CN105861724A - KRAS gene ultralow frequency mutation detection kit - Google Patents
KRAS gene ultralow frequency mutation detection kit Download PDFInfo
- Publication number
- CN105861724A CN105861724A CN201610389568.6A CN201610389568A CN105861724A CN 105861724 A CN105861724 A CN 105861724A CN 201610389568 A CN201610389568 A CN 201610389568A CN 105861724 A CN105861724 A CN 105861724A
- Authority
- CN
- China
- Prior art keywords
- primer
- nucleic acid
- target area
- pcr amplification
- group
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Pathology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Hospice & Palliative Care (AREA)
- Oncology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a primer composition used for detecting a target area of a nucleic acid sample to be detected and application of the primer composition. The nucleic acid sample to be detected is double-strand DNA and comprises a first strand and a second strand complementary to the first strand, and the primer composition comprises a general primer group, an upstream primer group and a downstream primer group; the general primer group comprises a first general primer and a second general primer, the first general primer is used for forming the 5' end of a sequencing library, and the target site of the second general primer is located at the 5' end in the target area on the two strands of the nucleic acid sample to be detected and used for forming the 3' end of the sequencing library; the upstream primer group comprises a first upstream primer group body and a second upstream primer group body; the downstream primer group comprises a first downstream primer group body and a second downstream primer group body. The primer composition can be effectively used for detecting sequence information of the target area of the nucleic acid sample to be detected, in particular to ultralow frequency mutation detection, the detection sensitivity is high, and the result is accurate and reliable.
Description
Technical field
The present invention relates to biology field, particularly mutation detection techniques field, in particular it relates to a kind of
KRAS gene intrasonic mutation detection kit.
Background technology
It is known that the relevant gene of disease and the detection in pathogenic mutation site, for deep hereditism and pathological research
And the research such as the medication of disease treatment and drug resistance, the most significant.
But, detection method or the sensitivity of current gene mutation are relatively low, or flux is relatively low, it is impossible to meet various
This demand simultaneously detected.
Therefore, be at present badly in need of a kind of high flux, detection in Gene Mutation means that detection sensitivity is high.
Summary of the invention
It is contemplated that at least solve one of technical problem present in prior art.To this end, one object of the present invention
It is the detection in Gene Mutation means proposing a kind of high flux, detection sensitivity is high.
It should be noted that the present invention is following discovery based on inventor and work and completes:
Plasma free Tumour DNA (circulating tumor DNA, ctDNA) is to be discharged in blood plasma by tumor cell
DNA, carry the gene mutation information consistent with primary tumor tissue, ctDNA detection as a kind of non-invasive detection methods,
Can gene mutation collection of illustrative plates in actual response solid tumor mass and frequency, be early diagnosis of tumor, treatment and prognosis evaluation weight
Want monitoring index.
RAS gene family and the closely-related gene of human tumor have three kinds of-HRAS, KRAS and NRAS, these three gene
The amino acid sequence homologous of the protein about 90% of coding, molecular weight is 21KDa, is also called RASp21 albumen.RAS egg
White be the GTP/GDP associated proteins of film conjunction type, by the mutually conversion of GTP and GDP can low-keyed regulation P21 to signal
The opening and closing of system, transfer sell Growth and Differentiation signal, thus affect cell proliferation, survival and atomization, KRAS believes
Number path is the downstream passages of EGFR and other signal transductions, when RAS gene is undergone mutation, and the RAS Proteolytic enzyme of its coding
GTP-RAS ability declines so that signal transduction pathway is constantly in sustained activation state, stimulates the continuous proliferation and differentiation of cell,
Cause malignant change of cell eventually.KRAS gene is a kind of common oncogene, is more common in malignant tumor, in colorectal cancer patients
There are about 30%～40% and there is KRAS gene mutation, patients with lung adenocarcinoma there are about 15%～30% and there is KRAS.KRAS dashes forward
Become be primarily located within the 12nd, 13,61 and No. 63 codons, wherein have 7 mutantional hotspot: G12C, G12R, G12S, G12V,
G12D, G12A, G13V/D, account for that KRAS gene always suddenlys change more than 90%.
Research shows, KRAS gene mutation and the NSCLC constitutional to the target therapeutic agent such as gefitinib, Erlotinib
Drug resistance is relevant.Studies have found that the sudden change of KRAS gene makes colorectal cancer patients that the treatment of Cetuximab is produced drug resistance.
NCCN (nonsmall-cell lung cancer clinical practice guideline 2016 editions) points out that KRAS gene mutation can make patients with lung cancer to EGFR tyrosine
Inhibitors of kinases (EGFT-TKI) produces drug resistance；Colorectal cancer patients antagonism EGFR antibody class medicine is made to produce drug resistance.So
Before NCCN (nonsmall-cell lung cancer clinical practice guideline 2016 editions) proposition patients with lung adenocarcinoma accepts the treatment of EGFR targeted drug, must
KRAS gene mutation detection must be carried out, decide whether to use EGFR targeted drug as clinical treatment measure according to testing result.
Therefore the important prediction index that the sudden change of detection KRAS gene can produce as EGFR targeted therapy drug resistance.
In Clinical detection DNA, the method for gene mutation mainly has 3 kinds: 1 at present) direct sequencing: it is that application is most at present
A kind of detection method, mainly Sanger check order, after mutant gene is effectively enriched with, just can be sequenced, advantage is
Result accurately and reliably, can read detected sequence information, but effectively be enriched with mutant gene region, and low at mutant gene content
In the case of face greatly challenge, be generally used to confirm that other detect positive findings.2) fluorescence quantitative PCR method: fixed at fluorescence
On amount PCR platform, utilize special primer that DNA mutation target sequence is carried out PCR amplification, utilize fluorescence labeling probe that amplification is produced
Thing carries out abrupt climatic change, such detection method high specificity, highly sensitive, can detect that the sudden change of DNA content as little as 1%, but
Probe cost intensive, and known mutations site can only be detected, it is difficult to adapt to clinical big flux pattern detection.3) high-flux sequence skill
Art method: typically utilize round pcr to be enriched with target area, then builds and is suitable for the library of machine order-checking on NGS, finally go up
Machine checks order, and information analysis obtains interesting target regional sequence information.But at present in the enrichment process of target area, it is enriched with
Specificity and effectiveness have a long way to go at different experiment porch, cause the sensitivity that finally detects and accuracy to exist the biggest
Fluctuation, and common Library development flow is numerous and diverse, and efficiency is low, the reliability of these factors affect to final result.
Therefore, it is badly in need of a kind of quick at present, the efficient method detecting KRAS gene mutation.
And then, present inventor has performed a series of research, and invented when the detection of the free plasma dna of research a kind of newly
CtDNA detection method, i.e. by free plasma dna fragment is connected special joint, then carry out efficient specific enrichment
Target area, reads detecting target base sequence in conjunction with second filial generation high throughput sequencing technologies.That is, inventors be surprised to learn that a kind of height
The detection in Gene Mutation means that flux, detection sensitivity are high, it is used not only for the detection of KRAS gene mutation, equally applicable
Detect in the target area of other genes, these target areas comprise selected from point mutation, insert, lack, gene fusion sudden change
At least one, the especially detection of intrasonic sudden change.On this basis, inventor is particularly based on KRAS gene pairs the method and carries out
Improve, and the efficient primer for KRAS gene design, develop a kind of by plasma DNA detection KRAS gene heat
The sequence measurement of point mutation and test kit thereof.
Thus, in a first aspect of the present invention, the invention provides a kind of for detecting determined nucleic acid sample object region
Primer composition.According to embodiments of the invention, described sample of nucleic acid to be detected is double-stranded DNA, including the first chain with
The second chain that one chain is complementary, this Primer composition includes:
Universal primer group, described universal primer group includes the first universal primer and the second universal primer, described first general
Primer is for constituting 5 ' ends of sequencing library, and the target spot of described second universal primer is positioned on two chains of sample of nucleic acid to be detected
5 ' ends of target area, for constituting 3 ' ends of sequencing library；
Forward primer group, described forward primer group includes the first forward primer group and the second forward primer group；And
Downstream primer group, described downstream primer group includes the first downstream primer group and the second downstream primer group；
Wherein,
Described first forward primer group, the second forward primer group, the first downstream primer group and the second downstream primer group are all wrapped
Containing n bar target region-specific primers, and it must is fulfilled for following condition:
(1) each forward primer of described first forward primer group and described second forward primer group extends the most in the same direction, target spot
It is respectively positioned on 3 ' ends of target area on the first chain of sample of nucleic acid to be detected；Described first downstream primer group and described second downstream
Each downstream primer of primer sets extends the most in the same direction, and target spot is respectively positioned on the second chain of sample of nucleic acid to be detected the 3 ' of target area
End；
(2) arbitrary integer of n=1-5, as a example by n=5, if each specific primer of described first forward primer group is respectively
For: N1、N2、N3、N4、N5, each specific primer of described second forward primer group is respectively as follows: M1、M2、M3、M4、M5, described first
Each specific primer of downstream primer group is respectively as follows: B1、B2、B3、B4、B5, each specific primer of described second downstream primer group
It is respectively as follows: P1、P2、P3、P4、P5, the distance between the target spot and target area of specific primer as criterion, each specificity
Distance relation between primer is:
N1>N2>N3>N4>N5；
M1>M2>M3>M4>M5；
N1>M1；
N2>M2；
N3>M3；
N4>M4；And
N5>M5,
B1>B2>B3>B4>B5；
P1>P2>P3>P4>P5；
B1>P1；
B2>P2；
B3>P3；
B4>P4；And
B5>P5。
It is surprisingly found by the inventors that, the Primer composition of the present invention can be efficiently used for detecting determined nucleic acid sample object
The sequence information in region, the especially detection of intrasonic sudden change.Specifically, the Primer composition of the present invention is utilized, it is possible to effectively
Ground is enriched with the sequence in described determined nucleic acid sample object region by PCR amplification, and then carries out building storehouse, order-checking such that it is able to have
Effect determines determined nucleic acid sample object regional sequence information, including the point mutation included in target area, inserts, lacks or base
Because merging sudden change, and detection sensitivity is high, and result is accurately and reliably.
In a second aspect of the present invention, the invention provides a kind of test kit.According to embodiments of the invention, this test kit
Comprise: foregoing Primer composition.According to embodiments of the invention, this test kit can be efficiently used for detecting core to be measured
The sequence information of acid sample target area, the especially detection of intrasonic sudden change.Specifically, the primer sets in this test kit is utilized
Compound, it is possible to be effectively enriched with the sequence in described determined nucleic acid sample object region by PCR amplification, and then carry out building storehouse, survey
Sequence such that it is able to effectively determine determined nucleic acid sample object regional sequence information, including the point mutation included in target area,
Inserting, lack or gene fusion sudden change, and detection sensitivity is high, result accurately and reliably, is particularly suited for low frequency sudden change
Detection.
In a third aspect of the present invention, the invention provides a kind of detection library, target area building determined nucleic acid sample
Method.According to embodiments of the invention, the method utilizes foregoing Primer composition or test kit, is expanded by PCR
It is enriched with the sequence in described determined nucleic acid sample object region.Thereby, it is possible to primer based on aforesaid present invention combination effectively
Thing or test kit carry out building storehouse, and then can be efficiently used for order-checking, to determine determined nucleic acid sample object regional sequence information,
Including the point mutation included in target area, inserting, lack or gene fusion sudden change, and detection sensitivity is high, result is accurate
The most reliable, it is particularly suited for the detection of intrasonic sudden change.
In a fourth aspect of the present invention, the invention provides and a kind of determine determined nucleic acid sample object regional sequence information
Method.According to embodiments of the invention, the method includes: examine according to the target area of foregoing structure determined nucleic acid sample
The method surveying library, builds the detection library, target area of described determined nucleic acid sample；Target to described determined nucleic acid sample
Checking order in region detection library, in order to obtains sequencing result；And based on described sequencing result, determine described determined nucleic acid sample
The sequence information of this target area.
Inventor finds, utilizes the method can Primer composition based on the aforesaid present invention or test kit structure effectively
Build sequencing library and the order-checking of target area such that it is able to effectively determine determined nucleic acid sample object regional sequence information, including
Point mutation included in target area, inserting, lack or gene fusion sudden change, and detection sensitivity is high, result accurately may be used
Lean on, be particularly suited for the detection of intrasonic sudden change.
In a fifth aspect of the present invention, the invention provides a kind of determined nucleic acid sample object region detection library that builds
Device.According to embodiments of the invention, this device is provided with foregoing Primer composition, and described device includes:
Pre-amplification unit, described pre-amplification unit is used for carrying out sample of nucleic acid to be measured pre-amplification, and by pre-amplified production
It is divided into 2 parts, respectively as the first pre-library and the second pre-library；
Primer amplified unit, described primer amplified unit is connected with described pre-amplification unit, for profit
With the first forward primer group and the second universal primer, described first pre-library is carried out a PCR amplification, then utilize on second
Trip primer sets and the second universal primer carry out the 2nd PCR amplification to the first pcr amplification product, in order to obtain the 2nd PCR amplification and produce
Thing；Meanwhile, the first downstream primer group and the second universal primer is utilized described second pre-library to carry out the 3rd PCR amplification, then
Utilization utilizes the second downstream primer group and the second universal primer that the 3rd pcr amplification product carries out the 4th PCR amplification, in order to obtain
4th pcr amplification product；And
Universal primer amplification unit, described universal primer amplification unit is connected with described primer amplified unit, uses
In mixing described second pcr amplification product and described 4th pcr amplification product, and the first universal primer and second is utilized general to draw
Thing carries out the 5th PCR amplification to described mixture, in order to obtain the 5th pcr amplification product, and described 5th pcr amplification product is constituted
The detection library, target area of described determined nucleic acid sample.
Thus, this device is utilized effectively Primer composition based on the aforesaid present invention or test kit to build
Storehouse, and then order-checking can be efficiently used for, to determine determined nucleic acid sample object regional sequence information, including institute in target area
The point mutation that comprises, inserting, lack or gene fusion sudden change, and detection sensitivity is high, result accurately and reliably, is particularly suited for
The detection of intrasonic sudden change.
In a sixth aspect of the present invention, the invention provides and a kind of determine determined nucleic acid sample object regional sequence information
System.According to embodiments of the invention, this system includes:
The device in foregoing structure determined nucleic acid sample object region detection library, is used for building described determined nucleic acid
The detection library, target area of sample；
Sequencing device, the device phase in described sequencing device and described structure determined nucleic acid sample object region detection library
Even, for being checked order in the detection library, target area of described determined nucleic acid sample, in order to obtain sequencing result；And
Sequence Determination Means, described Sequence Determination Means is connected with described sequencing device, is used for based on described sequencing result,
Determine the sequence information in described determined nucleic acid sample object region.
Inventor finds, utilizes this system can Primer composition based on the aforesaid present invention or test kit structure effectively
Build sequencing library and the order-checking of target area such that it is able to effectively determine determined nucleic acid sample object regional sequence information, including
Point mutation included in target area, inserting, lack or gene fusion sudden change, and detection sensitivity is high, result accurately may be used
Lean on, be particularly suited for the detection of intrasonic sudden change.
The additional aspect of the present invention and advantage will part be given in the following description, and part will become from the following description
Obtain substantially, or recognized by the practice of the present invention.
Accompanying drawing explanation
Above-mentioned and/or the additional aspect of the present invention and advantage are from combining the accompanying drawings below description to embodiment and will become
Substantially with easy to understand, wherein:
Fig. 1 shows the electrophoresis detection result of the PCR primer of pre-amplified library in embodiment 1；
Fig. 2 shows the electrophoresis detection result of universal primer amplified production in embodiment 1；
Fig. 3 shows the electrophoresis detection result of the PCR primer of pre-amplified library in embodiment 2；
Fig. 4 shows the electrophoresis detection result of universal primer amplified production in embodiment 2；
Fig. 5 shows according to embodiments of the present invention, the position relationship schematic diagram of each primer of the Primer composition of the present invention；
Fig. 6 shows the knot of the device building determined nucleic acid sample object region detection library according to embodiments of the present invention
Structure schematic diagram；And
Fig. 7 shows the knot of the system of determination determined nucleic acid sample object regional sequence information according to embodiments of the present invention
Structure schematic diagram.
Detailed description of the invention
Embodiments of the invention are described below in detail.The embodiments described below is exemplary, is only used for explaining this
Bright, and be not considered as limiting the invention.
In a first aspect of the present invention, the invention provides a kind of primer for detecting determined nucleic acid sample object region
Compositions.According to embodiments of the invention, described sample of nucleic acid to be detected is double-stranded DNA, including the first chain and mutual with the first chain
The second chain mended, this Primer composition includes:
Universal primer group, described universal primer group includes the first universal primer and the second universal primer, described first general
Primer is for constituting 5 ' ends of sequencing library, and the target spot of described second universal primer is positioned on two chains of sample of nucleic acid to be detected
5 ' ends of target area, for constituting 3 ' ends of sequencing library；
Forward primer group, described forward primer group includes the first forward primer group and the second forward primer group；And
Downstream primer group, described downstream primer group includes the first downstream primer group and the second downstream primer group；
Wherein,
Described first forward primer group, the second forward primer group, the first downstream primer group and the second downstream primer group are all wrapped
Containing n bar target region-specific primers, and it must is fulfilled for following condition:
(1) each forward primer of described first forward primer group and described second forward primer group extends the most in the same direction, target spot
It is respectively positioned on 3 ' ends of target area on the first chain of sample of nucleic acid to be detected；Described first downstream primer group and described second downstream
Each downstream primer of primer sets extends the most in the same direction, and target spot is respectively positioned on the second chain of sample of nucleic acid to be detected the 3 ' of target area
End；
(2) arbitrary integer of n=1-5, as a example by n=5, if each specific primer of described first forward primer group is respectively
For: N1、N2、N3、N4、N5, each specific primer of described second forward primer group is respectively as follows: M1、M2、M3、M4、M5, described first
Each specific primer of downstream primer group is respectively as follows: B1、B2、B3、B4、B5, each specific primer of described second downstream primer group
It is respectively as follows: P1、P2、P3、P4、P5, the distance between the target spot and target area of specific primer as criterion, each specificity
Distance relation between primer is:
N1>N2>N3>N4>N5；
M1>M2>M3>M4>M5；
N1>M1；
N2>M2；
N3>M3；
N4>M4；And
N5>M5,
B1>B2>B3>B4>B5；
P1>P2>P3>P4>P5；
B1>P1；
B2>P2；
B3>P3；
B4>P4；And
B5>P5。
It is surprisingly found by the inventors that, the Primer composition of the present invention can be efficiently used for detecting determined nucleic acid sample object
The sequence information in region, the especially detection of intrasonic sudden change.Specifically, the Primer composition of the present invention is utilized, it is possible to effectively
Ground is enriched with the sequence in described determined nucleic acid sample object region by PCR amplification, and then carries out building storehouse, order-checking such that it is able to have
Effect determines determined nucleic acid sample object regional sequence information, including the point mutation included in target area, inserts, lacks or base
Because merging sudden change, and detection sensitivity is high, and result is accurately and reliably.
Further, for convenience of understanding, inventor shows the position relationship of each primer in above-mentioned Primer composition with Fig. 5.
As it is shown in figure 5, ● for site to be detected (i.e. target area), USP1 is the first forward primer, and USP2 is the second forward primer,
DSP1 is the first downstream primer, and DSP2 is the second downstream primer, and UNP2 is the second universal primer, wherein " not shown in figure
One universal primer " can be combined with the second forward primer and the second downstream primer, for constituting 5 ' ends of sequencing library.
According to embodiments of the invention, for described first forward primer group, the second forward primer group, the first downstream primer
Group and the second downstream primer group in each, its each specific primer comprised is spaced successively based on the order on genomic locations
0-50 is to base pair.Thus, PCR amplification concentration effect is good.
According to embodiments of the invention, N1With M1Corresponding genomic locations has overlap, N2With M2Corresponding genomic locations
There are overlap, N3 and M3Corresponding genomic locations has overlap, N4With M4Corresponding genomic locations has overlap, N5With M5Corresponding base
Because there are overlap, B in group position1With P1Corresponding genomic locations has overlap, B2With P2Corresponding genomic locations has overlap, B3 and P3
Corresponding genomic locations has overlap, B4With P4Corresponding genomic locations has overlap, B5With P5Corresponding genomic locations has weight
Folded, preferably overlapping 10-15 base.Thus, PCR amplification concentration effect is good.
According to embodiments of the invention, the G/C content of each specific primer is 30%-70%, Tm value and is 55-68 DEG C.By
This, expanding effect is good.
According to embodiments of the invention, each specificity of described first forward primer group and described first downstream primer group draws
The 5' end of thing all has biotin modification.
5 ' ends of each specific primer of described second forward primer group and described second downstream primer group all contain first
The target spot of universal primer.Thus, sequencing analysis is conveniently carried out.
According to embodiments of the invention, the first universal primer:
AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTC (SEQ ID NO:7)；
Second universal primer: CAAGCAGAAGACGGCATACGA (SEQ ID NO:8).Thus, the primer of the present invention is utilized
After the sequence of compositions enrichment target area, it is possible to after utilizing Illumina order-checking platform (such as NextSeq500) to carry out easily
Continuous builds storehouse and order-checking, in order to realize the detection of target area.
According to embodiments of the invention, described target area is positioned on KRAS gene 2 exon, and n=1 is described
Each specific primer of the first forward primer group, the second forward primer group, the first downstream primer group and the second downstream primer group divides
It is not:
First forward primer: TGCTGAAAATGACTGAATATAAACTTGTGGT (SEQ ID NO:3),
Second forward primer: AGATGTGTATAAGAGACAGCTGAATATAAACTTGTGGTAGTTGGAGCT (SEQ ID
NO:4),
First downstream primer: CCACAAAATGATTCTGAATTAGCTGTATCG (SEQ ID NO:5),
Second downstream primer: AGATGTGTATAAGAGACAGGAATTAGCTGTATCGTCAAGGCACTCTTG (SEQ ID
NO:6).Thus, the Primer composition of the present invention can be used in the abrupt climatic change of KRAS gene 2 exon, and detects sensitive
Degree height, result accurately and reliably, and can effectively detect that intrasonic is suddenlyd change.
According to embodiments of the invention, described target area comprise selected from point mutation, insert, lack, gene fusion sudden change
At least one.
According to embodiments of the invention, described target area is positioned on KRAS gene.
In a second aspect of the present invention, the invention provides a kind of test kit.According to embodiments of the invention, this test kit
Comprise: foregoing Primer composition.According to embodiments of the invention, this test kit can be efficiently used for detecting core to be measured
The sequence information of acid sample target area, the especially detection of intrasonic sudden change.Specifically, the primer sets in this test kit is utilized
Compound, it is possible to be effectively enriched with the sequence in described determined nucleic acid sample object region by PCR amplification, and then carry out building storehouse, survey
Sequence such that it is able to effectively determine determined nucleic acid sample object regional sequence information, including the point mutation included in target area,
Inserting, lack or gene fusion sudden change, and detection sensitivity is high, result accurately and reliably, is particularly suited for low frequency sudden change
Detection.
In a third aspect of the present invention, the invention provides a kind of detection library, target area building determined nucleic acid sample
Method.According to embodiments of the invention, the method utilizes foregoing Primer composition or test kit, is expanded by PCR
It is enriched with the sequence in described determined nucleic acid sample object region.Thereby, it is possible to primer based on aforesaid present invention combination effectively
Thing or test kit carry out building storehouse, and then can be efficiently used for order-checking, to determine determined nucleic acid sample object regional sequence information,
Including the point mutation included in target area, inserting, lack or gene fusion sudden change, and detection sensitivity is high, result is accurate
The most reliable, it is particularly suited for the detection of intrasonic sudden change.
According to embodiments of the invention, it is characterised in that described method includes:
Sample of nucleic acid to be measured is carried out pre-amplification, and pre-amplified production is divided into 2 parts, respectively as the first pre-library and
Second pre-library；
The first forward primer group and the second universal primer is utilized described first pre-library to carry out a PCR amplification, then
Utilize the second forward primer group and the second universal primer that the first pcr amplification product carries out the 2nd PCR amplification, in order to obtain second
Pcr amplification product；Meanwhile, utilize the first downstream primer group and the second universal primer that described second pre-library is carried out the 3rd PCR
Amplification, then utilizes the second downstream primer group and the second universal primer that the 3rd pcr amplification product carries out the 4th PCR amplification, with
Just the 4th pcr amplification product is obtained；And
Mix described second pcr amplification product and described 4th pcr amplification product, and utilize the first universal primer and second
Universal primer carries out the 5th PCR amplification to described mixture, in order to obtain the 5th pcr amplification product, and described 5th PCR amplification is produced
Thing constitutes the detection library, target area of described determined nucleic acid sample.
Thus, utilize the Primer composition of the present invention, it is possible to realize the enrichment to target area nucleotide sequence efficiently, use
After the abrupt climatic change of target area, detection sensitivity is high, and result is accurately and reliably.
According to embodiments of the invention, described target area comprise selected from point mutation, insert, lack, gene fusion sudden change
At least one.
According to embodiments of the invention, described target area is positioned on KRAS gene.
In a fourth aspect of the present invention, the invention provides and a kind of determine determined nucleic acid sample object regional sequence information
Method.According to embodiments of the invention, the method includes: examine according to the target area of foregoing structure determined nucleic acid sample
The method surveying library, builds the detection library, target area of described determined nucleic acid sample；Target to described determined nucleic acid sample
Checking order in region detection library, in order to obtains sequencing result；And based on described sequencing result, determine described determined nucleic acid sample
The sequence information of this target area.
Inventor finds, utilizes the method can Primer composition based on the aforesaid present invention or test kit structure effectively
Build sequencing library and the order-checking of target area such that it is able to effectively determine determined nucleic acid sample object regional sequence information, including
Point mutation included in target area, inserting, lack or gene fusion sudden change, and detection sensitivity is high, result accurately may be used
Lean on, be particularly suited for the detection of intrasonic sudden change.
According to embodiments of the invention, described target area comprise selected from point mutation, insert, lack, gene fusion sudden change
At least one.
According to embodiments of the invention, described target area is positioned on KRAS gene.
In a fifth aspect of the present invention, the invention provides a kind of determined nucleic acid sample object region detection library that builds
Device.According to embodiments of the invention, this device 100 is provided with foregoing Primer composition, with reference to Fig. 6, described device
100 include: pre-amplification unit 10, primer amplified unit 20 and universal primer amplification unit 30.
Specifically, according to embodiments of the invention, pre-amplification unit 10 is used for sample of nucleic acid to be measured is carried out pre-amplification, and
Pre-amplified production is divided into 2 parts, respectively as the first pre-library and the second pre-library；Primer amplified unit 20 is with pre-
Amplification unit 10 is connected, and is used for utilizing the first forward primer group and the second universal primer that described first pre-library is carried out first
PCR expands, and then utilizes the second forward primer group and the second universal primer that the first pcr amplification product carries out the 2nd PCR amplification,
To obtain the second pcr amplification product；Meanwhile, utilize the first downstream primer group and the second universal primer to described second pre-library
Carry out the 3rd PCR amplification, then utilize the second downstream primer group and the second universal primer that the 3rd pcr amplification product is carried out
4th PCR amplification, in order to obtain the 4th pcr amplification product；Universal primer amplification unit 30 and primer amplified unit 20
It is connected, is used for mixing described second pcr amplification product and described 4th pcr amplification product, and utilize the first universal primer and the
Two universal primers carry out the 5th PCR amplification to described mixture, in order to obtain the 5th pcr amplification product, described 5th PCR amplification
Product constitutes the detection library, target area of described determined nucleic acid sample.
Thus, this device 100 is utilized effectively Primer composition based on the aforesaid present invention or test kit to carry out
Build storehouse, and then order-checking can be efficiently used for, to determine determined nucleic acid sample object regional sequence information, including in target area
The point mutation that comprised, inserting, lack or gene fusion sudden change, and detection sensitivity is high, result is accurately and reliably, especially suitable
Detection in intrasonic sudden change.
According to embodiments of the invention, described target area comprise selected from point mutation, insert, lack, gene fusion sudden change
At least one.
According to embodiments of the invention, described target area is positioned on KRAS gene.
In a sixth aspect of the present invention, the invention provides and a kind of determine determined nucleic acid sample object regional sequence information
System.According to embodiments of the invention, with reference to Fig. 6, this system 1000 includes: build determined nucleic acid sample object region detection literary composition
The device 100 in storehouse, sequencing device 200 and Sequence Determination Means 300.
Specifically, according to embodiments of the invention, the device 100 building determined nucleic acid sample object region detection library is used
In the detection library, target area building described determined nucleic acid sample；Sequencing device 200 and structure determined nucleic acid sample object district
The device 100 in detection library, territory is connected, for checking order the detection library, target area of described determined nucleic acid sample, in order to
Obtain sequencing result；Sequence Determination Means 300 is connected with sequencing device 200, for based on described sequencing result, determine described in treat
Survey the sequence information of sample of nucleic acid target area.
Inventor finds, utilizes this system 1000 can Primer composition based on the aforesaid present invention or reagent effectively
Box builds sequencing library and the order-checking of target area such that it is able to effectively determine determined nucleic acid sample object regional sequence information,
Including the point mutation included in target area, inserting, lack or gene fusion sudden change, and detection sensitivity is high, result is accurate
The most reliable, it is particularly suited for the detection of intrasonic sudden change.
According to embodiments of the invention, described target area comprise selected from point mutation, insert, lack, gene fusion sudden change
At least one.
According to embodiments of the invention, described target area is positioned on KRAS gene.
Below in conjunction with embodiment, the solution of the present invention is explained.It will be understood to those of skill in the art that following
Embodiment is merely to illustrate the present invention, and should not be taken as limiting the scope of the invention.Unreceipted concrete technology or bar in embodiment
Part, according to the technology described by the document in this area or condition, (such as writing with reference to J. Pehanorm Brooker etc., yellow training hall etc. is translated
" Molecular Cloning: A Laboratory guide ", the third edition, Science Press) or carry out according to product description.Agents useful for same or instrument
Unreceipted production firm person, be can by city available from conventional products, such as can purchase from Illumina company.
Embodiment 1
The method of the determination determined nucleic acid sample object regional sequence information according to the present invention, utilizes the primer sets of the present invention
Compound or test kit carry out target area abrupt climatic change to sample, specifically comprise the following steps that
1. joint design
ADT-F:CAAGCAGAAGACGGCATACGAGATNNNNNNNNATTAAGGGTGACTGGAGT TCAGACGTGTGCT
CTTCCGATCT,
ADT-R:pGATCGGAAGAGC,
Above sequence needs to be annealed into double-strand.
2. design of primers
2.1 pre-library PCR primer are as follows:
Pre-lib-primer-F:CAAGCAGAAGACGGCATACGA (SEQ ID NO:1),
Pre-lib-primer-R:GCTCTTCCGATCT (SEQ ID NO:2),
2.2 extend specific primer in the same direction for No. 12 of KRAS Exon 2 and No. 13 codon design
As follows:
First forward primer (KRAS-U-SP1): TGCTGAAAATGACTGAATATAAACTTGTGGT (SEQ ID NO:
3),
Second forward primer (KRAS-U-SP2): AGATGTGTATAAGAGACAGCTGAATATAAACTTGTGGTAGTTGG
AGCT (SEQ ID NO:4),
First downstream primer (KRAS-D-SP1): CCACAAAATGATTCTGAATTAGCTGTATCG (SEQ ID NO:5),
Second downstream primer (KRAS-D-SP2): AGATGTGTATAAGAGACAGGAATTAGCTGTATCGTCAAGGCACT
CTTG (SEQ ID NO:6),
Universal primer sequence is as follows:
First universal primer (UNP1): AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTC (SEQ ID
NO:7),
Second universal primer (UNP2): CAAGCAGAAGACGGCATACGA (SEQ ID NO:8),
3. extraction 5ml healthy human peripheral blood, separates 2ml blood plasma, extracts dissociative DNA.
4. dissociative DNA end is repaired
It is formulated as follows reaction:
Table 1
In PCR instrument, 20 DEG C of temperature are bathed 30 minutes.
120ulAmpure XP beads is used to be purified, 32ulEB eluting.
5.3 ' ends add poly adenine tail
It is formulated as follows reaction:
Table 2
| DNA solution | 32ul |
| Klenow enzyme buffer liquid | 5ul |
| dATP | 10ul |
| Klenow exo-enzyme | 3ul |
| Cumulative volume | 50ul |
In PCR instrument, 37 DEG C of temperature are bathed 30 minutes.
60ulAmpure XP beads is used to be purified, 10ulEB eluting.
6. connect special signature's sequence
It is formulated as follows reaction:
Table 3
| DNA solution | 10ul |
| DNA ligase buffer | 25ul |
| Special signature's sequence | 10ul |
| DNA ligase | 5ul |
| Cumulative volume | 50ul |
In PCR instrument, 20 DEG C of temperature are bathed 15 minutes.
60ulAmpure XP beads is used to be purified, 20ulEB eluting.
The most pre-amplified library
It is formulated as follows reaction:
Table 4
PCR program is as follows:
A) 98 DEG C 45 seconds；
B) 10 cyclic programs are as follows:
98 DEG C 15 seconds
60 DEG C 30 seconds
72 DEG C 30 seconds
C) 72 DEG C 1 minute
D) 4 DEG C of preservations.
Take 5ul PCR primer and carry out 2% agarose gel electrophoresis detection.Testing result is as shown in Figure 1.
Residue PCR primer uses 54 μ l Ampure XP beads to be purified, 22 μ l Elution Buffer eluting.
8. primer amplified
This sample pre-library equivalent is divided into two parts, the respectively first pre-library and the second pre-library, utilizes the first upstream
Primer sets and the second universal primer carry out a PCR amplification to the first pre-library, then utilize the second forward primer group and second
Universal primer carries out the 2nd PCR amplification to the first pcr amplification product, in order to obtain the second pcr amplification product；Meanwhile, is utilized
One downstream primer sets and the second universal primer carry out the 3rd PCR amplification to the second pre-library, then utilize the second downstream primer group
With the second universal primer, the 3rd pcr amplification product is carried out the 4th PCR to expand, in order to obtain the 4th pcr amplification product.
Wherein, following first pcr amplification reaction system and the 3rd pcr amplification reaction system are configured on ice:
Table 5
| Pre-library DNA solution | 100ng |
| 360Master mix | 25ul |
| SP1 primer+UNP2 | 2ul |
| GC-enhancer | 1ul |
| Cumulative volume | 50ul |
The PCR response procedures of the oneth PCR amplification and the 3rd PCR amplification is as follows:
A) 95 DEG C 10 minutes；
B) 10 cyclic programs are as follows:
95 DEG C 30 seconds
62 DEG C 30 seconds
72 DEG C 1 minute
C) 72 DEG C 7 minutes
D) 4 DEG C of preservations.
60ul Ampure XP XP reclaims, 24ul ultra-pure water or elution, and eluent carries out next step amplification.
Configure following 2nd PCR to expand and the reaction system of the 4th PCR amplification on ice:
Table 6
The PCR response procedures of the 2nd PCR amplification and the 4th PCR amplification is as follows:
A) 95 DEG C 10 minutes；
B) 10 cyclic programs are as follows:
95 DEG C 30 seconds
62 DEG C 30 seconds
72 DEG C 1 minute
C) 72 DEG C 7 minutes
D) 4 DEG C of preservations.
60ul Ampure XP XP reclaims, 12ul ultra-pure water or elution, and eluent carries out next step amplification.
9. universal primer amplification
Second pcr amplification product obtained above and the 4th pcr amplification product are mixed, then, configures on ice as follows
The reaction system of universal primer amplification:
Table 7
The PCR response procedures of universal primer amplification is as follows:
A) 98 DEG C 45 seconds；
B) 10 cyclic programs are as follows:
98 DEG C 15 seconds
60 DEG C 30 seconds
72 DEG C 30 seconds
C) 72 DEG C 1 minute
D) 4 DEG C of preservations.
Taking 5ul and carry out 2% detected through gel electrophoresis, testing result is as shown in Figure 2.
Residue PCR primer 54ul Ampure XP XP reclaims, and 30ul ultra-pure water or elution are final
Library.
After the Quality Control of library, Illumina NEXTseq CN500 carries out 75bp both-end order-checking.
11. sequencing data information analysiss
By machine data under high-flux sequence after Quality Control is filtered, carry out BWA comparison, assess data specificity, analyze knot
Fruit is shown in Table 8.
Table 8
The blood plasma that sample is Healthy People (its region to be detected does not also contain sudden change) that the present embodiment uses, the above results table
Bright: to utilize the method for the present invention and test kit target area (KRAS Exon 2 12,13 password can effectively be detected
The sudden change of son).
Embodiment 2
Method according to embodiment 1 carries out target area abrupt climatic change to sample, differs only in: the present embodiment uses
Sample is from the commercialization standard substance of HORIZON DISCOVERY company
MultiplexIcfDNAReferenceStandardSet (Catalogue#:HD780), takes in this product at KRAS gene 12
Number codon position mutation frequency be respectively 0% (wild type), 0.1% and 1% and 5% sample detect, each sudden change frequency
The sample of rate takes 10ng DNA to be carried out.
Wherein, the electrophoresis detection result of the PCR primer of pre-amplified library is as it is shown on figure 3, the electricity of universal primer amplified production
Swimming testing result is as shown in Figure 4.
By machine data under high-flux sequence after Quality Control is filtered, carry out BWA comparison, assess data specificity, analyze knot
Fruit is shown in Table 9.
Table 9
The sequence number that analysis and evaluation target detection site obtains further, analysis result is shown in Table 10.
Table 10
The above results shows, utilizes the method for the present invention and test kit can accurately detect mutation frequency as little as 0.1%
KRAS gene mutation.
To sum up, in conjunction with the embodiments 1 with embodiment 2, result shows, the present invention can successfully target area to sample of nucleic acid
Territory (KRAS gene region to be checked) carries out specific detection, and highly sensitive, and result is accurately and reliably.
In the description of this specification, reference term " embodiment ", " some embodiments ", " example ", " specifically show
Example " or the description of " some examples " etc. means to combine this embodiment or example describes specific features, structure, material or spy
Point is contained at least one embodiment or the example of the present invention.In this manual, to the schematic representation of above-mentioned term not
Necessarily refer to identical embodiment or example.And, the specific features of description, structure, material or feature can be any
One or more embodiments or example in combine in an appropriate manner.
Although an embodiment of the present invention has been shown and described, it will be understood by those skilled in the art that: not
These embodiments can be carried out multiple change in the case of departing from the principle of the present invention and objective, revise, replace and modification, this
The scope of invention is limited by claim and equivalent thereof.
Claims (10)
1., for detecting the Primer composition in determined nucleic acid sample object region, described sample of nucleic acid to be detected is double-strand
DNA, including the first chain and second chain complementary with the first chain, it is characterised in that including:
Universal primer group, described universal primer group includes the first universal primer and the second universal primer, described first universal primer
For constituting 5 ' ends of sequencing library, the target spot of described second universal primer is positioned at target on two chains of sample of nucleic acid to be detected
5 ' the ends in region, for constituting 3 ' ends of sequencing library；
Forward primer group, described forward primer group includes the first forward primer group and the second forward primer group；And
Downstream primer group, described downstream primer group includes the first downstream primer group and the second downstream primer group；
Wherein,
Described first forward primer group, the second forward primer group, the first downstream primer group and the second downstream primer group all comprise n bar
Target area specific primer, and it must is fulfilled for following condition:
(1) each forward primer of described first forward primer group and described second forward primer group extends the most in the same direction, the equal position of target spot
3 ' ends of target area on the first chain of sample of nucleic acid to be detected；Described first downstream primer group and described second downstream primer
Each downstream primer of group extends the most in the same direction, and target spot is respectively positioned on 3 ' ends of target area on the second chain of sample of nucleic acid to be detected；
(2) arbitrary integer of n=1-5, as a example by n=5, if each specific primer of described first forward primer group is respectively as follows:
N1、N2、N3、N4、N5, each specific primer of described second forward primer group is respectively as follows: M1、M2、M3、M4、M5, described first time
Each specific primer of trip primer sets is respectively as follows: B1、B2、B3、B4、B5, each specific primer of described second downstream primer group divides
It is not: P1、P2、P3、P4、P5, the distance between the target spot and target area of specific primer is as criterion, and each specificity draws
Distance relation between thing is:
N1>N2>N3>N4>N5；
M1>M2>M3>M4>M5；
N1>M1；
N2>M2；
N3>M3；
N4>M4；And
N5>M5,
B1>B2>B3>B4>B5；
P1>P2>P3>P4>P5；
B1>P1；
B2>P2；
B3>P3；
B4>P4；And
B5>P5。
Primer sets the most according to claim 1, it is characterised in that draw for described first forward primer group, the second upstream
In thing group, the first downstream primer group and the second downstream primer group each, its each specific primer comprised is based on genome position
The order put is spaced 0-50 successively to base pair,
Optionally, N1With M1Corresponding genomic locations has overlap, N2With M2Corresponding genomic locations has overlap, N3 and M3Corresponding
Genomic locations have overlap, N4With M4Corresponding genomic locations has overlap, N5With M5Corresponding genomic locations has overlap, B1
With P1Corresponding genomic locations has overlap, B2With P2Corresponding genomic locations has overlap, B3 and P3Corresponding genomic locations
There are overlap, B4With P4Corresponding genomic locations has overlap, B5With P5Corresponding genomic locations has overlap, preferably overlapping 10-15
Individual base,
Optionally, the G/C content of each specific primer is 30%-70%, Tm value and is 55-68 DEG C,
Optionally, the 5' end of each specific primer of described first forward primer group and described first downstream primer group all has biology
Element is modified.
It is general that 5 ' ends of each specific primer of described second forward primer group and described second downstream primer group all contain first
The target spot of primer.
Primer sets the most according to claim 1, it is characterised in that
First universal primer: AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTC (SEQ ID NO:7)；
Second universal primer: CAAGCAGAAGACGGCATACGA (SEQ ID NO:8),
Optionally, described target area is positioned on KRAS gene 2 exon, n=1, described first forward primer group,
Each specific primer of two forward primer groups, the first downstream primer group and the second downstream primer group is respectively as follows:
First forward primer: TGCTGAAAATGACTGAATATAAACTTGTGGT (SEQ ID NO:3),
Second forward primer: AGATGTGTATAAGAGACAGCTGAATATAAACTTGTGGTAGTTGGAGCT (SEQ ID NO:
4),
First downstream primer: CCACAAAATGATTCTGAATTAGCTGTATCG (SEQ ID NO:5),
Second downstream primer: AGATGTGTATAAGAGACAGGAATTAGCTGTATCGTCAAGGCACTCTTG (SEQ ID NO:
6),
Optionally, described target area comprise selected from point mutation, insert, lack, gene fusion sudden change at least one,
Optionally, described target area is positioned on KRAS gene.
4. a test kit, it is characterised in that comprise:
Primer composition described in any one of claim 1-3.
5. the method in the detection library, target area building determined nucleic acid sample, it is characterised in that
Utilize the Primer composition described in any one of claim 1-3 or the test kit described in claim 4, expanded by PCR
It is enriched with the sequence in described determined nucleic acid sample object region.
Method the most according to claim 5, it is characterised in that described method includes:
Sample of nucleic acid to be measured is carried out pre-amplification, and pre-amplified production is divided into 2 parts, respectively as the first pre-library and second
Pre-library；
Utilize the first forward primer group and the second universal primer that described first pre-library carries out a PCR amplification, then utilize
Second forward primer group and the second universal primer carry out the 2nd PCR amplification to the first pcr amplification product, in order to obtain the 2nd PCR
Amplified production；Meanwhile, utilize the first downstream primer group and the second universal primer that described second pre-library carries out the 3rd PCR to expand
Increase, then utilize the second downstream primer group and the second universal primer that the 3rd pcr amplification product carries out the 4th PCR amplification, in order to
Obtain the 4th pcr amplification product；And
Mix described second pcr amplification product and described 4th pcr amplification product, and utilize the first universal primer and second general
Primer carries out the 5th PCR amplification to described mixture, in order to obtain the 5th pcr amplification product, described 5th pcr amplification product structure
Become the detection library, target area of described determined nucleic acid sample,
Optionally, described target area comprise selected from point mutation, insert, lack, gene fusion sudden change at least one,
Optionally, described target area is positioned on KRAS gene.
7. the method determining determined nucleic acid sample object regional sequence information, it is characterised in that including:
According to the method described in claim 5 or 6, build the detection library, target area of described determined nucleic acid sample；
Is checked order in the detection library, target area of described determined nucleic acid sample, in order to obtain sequencing result；And
Based on described sequencing result, determine the sequence information in described determined nucleic acid sample object region,
Optionally, described target area comprise selected from point mutation, insert, lack, gene fusion sudden change at least one,
Optionally, described target area is positioned on KRAS gene.
8. the device building determined nucleic acid sample object region detection library, it is characterised in that be provided with claim 1-3
Primer composition described in any one, described device includes:
Pre-amplification unit, described pre-amplification unit for carrying out pre-amplification to sample of nucleic acid to be measured, and is divided equally by pre-amplified production
It it is 2 parts, respectively as the first pre-library and the second pre-library；
Primer amplified unit, described primer amplified unit is connected with described pre-amplification unit, is used for utilizing
One forward primer group and the second universal primer carry out a PCR amplification to described first pre-library, then utilize the second upstream to draw
Thing group and the second universal primer carry out the 2nd PCR amplification to the first pcr amplification product, in order to obtain the second pcr amplification product；With
Time, utilize the first downstream primer group and the second universal primer that described second pre-library carries out the 3rd PCR amplification, then utilize profit
With the second downstream primer group and the second universal primer, the 3rd pcr amplification product is carried out the 4th PCR to expand, in order to obtain the 4th
Pcr amplification product；And
Universal primer amplification unit, described universal primer amplification unit is connected with described primer amplified unit, is used for mixing
Close described second pcr amplification product and described 4th pcr amplification product, and utilize the first universal primer and the second universal primer pair
Described mixture carries out the 5th PCR amplification, in order to obtain the 5th pcr amplification product, and described 5th pcr amplification product constitutes described
The detection library, target area of determined nucleic acid sample.
Device the most according to claim 8, it is characterised in that described target area comprise selected from point mutation, insert, lack
At least one what mistake, gene fusion were suddenlyd change,
Optionally, described target area is positioned on KRAS gene.
10. the system determining determined nucleic acid sample object regional sequence information, it is characterised in that including:
The device building determined nucleic acid sample object region detection library described in claim 8 or 9, is used for building described to be measured
The detection library, target area of sample of nucleic acid；
Sequencing device, described sequencing device is connected with the device in described structure determined nucleic acid sample object region detection library, uses
In being checked order in the detection library, target area of described determined nucleic acid sample, in order to obtain sequencing result；And
Sequence Determination Means, described Sequence Determination Means is connected with described sequencing device, for based on described sequencing result, determines
The sequence information in described determined nucleic acid sample object region,
Optionally, described target area comprise selected from point mutation, insert, lack, gene fusion sudden change at least one,
Optionally, described target area is positioned on KRAS gene.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610389568.6A CN105861724B (en) | 2016-06-03 | 2016-06-03 | A kind of KRAS gene ultralow frequency mutation detection kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610389568.6A CN105861724B (en) | 2016-06-03 | 2016-06-03 | A kind of KRAS gene ultralow frequency mutation detection kit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105861724A true CN105861724A (en) | 2016-08-17 |
| CN105861724B CN105861724B (en) | 2019-07-16 |
Family
ID=56675823
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610389568.6A Active CN105861724B (en) | 2016-06-03 | 2016-06-03 | A kind of KRAS gene ultralow frequency mutation detection kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105861724B (en) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106755486A (en) * | 2017-01-19 | 2017-05-31 | 人和未来生物科技（长沙）有限公司 | The poor detection in Gene Mutation library constructing method in noninvasive prenatal foetal β types ground, detection method and kit |
| CN106755485A (en) * | 2017-01-19 | 2017-05-31 | 人和未来生物科技（长沙）有限公司 | The poor detection in Gene Mutation library constructing method in noninvasive prenatal foetal α types ground, detection method and kit |
| CN106834286A (en) * | 2017-04-05 | 2017-06-13 | 北京泛生子基因科技有限公司 | The primer combination of one-step method rapid build amplification sublibrary |
| CN106835292A (en) * | 2017-04-05 | 2017-06-13 | 北京泛生子基因科技有限公司 | The method that one-step method rapid build expands sublibrary |
| CN107254541A (en) * | 2017-08-03 | 2017-10-17 | 广州万德基因医学科技有限公司 | Storehouse primer pond and application are built for expanding the NGS of multiple targets in cfDNA samples |
| CN110651050A (en) * | 2017-07-21 | 2020-01-03 | 深圳华大生命科学研究院 | Targeted enrichment method and kit for detecting low-frequency mutation |
| CN113811618A (en) * | 2019-05-21 | 2021-12-17 | 深圳华大智造科技股份有限公司 | Sequencing library constructed based on methylated DNA target region, system and application |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103571822A (en) * | 2012-07-20 | 2014-02-12 | 中国科学院植物研究所 | Multipurpose DNA segment enrichment method used for next generation sequencing |
| CN105506063A (en) * | 2014-09-22 | 2016-04-20 | 深圳华大基因科技有限公司 | Primer composition and uses thereof |
-
2016
- 2016-06-03 CN CN201610389568.6A patent/CN105861724B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103571822A (en) * | 2012-07-20 | 2014-02-12 | 中国科学院植物研究所 | Multipurpose DNA segment enrichment method used for next generation sequencing |
| CN105506063A (en) * | 2014-09-22 | 2016-04-20 | 深圳华大基因科技有限公司 | Primer composition and uses thereof |
Non-Patent Citations (1)
| Title |
|---|
| GUOLI CHEN等: "A Virtual Pyrogram Generator to Resolve Complex Pyrosequencing Results", 《THE JOURNAL OF MOLECULAR DIAGNOSTICS》 * |
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106755486A (en) * | 2017-01-19 | 2017-05-31 | 人和未来生物科技（长沙）有限公司 | The poor detection in Gene Mutation library constructing method in noninvasive prenatal foetal β types ground, detection method and kit |
| CN106755485A (en) * | 2017-01-19 | 2017-05-31 | 人和未来生物科技（长沙）有限公司 | The poor detection in Gene Mutation library constructing method in noninvasive prenatal foetal α types ground, detection method and kit |
| CN106834286A (en) * | 2017-04-05 | 2017-06-13 | 北京泛生子基因科技有限公司 | The primer combination of one-step method rapid build amplification sublibrary |
| CN106835292A (en) * | 2017-04-05 | 2017-06-13 | 北京泛生子基因科技有限公司 | The method that one-step method rapid build expands sublibrary |
| CN106834286B (en) * | 2017-04-05 | 2020-02-21 | 北京泛生子基因科技有限公司 | Primer combination for one-step method rapid construction of amplicon library |
| CN110651050A (en) * | 2017-07-21 | 2020-01-03 | 深圳华大生命科学研究院 | Targeted enrichment method and kit for detecting low-frequency mutation |
| CN107254541A (en) * | 2017-08-03 | 2017-10-17 | 广州万德基因医学科技有限公司 | Storehouse primer pond and application are built for expanding the NGS of multiple targets in cfDNA samples |
| CN107254541B (en) * | 2017-08-03 | 2020-05-08 | 广州万德基因医学科技有限公司 | NGS (Next Generation Stratagene) library-building primer pool for amplifying multiple targets in cfDNA (deoxyribonucleic acid) sample and application |
| CN113811618A (en) * | 2019-05-21 | 2021-12-17 | 深圳华大智造科技股份有限公司 | Sequencing library constructed based on methylated DNA target region, system and application |
| CN113811618B (en) * | 2019-05-21 | 2024-02-09 | 深圳华大智造科技股份有限公司 | Sequencing library construction based on methylated DNA target region, system and application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105861724B (en) | 2019-07-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105861724A (en) | KRAS gene ultralow frequency mutation detection kit | |
| Pérez-Callejo et al. | Liquid biopsy based biomarkers in non-small cell lung cancer for diagnosis and treatment monitoring | |
| ES2844229T3 (en) | Gene mutations and copy number alterations of EGFR, KRAS, and MET | |
| CN104630375B (en) | Cancer gene is mutated and gene magnification detection | |
| US10697022B2 (en) | PIK3CA novel mutations detection for diagnosis of acquired cetuximab resistance in metastatic colorectal cancer patients | |
| CN104450948A (en) | Cancer detecting method, kit and application thereof | |
| JP6864089B2 (en) | Postoperative prognosis or antineoplastic compatibility prediction system for patients with advanced gastric cancer | |
| CN105803088B (en) | The primer and probe and its kit of one group of detection Kras gene mutation | |
| CN103333952A (en) | Genetic polymorphisms in age-related macular degeneration | |
| CN105969857A (en) | Non-small cell lung cancer targeted therapy gene detection method | |
| CN106048008A (en) | EGFR gene ultralow frequency mutation detection kit | |
| CN104805203A (en) | VEGF polymorphisms and anti-angiogenesis therapy | |
| CN106868139A (en) | PCR primer, kit and purposes | |
| Wu et al. | A novel mutant-enriched liquidchip technology for the qualitative detection of somatic mutations in KRAS gene from both serum and tissue samples | |
| CN103923975A (en) | Kit for detecting deletion mutation of EGFR gene exon 19, and method thereof | |
| CN110004229A (en) | Application of the polygenes as EGFR monoclonal antibody class Drug-resistant marker | |
| JP2023505031A (en) | Methods and compositions for cancer analysis | |
| Jr et al. | The molecular evolution of acquired resistance to targeted EGFR blockade in colorectal cancers | |
| CN107937524A (en) | Mankind's KRAS gene mutation detection kit and detection method | |
| CN103911439A (en) | Analyzing method and application of differential expression gene of systemic lupus erythematosus hydroxymethylation status | |
| CN108588201B (en) | A kind of method and device of colorectal cancer Cetuximab drug resistance trace amount DNA abrupt climatic change | |
| CN103667267B (en) | For with the DNA probe storehouse of KRAS gene recombination and the method adopting its enrichment KRAS gene fragment | |
| CN109295177A (en) | A kind of micro mutation of human EGFR gene is enriched with pretreated primer, method and kit | |
| KR20180020930A (en) | Method for detecting genes related with TP53 mutation gene and selected marker compositions for predicting gastric cancer prognostication or drug reactivity by the same method | |
| WO2016106645A1 (en) | Primer for detecting colorectal cancer drug-related gene mutation and detection method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |