for soybean, it is characterised in that methods described It is the soybean cotyledon genetic transformation of the transgenic engineering bacterial strain mediation described in claim 5.
8. utilization transgenic technology according to claim 6 improves drought-enduring and antiweed performance the method for soybean, feature It is that soybean acceptor kind is Williams82.
9. utilization transgenic technology according to claim 6 improves drought-enduring and antiweed performance the method for soybean, wherein Obtain the T of antiweed performance0The step of for plant, is as follows：
(1) collects thalline after 28 DEG C of culture 16h of Agrobacterium, is transferred in YEP fluid nutrient mediums, until OD600Value 0.5~0.7 is standby With；
(2) selection soybean acceptor kind Williams82 mature seeds, chlorination 16h, seed is put into GM sprouting trainings after sterilizing Support base (culture medium prescription is with reference to OLHOFT etc.) dim light and sprout 16h；
(3) cotyledonary node is cut, soya seeds are divided into two from plumular axis, point of a knife dips in engineering bacterium solution when cutting, by the cotyledon after incision Section is put into engineering bacterium solution, softly rocks 30min, is transferred in co-cultivation base, lucifuge culture (23 DEG C, 3~5d)；
(4) after co-culturing, the plumular axis of elongation is cut about 2/3, retains the plumular axis of about 5mm, insertion plus the SIM elongation trainings of selective agent Support in base, induction Multiple Buds grow, 25 DEG C of condition of culture, illumination 16h/d, intensity of illumination 2000lx；
(5) after cultivating 7d in SIM culture mediums, it is transferred in SEM screening and culturing mediums, is spaced 15d subcultures 1 time, screening 3~4 is taken turns, and obtains To mitogenetic seedling；
(6) the mitogenetic seedling that will have been extended cuts from external body, is transferred in root media and takes root；
(7) take root sound transformation seedlings, moved into after hardening (3~5d) and cultivate in basin, obtain TO for transfer-gen plant.
10. utilization transgenic technology according to claim 6 improves drought-enduring and antiweed performance the method for soybean, and it is special Levying is, the method for obtaining antiweed and drought-enduring soybean material is as follows：
(1) method such as application Bar ELISA test strips, phosphine oxamate herbicide smearing, the amplification of FvC5SD gene PCRs is to T0Generation conversion is planted Strain carries out Screening and Identification, obtains positive plant；
(2) selfing is carried out to positive plant and obtains T1For seed；
(3) T is cultivated1For soybean plant strain, to T1Enter performing PCR Molecular Detection for positive plant；
(4) T with positive transgenic soybean of the soil drought to being detected through PCR is coerced by PEG1For the seed of strain, carry out big Bean seedlings phase drought tolerance is identified, obtains turning the drought-enduring soybean material of FvC5SD genes.
11. utilization transgenic technologys according to claim 9 improve drought-enduring and antiweed performance the method for soybean, and it is special Levying is：
(1) method that the PEG stress is identified is：The seed of mature and plump is respectively put into seed soaking bag, with ultra-pure water by seed Floating ash is removed in cleaning, then with 75% alcohol disinfecting 1 minute (immersion)；Cleaned with ultra-pure water 2 times；0.1% mercury chloride sterilizes 10 points Clock；2 times are cleaned with ultra-pure water and surface moisture is removed；Acceptor material and transgenic line seed are put into 9 centimetres of glass of diameter Put in culture dish it is neat, using two layers of filter paper as culture bed；Each culture dish puts 10 materials, using ultra-pure water as blank pair According to group, the PEG6000 stress with -0.5Mpa is treatment group, is cultivated in artificial climate culturing room, sets 25 DEG C of temperature, Dark condition treatment, humidity 70%, incubation time is 8 days；We from Fig. 5 (on) in it can be seen that same PEG under the conditions of, turn Germination percentage is higher than control CK in FvC5SD materials；
(2) the Soil Drought Stress method is：The transgenic line germinateed after PEG stress, with ultrapure water PEG solution Root moisture is blotted with paper, seedling is transplanted in planting pot, soil moisture content was 15% or so (enabling seedling transplanting survival)； 1% (being measured using soil water-containing instrument) is reduced in moisture, keeps soil Severe drought to coerce 7 days, rehydration allows soil moisture to contain After amount is normal, the transgenic line that selection normal growth is survived is used as drought-enduring transgenic line.
CN201710142894.1A 2017-03-10 2017-03-10 Improve drought-enduring and antiweed performance the method for soybean Pending CN106916846A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201710142894.1A CN106916846A (en) 2017-03-10 2017-03-10 Improve drought-enduring and antiweed performance the method for soybean

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710142894.1A CN106916846A (en) 2017-03-10 2017-03-10 Improve drought-enduring and antiweed performance the method for soybean

Publications (1)

Publication Number Publication Date
CN106916846A true CN106916846A (en) 2017-07-04

Family

ID=59460387

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710142894.1A Pending CN106916846A (en) 2017-03-10 2017-03-10 Improve drought-enduring and antiweed performance the method for soybean

Country Status (1)

Country Link
CN (1) CN106916846A (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016120657A1 (en) * 2014-12-25 2016-08-04 National Institute Of Plant Genome Research Polynucleotide associated with ergosterol biosynthesis and uses thereof
CN106434742A (en) * 2016-11-11 2017-02-22 吉林省农业科学院 Method for expressing canine distemper proteins by aid of soybeans

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016120657A1 (en) * 2014-12-25 2016-08-04 National Institute Of Plant Genome Research Polynucleotide associated with ergosterol biosynthesis and uses thereof
CN106434742A (en) * 2016-11-11 2017-02-22 吉林省农业科学院 Method for expressing canine distemper proteins by aid of soybeans

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
AYUSHI KAMTHAN ET AL.: "Expression of a fungal sterol desaturase improves tomato drought tolerance, pathogen resistance and nutritional quality", 《SCIENTIFIC REPORTS》 *

Similar Documents

Publication Publication Date Title
CN107043779B (en) Application of CRISPR/nCas 9-mediated site-specific base substitution in plants
CN112279903B (en) Gene for improving rice blast resistance of rice in panicle stage and application thereof
CN106929532B (en) Artificially creating male sterile line of maize and efficient transfer method
CN112941087B (en) Application of corn ZmBES1/BZR1-2 gene in improving plant drought tolerance
CN110229843B (en) Upland cotton transformation event 19PFA1-135-17 and specificity identification method thereof
CN103966235A (en) Eggplant anthocyanin synthesis-related gene SmMYB1 as well as recombinant expression vector thereof and application of gene SmMYB1 in purple tomato culture
CN107417779B (en) Plant aluminum-resistant related protein GmGRPL and coding gene and application thereof
CN117088957B (en) Application of tomato SlMYB13 protein and encoding gene thereof in regulation and control of salt tolerance and drought tolerance of plants
CN111593031B (en) Rice ALS mutant gene, plant transgenic screening vector pCALSm3 containing gene and application thereof
CN110564752B (en) Application of differential agent technology in enrichment of C.T base substitution cells
CN107142275A (en) Applications of the eary maturity of grape gene VvWRKY13 in regulation and control plant in Synthesis pathway
CN106916846A (en) Improve drought-enduring and antiweed performance the method for soybean
CN113185590B (en) Gene for regulating early heading and flowering of rice and application thereof
CN106636193A (en) Method for regulating flowering time of chrysanthemum by RNAi (Ribonucleic Acid interfere) carrier
CN114163509A (en) Chinese cabbage PAO gene and application thereof in regulation and control of plant stay green character
CN108866080B (en) Tomato stress response gene, recombinant expression vector thereof and application thereof in cultivation of salt-tolerant tomatoes
CN111411098B (en) Rice ALS mutant gene, plant transgenic screening vector pCALSm2 containing gene and application thereof
CN111471684B (en) Plant constitutive promoter ALSpro and application thereof
CN108486112A (en) A kind of promoter with anther tissue specificity
CN109112130B (en) High-salt and aging specific induction promoter, engineering vector and application
CN107312794A (en) Rose RrNUDX1 genes are changing the interim application of plant flowers
CN105255859B (en) Method for improving abiotic stress resistance of plants
CN111560396B (en) Plant transgenic screening vector pCALSm1 and application thereof
CN113373157B (en) Application of GF14C gene in improving salt resistance of rice
CN108949764B (en) Dark and aging specific induction promoter, engineering vector and application

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication

Application publication date: 20170704

RJ01 Rejection of invention patent application after publication