CN106868127A

CN106868127A - People's KRAS gene multipoint mutation single tube joint inspections fluorescence PCR method, kit and system

Info

Publication number: CN106868127A
Application number: CN201710090387.8A
Authority: CN
Inventors: 黄临迷; 宋卓; 袁梦兮
Original assignee: Human And Future Biotechnology (changsha) Co Ltd
Current assignee: Human And Future Biotechnology (changsha) Co Ltd
Priority date: 2017-02-20
Filing date: 2017-02-20
Publication date: 2017-06-20
Anticipated expiration: 2037-02-20
Also published as: CN106868127B

Abstract

The invention discloses a kind of people KRAS genes multipoint mutation single tube joint inspection fluorescence PCR method, kit and system.Method includes：In fluorescent PCR system, Fluorescence PCR is carried out as template using the DNA in the site of KRAS gene mutation containing someone, wherein fluorescent PCR system includes：Upstream primer sequence, the downstream primer sequence for detecting the various mutational sites of KRAS, the fluorescence probe sequence for detecting the various mutational sites of KRAS for detecting KRASGly12Asp mutational sites；Taq enzyme, UNG enzymes, dNTPs, dUTP, Mg²⁺With PCR buffer solutions；First additive and Second addition, the first additive include bovine serum albumin(BSA), and Second addition includes dimethyl sulfoxide (DMSO), NH₄Cl and aqueous sorbitol solution.The present invention can be in 7 kinds of hot spot mutations on joint-detection KRAS genes the 12nd and the 13rd bit codon in single tube PCR reactions.

Description

People's KRAS gene multipoint mutation single tube joint inspections fluorescence PCR method, kit and system

Technical field

The present invention relates to the horizontal detection technique field of gene methylation, more particularly to a kind of people KRAS genes multipoint mutation list Pipe joint inspection fluorescence PCR method, kit and system.

Background technology

Excrement both containing the normal Colon and rectum epithelial cell that comes off and free DNA, also containing largely from colorectal cancer The cancer cell and free cancer DNA for coming off；Again because enteron aisle is alkaline environment, be conducive to the preservation of DNA, make to be extracted from excrement DNA mass it is preferable.Therefore excrement gene methylation is straight as a kind of non-invasive knot new, that susceptibility is high, specificity is medium Phleboedesis tumor markers, can further be detected, as the early screening of related neoplasms according to its positive findings to suspected case Means have critically important clinical value.

Paraffin tissue sections are applied not only to observe the morphosis of normal cell tissue, are additionally operable to study, observe and judge The Main Means of the metamorphosis of cell tissue, due to biological tissue by can be intact after fixation, FFPE preservation its Morphosis, substantial amounts of intracellular DNA inhereditary materials be able to it is intact be stored in the middle of paraffin organization, by dewaxing, cell dissociation, The DNA inhereditary materials that the steps such as DNA extractions can preserve these are discharged.Meanwhile, paraffin tissue sections are also one The effective means for obtaining a large amount of human body flesh tissue samples in a short time is planted, and part research is related to retrospective analysis, it is also desirable to borrow Help the formalin fix paraffin-embedded tissue that pathology department etc. preserves for a long time.Therefore, either as the early stage of related neoplasms Examination means, or Tumorigenesis are illustrated from gene level, paraffin section tissue all has critically important early detection, grinds Study carefully and use clinical value.

RAS gene families have three kinds of HRAS, KRAS and NRAS with the closely related gene of human tumor, and these three genes are compiled The amino acid sequence homologous of the protein about 90% of code, molecular weight is 21KDa, is also called RASp21 albumen.KRAS believes Number path is the downstream passages of EGFR and other signal transductions, when RAS genes are undergone mutation, the RAS proteolysis of its coding GTP-RAS abilities decline so that signal transduction pathway is constantly in sustained activation state, stimulate the continuous Proliferation, Differentiation of cell, most Cause malignant change of cell eventually.KRAS gene is a kind of common oncogene, malignant tumour is more common in, in colorectal cancer patients There are about 30%~40% and there is KRAS gene mutation, 15%~30% is there are about in patients with lung adenocarcinoma and there is KRAS.KRAS dashes forward Change is primarily located within the 12nd, 13,61 and No. 63 codons, wherein there is 7 mutantional hotspots：Gly12Asp、Gly12Val、 Gly12Ser, Gly12Cys, Gly12Ala, Gly12Arg and Gly13Asp totally 7 class hot spot mutation, account for the always mutation of KRAS genes More than 90%.

Research shows, the primary of KRAS gene mutation and NSCLC to target therapeutic agents such as Gefitinib, Tarcevas Resistance is relevant.Studies have found that the mutation of KRAS genes makes treatment of the colorectal cancer patients to Cetuximab produce drug resistance. NCCN (non-small cell lung cancer clinical practice guideline 2016 editions) points out that KRAS gene mutation can make patients with lung cancer to EGFR tyrosine Kinase inhibitor (EGFT-TKI) produces resistance；Colorectal cancer patients is resisted EGFR antibody classes medicine and produce resistance.So Before NCCN (non-small cell lung cancer clinical practice guideline 2016 editions) proposes that patients with lung adenocarcinoma receives the treatment of EGFR targeted drugs, must KRAS gene mutation detection must be carried out, decides whether to use EGFR targeted drugs as clinical treatment measure according to testing result. Therefore risk profile is continued to KRAS gene mutation, the important prediction that whether can be produced as EGFR targeted therapy drug resistances refers to Mark.

The method of gene mutation mainly has 3 kinds in current clinical detection DNA：1) direct sequencing, is that application is most at present A kind of detection method, mainly Sanger sequencing, when mutator obtain effectively enrichment after, can just be sequenced, advantage is Result accurately and reliably, can read detected sequence information, but it is effectively enriched with mutator region, and in mutator content Greatly challenge is faced in the case of low, is generally used to confirm other detection positive findingses.2) fluorescence quantitative PCR method, in fluorescence On quantitative PCR platform, enter performing PCR using special primer pair DNA mutation target sequence and expand, using fluorescence labeling probe to amplification Product carries out abrupt climatic change, and such detection method high specificity, sensitivity are high, the mutation of detectable DNA content as little as 1%, But the single abrupt climatic change flux of current single tube is low, and probe is costly, it is difficult to adapt to the risk profile of clinical big flux sample.3) High throughput sequencing technologies method, is typically enriched with using round pcr to target area, is then built and is suitable for machine sequencing on NGS Library, finally go up machine sequencing, information analysis obtain interesting target regional sequence information.But it is rich to target area at present During collection, the specificity and validity Library development flow big in different experiment porch gaps and common of enrichment are numerous and diverse, week Phase is long, high cost, and whether these factors all cause the limiting factor for needing to carry out high-flux sequence.

Therefore, a kind of flux, result of improving is badly in need of at present and differentiates KRAS genes in the middle of quick clearly various biological specimens Whether the method that mutation carries out risk profile, need to further discriminate between mutation type or carry out high flux for clinic is provided Sequencing provides basis for estimation.

The content of the invention

The present invention provides a kind of people KRAS genes multipoint mutation single tube joint inspection fluorescence PCR method, kit and system, in list 7 kinds of hot spot mutations in pipe PCR reactions on joint-detection KRAS genes the 12nd and the 13rd bit codon.

According to the first aspect of the invention, the present invention provides a kind of people KRAS genes multipoint mutation single tube joint inspection fluorescent PCR Method, including：

In fluorescent PCR system, Fluorescence PCR is carried out as template using the DNA in the site of KRAS gene mutation containing someone, Wherein above-mentioned fluorescent PCR system includes：

A () is used to detect the upstream primer sequence in KRAS Gly12Asp mutational sites：

GAATATAAACTTGTGGTAGTTGGAGCdIGA(SEQ ID NO：1),

Upstream primer sequence for detecting KRAS Gly12Ala mutational sites：

GGAATATAAACTTGTGGTAGTTGGAGCdIGC(SEQ ID NO：2),

Upstream primer sequence for detecting KRAS Gly12Val and Gly12Ser mutational sites：

GAATATAAACTTGTGGTAGTTGGAGCdIGT(SEQ ID NO：3),

Upstream primer sequence for detecting KRAS Gly12Arg and Gly12Cys mutational sites：

GGAATATAAACTTGTGGTAGTTGGAGdITC(SEQ ID NO：4),

Upstream primer sequence for detecting KRAS Gly13Asp mutational sites：

GGAATATAAACTTGTGGTAGTTGGAGCTGGdIGT(SEQ ID NO：5),

Wherein, the dI in above-mentioned upstream primer sequence represents deoxyinosine nucleotides；

B () is used to detect the downstream primer sequence in the various mutational sites of KRAS：

CCTCTATTGTTGGATCATATTCGT(SEQ ID NO：6)；

C () is used to detect the fluorescence probe sequence in the various mutational sites of KRAS：

GAGTGCCTTGACGATACAGCTAATTC(SEQ ID NO：7),

Wherein, 5 ' ends of above-mentioned fluorescence probe sequence have fluorophor, and 3 ' ends have quenching group；

(d) Taq enzyme, UNG enzymes (Uracil-N-glycosylase, uracil-N-glycosylase), dNTPs (including dATP、dCTP、dGTP、dTTP)、dUTP、Mg²⁺With PCR buffer solutions；

E () the first additive and Second addition, above-mentioned first additive include bovine serum albumin(BSA), above-mentioned second addition Agent includes dimethyl sulfoxide (DMSO), NH₄Cl and aqueous sorbitol solution.

Further, above-mentioned fluorophor is FAM, and above-mentioned quenching group is BHQ1.Certainly, fluorophor can also be Other fluorophors such as HEX, TET, quenching group can also be other quenching groups such as TAMRA.

Further, also include in above-mentioned fluorescent PCR system：

For the interior label sequence of KRAS monitoring, including：

Upstream primer sequence is：CCTAGTAGGAAATAAATGTGATTTGCC(SEQ ID NO：8),

Fluorescence probe sequence is：

TAGAACAGTAGACACAAAACAGGCTCAGGACTT(SEQ ID NO：9),

Downstream primer sequence is：CTGTCTTGTCTTTGCTGATGTTTCA(SEQ ID NO：10),

Wherein, 5 ' ends of above-mentioned fluorescence probe sequence have fluorophor VIC, and 3 ' ends have quenching group BHQ1.

Further, contain in every above-mentioned fluorescent PCR systems of 50 μ L：

Taq enzyme, 2 units of UNG enzymes；The μ L of dUTP 0.4 of the dNTPs and 2.5mM of 10mM；The Mg of 50mM²⁺1.5μL；10× The μ L of PCR buffer solutions 5；Respective 1~2 the μ L, 10 μM of the μ L of probe sequence 3~4 of 10 μM of primer sequence；KRAS gene mutation containing someone 20~the 40ng of DNA in site；10mg/mL bovine serum albumin(BSA)s 2 μ L, dimethyl sulfoxide (DMSO), 250mM NH₄Cl and 60% sorbose The μ L of alcohol solution 1.25, and surplus water.

Further, also contain in above-mentioned every above-mentioned fluorescent PCR systems of 50 μ L：

The respective 1 μ L of 10 μM of above-mentioned interior target primer sequence, and 10 μM of μ L of above-mentioned interior target probe sequence 0.5；On Stating interior target primer sequence and probe sequence includes：

For the interior label sequence of KRAS monitoring, including：

Upstream primer sequence is：CCTAGTAGGAAATAAATGTGATTTGCC(SEQ ID NO：8),

Fluorescence probe sequence is：

TAGAACAGTAGACACAAAACAGGCTCAGGACTT(SEQ ID NO：9),

Downstream primer sequence is：CTGTCTTGTCTTTGCTGATGTTTCA(SEQ ID NO：10),

Further, the program of above-mentioned Fluorescence PCR is：

50 DEG C of reaction 2min；95 DEG C of reaction 5min；95 DEG C of reaction 15s and then 60 DEG C of reaction 30s carry out 15 circulations；95℃ Reaction 15s and then 60 DEG C of reaction 30s carry out 30 and circulate and collect fluorescence signal；20 DEG C of reaction 2min.

According to the second aspect of the invention, the present invention provides a kind of people KRAS genes multipoint mutation single tube joint inspection fluorescent PCR Kit, including：

GAATATAAACTTGTGGTAGTTGGAGCdIGA(SEQ ID NO：1),

Upstream primer sequence for detecting KRAS Gly12Ala mutational sites：

GGAATATAAACTTGTGGTAGTTGGAGCdIGC(SEQ ID NO：2),

GAATATAAACTTGTGGTAGTTGGAGCdIGT(SEQ ID NO：3),

GGAATATAAACTTGTGGTAGTTGGAGdITC(SEQ ID NO：4),

Upstream primer sequence for detecting KRAS Gly13Asp mutational sites：

GGAATATAAACTTGTGGTAGTTGGAGCTGGdIGT(SEQ ID NO：5),

CCTCTATTGTTGGATCATATTCGT(SEQ ID NO：6)；

GAGTGCCTTGACGATACAGCTAATTC(SEQ ID NO：7),

(d) Taq enzyme, UNG enzymes, dNTPs, dUTP, Mg²⁺With PCR buffer solutions；

E () the first additive and Second addition, above-mentioned first additive include bovine serum albumin(BSA), above-mentioned second addition Agent includes dimethyl sulfoxide (DMSO), NH₄Cl and aqueous sorbitol solution；

Optionally, (f) is used for the interior label sequence of KRAS monitoring, including：

Upstream primer sequence is：CCTAGTAGGAAATAAATGTGATTTGCC(SEQ ID NO：8),

Fluorescence probe sequence is：

TAGAACAGTAGACACAAAACAGGCTCAGGACTT(SEQ ID NO：9),

Downstream primer sequence is：CTGTCTTGTCTTTGCTGATGTTTCA(SEQ ID NO：10),

Further, above-mentioned fluorophor is FAM, and above-mentioned quenching group is BHQ1.

According to the third aspect of the invention we, the present invention provides a kind of people KRAS genes multipoint mutation single tube joint inspection fluorescent PCR Reaction system, every above-mentioned Fluorescence PCR systems of 50 μ L include：

(1) 10 μM of primer sequence respective 1~2 μ L, respective 3~4 μ L of 10 μM of probe sequence；Wherein, above-mentioned primer sequence Row and probe sequence include：

(1a) is used to detect the upstream primer sequence in KRAS Gly12Asp mutational sites：

GAATATAAACTTGTGGTAGTTGGAGCdIGA(SEQ ID NO：1),

Upstream primer sequence for detecting KRAS Gly12Ala mutational sites：

GGAATATAAACTTGTGGTAGTTGGAGCdIGC(SEQ ID NO：2),

GAATATAAACTTGTGGTAGTTGGAGCdIGT(SEQ ID NO：3),

GGAATATAAACTTGTGGTAGTTGGAGdITC(SEQ ID NO：4),

Upstream primer sequence for detecting KRAS Gly13Asp mutational sites：

GGAATATAAACTTGTGGTAGTTGGAGCTGGdIGT(SEQ ID NO：5),

(1b) is used to detect the downstream primer sequence in the various mutational sites of KRAS：

CCTCTATTGTTGGATCATATTCGT(SEQ ID NO：6)；

(1c) is used to detect the fluorescence probe sequence in the various mutational sites of KRAS：

GAGTGCCTTGACGATACAGCTAATTC(SEQ ID NO：7),

(2) Taq enzyme, 2 units of UNG enzymes；The μ L of dUTP 0.4 of the dNTPs and 2.5mM of 10mM；The Mg of 50mM²⁺1.5μL； The μ L of 10 × PCR buffer solutions 5；

The μ L of (3) first additive 2, the μ L of Second addition 1.25, above-mentioned first additive include 10mg/mL bovine serum albumins In vain, above-mentioned Second addition includes dimethyl sulfoxide (DMSO), 250mM NH₄Cl and 60% aqueous sorbitol solution；

(4) 20~40ng of DNA in the site of KRAS gene mutation containing someone；And

(5) water of surplus.

The respective 1 μ L of (6) 10 μM of interior target primer sequence, and 10 μM of μ L of interior target probe sequence 0.5, wherein above-mentioned Interior target primer sequence and probe sequence include the interior label sequence for KRAS monitoring, including：

Upstream primer sequence is：CCTAGTAGGAAATAAATGTGATTTGCC(SEQ ID NO：8),

Fluorescence probe sequence is：

TAGAACAGTAGACACAAAACAGGCTCAGGACTT(SEQ ID NO：9),

Downstream primer sequence is：CTGTCTTGTCTTTGCTGATGTTTCA(SEQ ID NO：10),

Beneficial effects of the present invention are embodied in：The present invention solves the class focus of joint-detection KRAS genes 7 in single tube reaction The problem of mutation, conventional kit is usually the single hot spot mutation of single tube reaction detection, this KRAS gene associations detection hand Section saves material resources and human cost, for the KRAS gene mutation detection of great amount of samples provides approach.Additionally, conventional reagent Box generally carries out interpretation to testing result using the algorithm of △ △ CT, and 100ng wild type humans DNA is to be also easy to produce stronger non-specificity Amplification, causes result to differentiate unclear caused false positive results.And testing result interpretation quicklook of the present invention, KRAS genes connection Algorithm of the detection means without △ △ CT is closed, without amplified signal in 200ng people DNA, there is mutation to have amplified signal, as a result sentenced It is quick not clear.

Brief description of the drawings

Fig. 1 can detect fluorescence signal for mutant sequences, and the principle of wild-type sequence detection unstressed configuration signal is illustrated Figure, wherein dI (deoxyInosine) is the end of deoxyinosine modification 3 ' the 3rd base reciprocal, and its adhesion is weak；

Fig. 2 is for negative with reference to the class hot spot mutation target area detection signal FAM of people DNA 200ng (100%) KRAS genes 7 Fluorescence curve figure；

Fig. 3 is for negative with reference to the class hot spot mutation internal standard region detection signal VIC of people DNA 200ng (100%) KRAS genes 7 Fluorescence curve figure；

Fig. 4 is the class mutant plasmid 5*10 of KRAS genes 7²The detection of copy (1%)+people DNA 200ng (99%) target area Signal FAM fluorescence curve figures；

Fig. 5 is the class mutant plasmid 5*10 of KRAS genes 7²Copy (1%)+people DNA 200ng (99%) internal standard region detection Signal VIC fluorescence curve figures；

Fig. 6 is the class mutant plasmid 5*10 of KRAS genes 7⁴The detection of copy (50%)+people DNA 200ng (50%) target area Signal FAM fluorescence curve figures；

Fig. 7 is the class mutant plasmid 5*10 of KRAS genes 7⁴Copy (50%)+people DNA 200ng (50%) internal standard region detection Signal VIC fluorescence curve figures；

The class hot spot mutation target area detection signal FAM of Fig. 8 behaviour fecal sample DNA 100ng (100%) KRAS genes 7 Fluorescence curve figure；

The class hot spot mutation internal standard region detection signal VIC of Fig. 9 behaviour fecal sample DNA 100ng (100%) KRAS genes 7 Fluorescence curve figure；

Figure 10 behaves, and 7 class hot spot mutation target area detection signal FAM are glimmering for free blood DNA 3ng (100%) KRAS genes Distribution curve flux；

Figure 11 behaves, and 7 class hot spot mutation internal standard region detection signal VIC are glimmering for free blood DNA 3ng (100%) KRAS genes Distribution curve flux.

Specific embodiment

The present invention is described in further detail below by specific embodiment combination accompanying drawing.

Present inventor has performed a series of researchs, and in research human faecal mass DNA, the KRAS gene of paraffin section DNA A kind of new people KRAS gene multipoint mutation single tube joint inspection fluorescence PCR methods and kit are invented during detection, has there is nondiagnostic Purposes.Detection method of the invention designs primer and its probe for the class hot spot mutation (table 1) of people KRAS genes 7, i.e., by right The upstream specificity ARMS design of primers of the class hot spot mutation gene of KRAS genes 7 and base modification (Fig. 1) in above-mentioned biological specimen, Downstream shares Taq-man probes and primer, with reference to the PCR reaction solutions and efficient Taq enzyme of optimization, and further to PCR amplification bodies DNTPs, Mg ion, NH in the middle of system₄The chemistry examination such as Cl, bovine serum albumin(BSA) (BSA), dimethyl sulfoxide (DMSO) (DMSO), D-sorbite The addition of agent special ratios composition, to reach the optimal reaction system condition of ARMS-PCR primers work, to PCR amplification steps Optimization, with reference to q-PCR platforms, realizes the joint-detection (not differentiating between specific mutation type) of the class hot spot mutation gene of KRAS genes 7, Simultaneously false positive situation is occurred without under the wild type human DNA backgrounds of 200ng/ reactions without amplified signal, testing result is quick, Intuitively, conveniently differentiated.

Table 1 KRAS genes, 7 kinds of common mutations

Specific primer used in the present invention and its probe sequence include：

GAATATAAACTTGTGGTAGTTGGAGCdIGA(SEQ ID NO：1),

Upstream primer sequence for detecting KRAS Gly12Ala mutational sites：

GGAATATAAACTTGTGGTAGTTGGAGCdIGC(SEQ ID NO：2),

GAATATAAACTTGTGGTAGTTGGAGCdIGT(SEQ ID NO：3),

GGAATATAAACTTGTGGTAGTTGGAGdITC(SEQ ID NO：4),

Upstream primer sequence for detecting KRAS Gly13Asp mutational sites：

GGAATATAAACTTGTGGTAGTTGGAGCTGGdIGT(SEQ ID NO：5),

CCTCTATTGTTGGATCATATTCGT(SEQ ID NO：6)；

GAGTGCCTTGACGATACAGCTAATTC(SEQ ID NO：7),

DI in upstream primer sequence is located at 3 ' ends the 3rd base reciprocal, the presence of the base so that itself and target area Adhesion die down, once so that the base of the end of primer sequence 3 ' can not be matched with target area, then be difficult to expand Increase reaction, that is, in the case of wild-type sequence, the base of 3 ' ends can not be matched, then amplification cannot occur anti- Should；And in the case of mutant sequences, the base of 3 ' ends can still be matched, there is amplified reaction.Therefore, it is above-mentioned The ingehious design of specific primer and its probe sequence, it is ensured that the class hot spot mutation of joint-detection KRAS genes 7 in single tube reaction.

The present invention also uses UNG enzymes, the uracil glucosides in its selective hydrolysis double-strand of the fracture containing dU or single stranded DNA Key, the DNA for having missing base of formation can further hydrolytic cleavage under alkaline medium and high temperature.Therefore in UNG enzymes and The system that dUTP is present, can eliminate and prevent pollution.For example, the step of 50 DEG C of reaction 2min are set before PCR reactions, making UNG enzyme effects amplified production that may be present in the middle of U bases cut-out environment, to exclude the false positive knot that thus may cause Really, make testing result more accurate.

The present invention uses bovine serum albumin(BSA) as the first additive, and contains dimethyl sulfoxide (DMSO), NH₄Cl and sorbose The Second addition of alcohol solution, can for probe with primer in the case of different to wild-type sequence/mutant sequences, it is clever Combine quickly or not combining target region.That is, the presence of the first additive and Second addition, is probe and primer With reference to the favourable environment of offer so that in the case of mutant sequences, positive fluorescent PCR signal is produced；And in wild type In the case of sequence, it is impossible to produce positive fluorescent PCR signal.

Additionally, being provided for the interior label sequence of KRAS monitoring, different fluorescence labeling probes is used from target gene, passed through Whether whether detection internal standard normally monitors the amount of sample to be tested effective dna, while having PCR mortifiers in monitor sample, keeps away Exempt from PCR false negatives.

Inventor is also optimized to Fluorescence PCR system, realizes optimal expanding effect.Inventor obtains one Individual optimal Fluorescence PCR system, contains in every 50 μ L fluorescent PCR systems：Taq enzyme, 2 units of UNG enzymes；10mM's The μ L of dUTP 0.4 of dNTPs and 2.5mM；The Mg of 50mM²⁺1.5μL；The μ L of 10 × PCR buffer solutions 5；10 μM of primer sequence each 1 ~2 μ L, 10 μM of the μ L of probe sequence 3~4；20~the 40ng of DNA in the site of KRAS gene mutation containing someone；10mg/mL cow's serums Albumin 2 μ L, dimethyl sulfoxide (DMSO), 250mM NH₄The Cl and μ L of 60% aqueous sorbitol solution 1.25, and surplus water.

Describe technical scheme and technique effect in detail by the following examples, it will be appreciated that embodiment is only Exemplary, it is impossible to it is interpreted as limiting the scope of the invention.

In following examples, the specific primer and its probe sequence for using are as follows：

Upstream primer sequence for detecting KRAS Gly12Asp mutational sites：

GAATATAAACTTGTGGTAGTTGGAGCdIGA(SEQ ID NO：1),

Upstream primer sequence for detecting KRAS Gly12Ala mutational sites：

GGAATATAAACTTGTGGTAGTTGGAGCdIGC(SEQ ID NO：2),

GAATATAAACTTGTGGTAGTTGGAGCdIGT(SEQ ID NO：3),

GGAATATAAACTTGTGGTAGTTGGAGdITC(SEQ ID NO：4),

Upstream primer sequence for detecting KRAS Gly13Asp mutational sites：

GGAATATAAACTTGTGGTAGTTGGAGCTGGdIGT(SEQ ID NO：5),

Downstream primer sequence for detecting the various mutational sites of KRAS：

CCTCTATTGTTGGATCATATTCGT(SEQ ID NO：6)；

Fluorescence probe sequence for detecting the various mutational sites of KRAS：

FAM-GAGTGCCTTGACGATACAGCTAATTC-BHQ1(SEQ ID NO：7).

For the interior label sequence of KRAS monitoring, including：

Upstream primer sequence is：CCTAGTAGGAAATAAATGTGATTTGCC(SEQ ID NO：8),

Fluorescence probe sequence is：

VIC-TAGAACAGTAGACACAAAACAGGCTCAGGACTT-BHQ1(SEQ ID NO：9),

Downstream primer sequence is：CTGTCTTGTCTTTGCTGATGTTTCA(SEQ ID NO：10).

The constituent of the single tube reaction solution of the class hot spot mutation of detection KRAS genes 7 is as shown in table 2 below：

Table 2

The program of Fluorescence PCR is：50 DEG C of reaction 2min；95 DEG C of reaction 5min；95 DEG C of reaction 15s and then 60 DEG C of reactions 30s carries out 15 circulations；95 DEG C of reaction 15s and then 60 DEG C of reaction 30s carry out 30 and circulate and collect fluorescence signal；20 DEG C of reactions 2min。

Fig. 2 shows negative with reference to the class hot spot mutation target area detection letter of people DNA 200ng (100%) KRAS genes 7 Number FAM fluorescence curve figures, it is seen that unstressed configuration signal；Fig. 3 shows negative with reference to the class of people DNA 200ng (100%) KRAS genes 7 Hot spot mutation internal standard region detection signal VIC fluorescence curve figures, it is seen that have fluorescence signal；Fig. 4 shows that the class of KRAS genes 7 is mutated Plasmid 5*10²Copy (1%)+people DNA 200ng (99%) target area detection signal FAM fluorescence curve figures, it is seen that have fluorescence Signal；Fig. 5 shows the class mutant plasmid 5*10 of KRAS genes 7²Copy (1%)+people DNA 200ng (99%) internal standard region detection Signal VIC fluorescence curve figures, it is seen that have fluorescence signal；Fig. 6 shows the class mutant plasmid 5*10 of KRAS genes 7⁴Copy (50%)+ People DNA 200ng (50%) target area detection signal FAM fluorescence curve figures, it is seen that have fluorescence signal；Fig. 7 shows KRAS bases Because of 7 class mutant plasmid 5*10⁴Copy (50%)+people DNA 200ng (50%) internal standard region detection signal VIC fluorescence curve figures, It can be seen that there is fluorescence signal；Fig. 8 shows the class hot spot mutation target area of human faecal mass sample DNA 100ng (100%) KRAS genes 7 Detection signal FAM fluorescence curve figures, it is seen that unstressed configuration signal；Fig. 9 shows human faecal mass sample DNA 100ng (100%) KRAS The class hot spot mutation internal standard region detection signal VIC fluorescence curve figures of gene 7, it is seen that have fluorescence signal；Figure 10 shows that people dissociates The class hot spot mutation target area detection signal FAM fluorescence curve figures of blood DNA 3ng (100%) KRAS genes 7, it is seen that unstressed configuration is believed Number；Figure 11 shows the free class hot spot mutation internal standard region detection signal VIC fluorescence of blood DNA 3ng (100%) KRAS genes 7 of people Curve map, it is seen that have fluorescence signal.

Above content is to combine specific embodiment further description made for the present invention, it is impossible to assert this hair Bright specific implementation is confined to these explanations.For general technical staff of the technical field of the invention, do not taking off On the premise of present inventive concept, some simple deduction or replace can also be made, should all be considered as belonging to protection of the invention Scope.

SEQUENCE LISTING

<110>People and future biological science and technology（Changsha）Co., Ltd

<120>People's KRAS gene multipoint mutation single tube joint inspections fluorescence PCR method, kit and system

<130> 17I23926

<160> 10

<170> PatentIn version 3.3

<210> 1

<211> 29

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (27)..(27)

<223>N is deoxyinosine

<400> 1

gaatataaac ttgtggtagt tggagcnga 29

<210> 2

<211> 30

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (28)..(28)

<223>N is deoxyinosine

<400> 2

ggaatataaa cttgtggtag ttggagcngc 30

<210> 3

<211> 29

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (27)..(27)

<223>N is deoxyinosine

<400> 3

gaatataaac ttgtggtagt tggagcngt 29

<210> 4

<211> 29

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (27)..(27)

<223>N is deoxyinosine

<400> 4

ggaatataaa cttgtggtag ttggagntc 29

<210> 5

<211> 33

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (31)..(31)

<223>N is deoxyinosine

<400> 5

ggaatataaa cttgtggtag ttggagctgg ngt 33

<210> 6

<211> 24

<212> DNA

<213>Artificial sequence

<400> 6

cctctattgt tggatcatat tcgt 24

<210> 7

<211> 26

<212> DNA

<213>Artificial sequence

<400> 7

gagtgccttg acgatacagc taattc 26

<210> 8

<211> 27

<212> DNA

<213>Artificial sequence

<400> 8

cctagtagga aataaatgtg atttgcc 27

<210> 9

<211> 33

<212> DNA

<213>Artificial sequence

<400> 9

tagaacagta gacacaaaac aggctcagga ctt 33

<210> 10

<211> 25

<212> DNA

<213>Artificial sequence

<400> 10

ctgtcttgtc tttgctgatg tttca 25

Claims

1. a kind of people KRAS genes multipoint mutation single tube joint inspection fluorescence PCR method, it is characterised in that including：

In fluorescent PCR system, Fluorescence PCR is carried out as template using the DNA in the site of KRAS gene mutation containing someone, wherein The fluorescent PCR system includes：

GAATATAAACTTGTGGTAGTTGGAGCdIGA(SEQ ID NO：1),

Upstream primer sequence for detecting KRAS Gly12Ala mutational sites：

GGAATATAAACTTGTGGTAGTTGGAGCdIGC(SEQ ID NO：2),

GAATATAAACTTGTGGTAGTTGGAGCdIGT(SEQ ID NO：3),

GGAATATAAACTTGTGGTAGTTGGAGdITC(SEQ ID NO：4),

Upstream primer sequence for detecting KRAS Gly13Asp mutational sites：

GGAATATAAACTTGTGGTAGTTGGAGCTGGdIGT(SEQ ID NO：5),

Wherein, the dI in the upstream primer sequence represents deoxyinosine nucleotides；

CCTCTATTGTTGGATCATATTCGT(SEQ ID NO：6)；

GAGTGCCTTGACGATACAGCTAATTC(SEQ ID NO：7),

Wherein, 5 ' ends of the fluorescence probe sequence have fluorophor, and 3 ' ends have quenching group；

(d) Taq enzyme, UNG enzymes, dNTPs, dUTP, Mg²⁺With PCR buffer solutions；

E () the first additive and Second addition, first additive include bovine serum albumin(BSA), the Second addition bag Include dimethyl sulfoxide (DMSO), NH₄Cl and aqueous sorbitol solution.

2. method according to claim 1, it is characterised in that the fluorophor is FAM, and the quenching group is BHQ1。

3. method according to claim 1, it is characterised in that also include in the fluorescent PCR system：

For the interior label sequence of KRAS monitoring, including：

Upstream primer sequence is：CCTAGTAGGAAATAAATGTGATTTGCC(SEQ ID NO：8),

Fluorescence probe sequence is：

TAGAACAGTAGACACAAAACAGGCTCAGGACTT(SEQ ID NO：9),

Downstream primer sequence is：CTGTCTTGTCTTTGCTGATGTTTCA(SEQ ID NO：10),

Wherein, 5 ' ends of the fluorescence probe sequence have fluorophor VIC, and 3 ' ends have quenching group BHQ1.

4. method according to claim 1, it is characterised in that contain in fluorescent PCR system described in every 50 μ L：

Taq enzyme, 2 units of UNG enzymes；The μ L of dUTP 0.4 of the dNTPs and 2.5mM of 10mM；The Mg of 50mM²⁺1.5μL；10×PCR The μ L of buffer solution 5；Respective 1~2 the μ L, 10 μM of the μ L of probe sequence 3~4 of 10 μM of primer sequence；The position of KRAS gene mutation containing someone 20~the 40ng of DNA of point；10mg/mL bovine serum albumin(BSA)s 2 μ L, dimethyl sulfoxide (DMSO), 250mM NH₄Cl and 60% D-sorbite The μ L of the aqueous solution 1.25, and surplus water.

5. method according to claim 4, it is characterised in that also contain in fluorescent PCR system described in every 50 μ L：

The respective 1 μ L of 10 μM of described interior target primer sequence, and 10 μM of μ L of described interior target probe sequence 0.5；In described Target primer sequence and probe sequence include：

For the interior label sequence of KRAS monitoring, including：

Upstream primer sequence is：CCTAGTAGGAAATAAATGTGATTTGCC(SEQ ID NO：8),

Fluorescence probe sequence is：

TAGAACAGTAGACACAAAACAGGCTCAGGACTT(SEQ ID NO：9),

Downstream primer sequence is：CTGTCTTGTCTTTGCTGATGTTTCA(SEQ ID NO：10),

6. the method according to any one of claim 1 to 5, it is characterised in that the program of the Fluorescence PCR is：

50 DEG C of reaction 2min；95 DEG C of reaction 5min；95 DEG C of reaction 15s and then 60 DEG C of reaction 30s carry out 15 circulations；95 DEG C of reactions 15s and then 60 DEG C of reaction 30s carry out 30 and circulate and collect fluorescence signal；20 DEG C of reaction 2min.

7. a kind of people KRAS genes multipoint mutation single tube joint inspection fluorescent PCR kit, it is characterised in that including：

GAATATAAACTTGTGGTAGTTGGAGCdIGA(SEQ ID NO：1),

Upstream primer sequence for detecting KRAS Gly12Ala mutational sites：

GGAATATAAACTTGTGGTAGTTGGAGCdIGC(SEQ ID NO：2),

GAATATAAACTTGTGGTAGTTGGAGCdIGT(SEQ ID NO：3),

GGAATATAAACTTGTGGTAGTTGGAGdITC(SEQ ID NO：4),

Upstream primer sequence for detecting KRAS Gly13Asp mutational sites：

GGAATATAAACTTGTGGTAGTTGGAGCTGGdIGT(SEQ ID NO：5),

CCTCTATTGTTGGATCATATTCGT(SEQ ID NO：6)；

GAGTGCCTTGACGATACAGCTAATTC(SEQ ID NO：7),

(d) Taq enzyme, UNG enzymes, dNTPs, dUTP, Mg²⁺With PCR buffer solutions；

E () the first additive and Second addition, first additive include bovine serum albumin(BSA), the Second addition bag Include dimethyl sulfoxide (DMSO), NH₄Cl and aqueous sorbitol solution；

Upstream primer sequence is：CCTAGTAGGAAATAAATGTGATTTGCC(SEQ ID NO：8),

Fluorescence probe sequence is：

TAGAACAGTAGACACAAAACAGGCTCAGGACTT(SEQ ID NO：9),

Downstream primer sequence is：CTGTCTTGTCTTTGCTGATGTTTCA(SEQ ID NO：10),

8. kit according to claim 7, it is characterised in that the fluorophor is FAM, and the quenching group is BHQ1。

9. a kind of people KRAS genes multipoint mutation single tube joint inspection Fluorescence PCR system, it is characterised in that fluorescence described in every 50 μ L PCR reaction systems include：

(1) 10 μM of primer sequence respective 1~2 μ L, respective 3~4 μ L of 10 μM of probe sequence；Wherein, the primer sequence and Probe sequence includes：

GAATATAAACTTGTGGTAGTTGGAGCdIGA(SEQ ID NO：1),

Upstream primer sequence for detecting KRAS Gly12Ala mutational sites：

GGAATATAAACTTGTGGTAGTTGGAGCdIGC(SEQ ID NO：2),

GAATATAAACTTGTGGTAGTTGGAGCdIGT(SEQ ID NO：3),

GGAATATAAACTTGTGGTAGTTGGAGdITC(SEQ ID NO：4),

Upstream primer sequence for detecting KRAS Gly13Asp mutational sites：

GGAATATAAACTTGTGGTAGTTGGAGCTGGdIGT(SEQ ID NO：5),

CCTCTATTGTTGGATCATATTCGT(SEQ ID NO：6)；

GAGTGCCTTGACGATACAGCTAATTC(SEQ ID NO：7),

(2) Taq enzyme, 2 units of UNG enzymes；The μ L of dUTP 0.4 of the dNTPs and 2.5mM of 10mM；The Mg of 50mM²⁺1.5μL；10× The μ L of PCR buffer solutions 5；

The μ L of (3) first additive 2, the μ L of Second addition 1.25, first additive include 10mg/mL bovine serum albumin(BSA)s, The Second addition includes dimethyl sulfoxide (DMSO), 250mM NH₄Cl and 60% aqueous sorbitol solution；

(4) 20~40ng of DNA in the site of KRAS gene mutation containing someone；And

(5) water of surplus.

10. Fluorescence PCR system according to claim 9, it is characterised in that fluorescent PCR body described in every 50 μ L Also contain in system：

The respective 1 μ L of (6) 10 μM of interior target primer sequence, and 10 μM of μ L of interior target probe sequence 0.5, wherein the internal standard Primer sequence and probe sequence include for KRAS monitoring interior label sequence, including：

Upstream primer sequence is：CCTAGTAGGAAATAAATGTGATTTGCC(SEQ ID NO：8),

Fluorescence probe sequence is：

TAGAACAGTAGACACAAAACAGGCTCAGGACTT(SEQ ID NO：9),

Downstream primer sequence is：CTGTCTTGTCTTTGCTGATGTTTCA(SEQ ID NO：10),