CN106834452A - The probe ligation amplification detection method of minigene group DNA - Google Patents
The probe ligation amplification detection method of minigene group DNA Download PDFInfo
- Publication number
- CN106834452A CN106834452A CN201710027293.6A CN201710027293A CN106834452A CN 106834452 A CN106834452 A CN 106834452A CN 201710027293 A CN201710027293 A CN 201710027293A CN 106834452 A CN106834452 A CN 106834452A
- Authority
- CN
- China
- Prior art keywords
- dna
- template
- reaction
- linked system
- micro
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of probe ligation amplification detection method of minigene group DNA, comprise the following steps：Minigene group DNA sample is concentrated or is evaporated in powdered；With the genomic DNA that concentrates or be evaporated as template is attached reaction, the volume of linked system is not higher than 20 μ L, and template DNA amount is not higher than 50ng；Micro coupled reaction system takes volatilization prevention measure, reduces the contact area of reaction system and air；Multiplexed PCR amplification is carried out by template of the product of coupled reaction；Obtain amplified production.Template demand of the present invention is few：In micro linked system of the invention, the total amount of DNA profiling also can reach the connection effect of conventional linked system less than 50ng；Specificity and stability are high, and DNA profiling total amount also can reach the connection specificity and stability of conventional linked system less than 50ng；Reagent loss is small：The relatively conventional system volume reduction of micro linked system of the invention is more, therefore the reagent loss of each composition is also reduced relatively, has saved reagent cost.
Description
Technical field
The present invention relates to a kind of probe ligation amplification detection method of minigene group DNA.
Background technology
Multiple probe ligation amplification technology (MLPA) is the one kind invented by Dutch scholar Schouten for 2002 to be measured
Target sequence carries out the technology of qualitative and quantitative analysis in nucleic acid.Using probe hybridization, connection and multi-PRC reaction, it can be same
When the multiple target nucleic acid sequences of detection presence and copy number change.MLPA with its high specific, it is convenient and swift the features such as, it is wide
Gene or the abnormal detection of chromosome segment copy number are applied to generally.2012, researcher was in the technical foundation of MLPA
A kind of high flux probe ligation amplification technology HLPA (high-throughput ligation-dependent probe are invented
Amplification), the flux and efficiency of detection are greatly improved.2015, Zhang et al. was successfully carried out using HLPA
Diagnosis to congenital heart disease, embodies application of this technology in clinical diagnosis.Additionally, as the beneficial of karyotyping
Supplement, probe ligation amplification technology can be used for the pre-natal diagnosis of foetal chromosome aneuploidy in clinical amniotic fluid sample.
Although MLPA and HLPA is widely used in scientific research and clinic, deficiency is technically still suffered from, such as in probe
More template DNA is needed to use in combining target DNA and follow-up enzyme coupled reaction.In conventional coupled reaction system
(http://www.mrc-holland.com) in the demand of template DNA be 50-250ng.So, it is micro for some
DNA sample may there is sample size and cannot meet the situation of requirement of experiment because researcher may be from extremely small
Tissue, even unicellular middle extraction nucleic acid to be detected.Accordingly, it is difficult to detect that minim DNA becomes MLPA and HLPA and dividing
Technical bottleneck in sub- diagnostic field.
When initial nucleic acid amount is relatively low, researcher is usually taken following methods：(1) more sample extractings are chosen
DNA/RNA.This method feasibility in practical operation is not high, because sample (tissue, blood etc.) is limited, it is impossible to largely obtain
；(2) the nucleic acid extraction method that extracted amount is higher is used.This means often means that the increase of experimental cost, is unfavorable for
Application in clinic；(3) the pre- TRAP of primer extend (Primer Extension Pre-amplification, PEP) is used
The random primer template DNA relatively low to content carries out pre- amplification.But this way can cause the inhomogeneity and non-specific of amplification
Property amplification, influence subsequent detection accuracy.
Current, any report display probe ligation amplification technology there is no to be detected to the DNA of below 50ng.Examine
The cost for considering this technology is relatively low and very accurate to the detection of copy number, if it is possible to effectively detect minim DNA, will be into
It is a new breakthrough of clinical molecular diagnosis technology.
The content of the invention
It is an object of the invention to the problem above for overcoming prior art to exist, there is provided a kind of spy of minigene group DNA
Pin ligation amplification detection method, this method is that the DNA by initial amount less than 50ng is concentrated or is evaporated in after powdered, with micro-
Quantitative response system (reaction solution cumulative volume is not higher than 20 μ L, and template DNA addition is no more than 50ng) is attached reaction (liquid table
Face cover organic reagent, such as mineral oil with prevent volatilization), to reach expected experiment effect.
To realize above-mentioned technical purpose, above-mentioned technique effect is reached, the present invention is achieved through the following technical solutions：
A kind of probe ligation amplification detection method of minigene group DNA, comprises the following steps：
1) minigene group DNA sample is concentrated or is evaporated in powdered；
2) with the genomic DNA that concentrates or be evaporated as template is attached reaction, the volume of linked system is not higher than 20 μ L,
Template DNA amount is not higher than 50ng；
3) micro linked system takes volatilization prevention measure, reduces the contact area of reaction system and air, such as in liquid level
Cover organic reagent, reaction etc. is attached using the capillary of endcapped.
4) multiplexed PCR amplification is carried out by template of the product of coupled reaction；
5) amplified production is obtained.
Further, the amplified production is used for subsequent experimental, including fluorescent capillary electrophoresis, the sequencing of the generation of high flux two or base
One or more experiment in because of chip detection.
The beneficial effects of the invention are as follows:
1st, template demand is few：In micro linked system of the invention, the total amount of DNA profiling also can reach less than 50ng
The Detection results of conventional linked system, the situation few to DNA content, such as pregnant woman blood plasma dissociative DNA can be detected, dashed forward
The bottleneck of conventional probe ligation amplification reaction is broken.
2nd, reagent loss is small：The relatively conventional system volume of micro linked system of the invention reduce it is more, therefore each into
The reagent loss divided is also relative to be reduced, and has saved reagent cost.
3rd, atopic, stability are high：In micro linked system, DNA profiling amount can reach routine less than 50ng
The specificity and stability of linked system.
Described above is only the general introduction of technical solution of the present invention, in order to better understand technological means of the invention,
And can be practiced according to the content of specification, below with presently preferred embodiments of the present invention and coordinate accompanying drawing describe in detail as after.
Specific embodiment of the invention is shown in detail by following examples and its accompanying drawing.
Brief description of the drawings
Accompanying drawing described herein is used for providing a further understanding of the present invention, constitutes the part of the application, this hair
Bright schematic description and description does not constitute inappropriate limitation of the present invention for explaining the present invention.In the accompanying drawings：
Fig. 1 is minigene group DNA probe coupled reaction flow；
Fig. 2 is that different systems detect sample peak figure；
The coefficient of variation (CV) of Fig. 3 different detection architectures compares；
Fig. 4 is that the copy number average value in the different all sites to be measured of system compares.
Specific embodiment
Describe the present invention in detail below with reference to the accompanying drawings and in conjunction with the embodiments.
The embodiment carries out the probe coupled reaction of minim DNA system to initial amount for the human genome DNA of 5ng, with
As a example by MLPA technologies, copy number detection is carried out to 13 sites (site to be measured) on No. 21 chromosomes, have chosen 5 non-No. 21
The site of chromosome is used as with reference to site.Selected site information is referring to table 1.Probe sequence is shown in Table 2 and table 3, wherein, sequence
Such as sequence table SEQ ID NO.:1 to SEQ ID NO.:Shown in 36.In probe and genome site sequence specific binding to be measured
Afterwards, the reaction system (system 1 of different volumes is used using ligase：The μ L of volume 20；System 2：The μ L of volume 12；System 3：Volume 5
μ L) it is attached reaction.Connection product carries out multiple fluorescence PCR amplification, separates different size of fragment simultaneously by electrocapillary phoresis
Copy number to 13 sites to be measured is calculated, and each system carries out 5 repetitions and tests.
The site to be measured of table 1 and reference site information
Table 25 ' holds probe sequence
Table 33 ' holds probe sequence
First, sample is detected
Sample is the healthy human gene group DNA extracted from haemocyte.
2nd, detection method
Mainly include the following steps that：
Sample to be tested is carried out into accurate quantification with real-time PCR, the DNA vacuum that total amount is 5ng is then taken and is drained work
It is sample to be tested.
This experiment needs following reagent：ddH2O, 10 × ligase buffer (NEB, B0208S), Taq DNA ligases
(NEB, M0208L), linking probe mixed liquor, testing gene group DNA (vacuum is drained), 10 × PCR buffer (Takara,
R007WZ), MgCl2, dNTP, Taq archaeal dna polymerase (Takara, R007WZ), PCR primer mixed liquor.
A. linked system is prepared：
System 1 (20 μ L)：
System 2 (12 μ L)：
System 3 (5 μ L)：
Remarks：System 3 need to add 10 μ L mineral oil, prevent reaction system from volatilizing.
Coupled reaction condition setting is as follows：95℃2min；4 circulations (96 DEG C of 20s, 60 DEG C of 4h)；94 DEG C of 2min, at 72 DEG C
Preserve.Reaction is needed to add after terminating and stops reaction, concussion with the isometric reaction terminating liquid of coupled reaction volume (20mM EDTA)
It is centrifuged after mixing.
B. the product of coupled reaction carries out multiplexed PCR amplification with the universal primer with fluorescence labeling, primer sequence and glimmering
Signal is shown in Table 4.
The multiple fluorescence PCR of table 4 reacts primer information
| Primer | Fluorescence labeling | Sequence (5'-3') |
| Forward primer | VIC | TATTCGCTCATAACGGGTTCG |
| Reverse primer | Nothing | GTTTCTTGCTTCCCTAGAGCGGGTGATTT |
Multiple fluorescence PCR reaction system prepares (30 μ L)：
PCR reaction conditions set as follows：95℃2min；5 cyclic amplifications (94 DEG C of 20s, 62 DEG C -1 DEG C often circulation 40s and
72℃90s)；28 cyclic amplifications (94 DEG C of 20s, 57 DEG C of 40s and 72 DEG C of 90s), 60min, 4 DEG C of preservations are extended at 68 DEG C.
C. capillary electrophoresis separation amplified production
Take 1 μ l Multiplex fluorescent PCR products ddH2O dilutes 10 times, then takes the Hi-Di (ABI) that 1 μ l are added to 8.9 μ l
In the LIZ500 endogenous controls (ABI) of 0.1 μ l, after 95 DEG C of 5min denaturation, being placed on 3730XL sequenators carries out capillary electricity
Swimming.
Electrophoresis result carries out data analysis using GeneMapper4.0 softwares, reads the data, reference picture 2, Fig. 3 such as peak height
It is shown.
3rd, data analysis
1. site peak type and peak height initial data
Fig. 2 and Fig. 3 show differential responses system negative control and pattern detection peak figure result.
The computational methods of copy number are illustrated by taking system 3 as an example.A site (T015) is chosen from 13 sites to be measured, it is right
5 are answered with reference to site (TREF37,38,39,40,41).Table 5 is site to be measured (T015) and corresponding with reference to site (TREF)
Peak height data.
The sample site peak height data of table 5
2. sample correction
Calculate site peak height to be measured respectively with the corresponding ratio with reference to site peak height, all samples should in taking same system
The median of site peak height ratios to be measured is the corrected value in the site.
The site to be measured of table 6 and the peak height ratios with reference to site
3. site copy number is calculated
The peak height ratios being calculated with reference to site with each are all to calculate should refer to site divided by corresponding corrected value
Relative copy number median be multiplied by 2 be absolute copy number.For the absolute copy number that is calculated with reference to site
Average value be the final copy number calculated value in the site.Result of calculation is shown in Table 7.
The site copy number result of calculation of table 7
4. the CV values of single sample all sites are calculated
Table 8 to table 10 is the CV value calculating methods of single sample all sites
Formula：The average value (Mean) of the standard deviation (SD) of CV=site copy numbers to be measured/site copy number to be measured
The average CV values of all sites of 8 system of table 1
The average CV values of all sites of 9 system of table 2
The average CV values of all sites of 10 system of table 3
5. all sites copy number of different systems is calculated and compared
Fig. 4 shows the average copy number that 13 sites to be measured are calculated in the experiment of system 1,2,3.Because sample is
Normal gene group DNA, so theoretical copy number is 2., it is apparent that the copy number that system 3 is obtained is in different sites to be measured
Between error it is minimum, CV values minimum (Fig. 3) in three systems, result of calculation is also closest to theoretical value.
4th, conclusion
Found by contrast experiment, for the detection of the genomic DNA sample less than 50ng, be evaporated by sample concentration,
Reaction is attached with micro system, expected experiment effect can be reached.In the case where template DNA is fixed, reactant is reduced
It is that the CV that volume is obtained is smaller, it is as a result more accurate.
Under conditions of template DNA addition is certain, compared with system 1 and system 2, system 3 has following advantage：1st, it is cloudy
Property control in non-specific peak heights it is relatively low；2nd, in pattern detection result peak figure, non-specific peak height is substantially reduced, often
The corresponding peak height in individual site is higher, and peak type is more homogeneous；3rd, the fluctuation of sample all sites is small, and stable experiment is more preferable.
The preferred embodiments of the present invention are the foregoing is only, is not intended to limit the invention, for the skill of this area
For art personnel, the present invention can have various modifications and variations.It is all within the spirit and principles in the present invention, made any repair
Change, equivalent, improvement etc., should be included within the scope of the present invention.
SEQUENCE LISTING
<110>Its vast and boundless biological medicine science and technology (Suzhou) Co., Ltd
<120>The probe ligation amplification detection method of minigene group DNA
<160> 36
<170> PatentIn version 3.5
<210> 1
<211> 44
<212> DNA
<213> Artificial Sequence
<400> 1
tattcgctca taacgggttc gtgcaaaact gtggccagtt atgc 44
<210> 2
<211> 42
<212> DNA
<213> Artificial Sequence
<400> 2
tattcgctca taacgggttc gcagcggttc gccaacaaga ag 42
<210> 3
<211> 48
<212> DNA
<213> Artificial Sequence
<400> 3
tattcgctca taacgggttc gccctaagag agaagccatg tggaggag 48
<210> 4
<211> 51
<212> DNA
<213> Artificial Sequence
<400> 4
tattcgctca taacgggttc gcgatccaga gagcagggca ggagatgata c 51
<210> 5
<211> 48
<212> DNA
<213> Artificial Sequence
<400> 5
tattcgctca taacgggttc gcgatttctg ctggcagaca ccatttgt 48
<210> 6
<211> 50
<212> DNA
<213> Artificial Sequence
<400> 6
tattcgctca taacgggttc gcgattcatt ttccatttag ggaatgtggg 50
<210> 7
<211> 52
<212> DNA
<213> Artificial Sequence
<400> 7
tattcgctca taacgggttc gcgatggtat ttccaaatca gacattttgc cc 52
<210> 8
<211> 54
<212> DNA
<213> Artificial Sequence
<400> 8
tattcgctca taacgggttc gcgatcgatc gtgctctttc ctctccaaat ggga 54
<210> 9
<211> 55
<212> DNA
<213> Artificial Sequence
<400> 9
tattcgctca taacgggttc gcgatcgtct ttttaacaac tcatctccct gagcc 55
<210> 10
<211> 54
<212> DNA
<213> Artificial Sequence
<400> 10
tattcgctca taacgggttc gcgatcgatc cctttgactg gtttgtggcc atct 54
<210> 11
<211> 57
<212> DNA
<213> Artificial Sequence
<400> 11
tattcgctca taacgggttc gcgatcgatc gttttaaaaa atgccctact ccttccc 57
<210> 12
<211> 61
<212> DNA
<213> Artificial Sequence
<400> 12
tattcgctca taacgggttc gcgatcgatc gatcgaatcc tgaaccacac tctcagagcc 60
t 61
<210> 13
<211> 62
<212> DNA
<213> Artificial Sequence
<400> 13
tattcgctca taacgggttc gcgatcgatc gatcgcatag acatatggac cagcaatcag 60
gc 62
<210> 14
<211> 62
<212> DNA
<213> Artificial Sequence
<400> 14
tattcgctca taacgggttc gcgatcgatc gatcgatcga tggtgcgcgc tcctcctaac 60
tc 62
<210> 15
<211> 66
<212> DNA
<213> Artificial Sequence
<400> 15
tattcgctca taacgggttc gcgatcgatc gatcgatcga tcgccaccct ccagtagcct 60
tttcct 66
<210> 16
<211> 67
<212> DNA
<213> Artificial Sequence
<400> 16
tattcgctca taacgggttc gcgatcgatc gatcgatcga tgcacacaag ctcacccact 60
caagtta 67
<210> 17
<211> 66
<212> DNA
<213> Artificial Sequence
<400> 17
tattcgctca taacgggttc gcgatcgatc gatcgtattt tctatcacct tggaaaggca 60
ctattt 66
<210> 18
<211> 67
<212> DNA
<213> Artificial Sequence
<400> 18
tattcgctca taacgggttc gcgatcgatc gatcgattct attatagttt gaccatagcc 60
acatggg 67
<210> 19
<211> 41
<212> DNA
<213> Artificial Sequence
<400> 19
cgcagcacgg agtgagtgac aaatcacccg ctctagggaa g 41
<210> 20
<211> 46
<212> DNA
<213> Artificial Sequence
<400> 20
tggtaaagta gcaaaaatgg ggatgaaatc acccgctcta gggaag 46
<210> 21
<211> 44
<212> DNA
<213> Artificial Sequence
<400> 21
cgaggcgggt ttgatgtgtg cgaaaatcac ccgctctagg gaag 44
<210> 22
<211> 45
<212> DNA
<213> Artificial Sequence
<400> 22
agaaataaga gcaggggaga ggggaaatca cccgctctag ggaag 45
<210> 23
<211> 49
<212> DNA
<213> Artificial Sequence
<400> 23
gaatggacag ttttccagat ggtggcgaaa atcacccgct ctagggaag 49
<210> 24
<211> 50
<212> DNA
<213> Artificial Sequence
<400> 24
agctctggtc agagacccac agatcgatca aatcacccgc tctagggaag 50
<210> 25
<211> 51
<212> DNA
<213> Artificial Sequence
<400> 25
aaaattgctg cccctctctg gttcgatcga aaatcacccg ctctagggaa g 51
<210> 26
<211> 53
<212> DNA
<213> Artificial Sequence
<400> 26
cttccccaaa tcaggaaaat gtgacccgat cgaaatcacc cgctctaggg aag 53
<210> 27
<211> 55
<212> DNA
<213> Artificial Sequence
<400> 27
ctgcaaaaca gagcacctcc tcccgatcga tcgaaaatca cccgctctag ggaag 55
<210> 28
<211> 56
<212> DNA
<213> Artificial Sequence
<400> 28
gttgtcctct ctgttacggc ctcatccgat cgatcaaatc acccgctcta gggaag 56
<210> 29
<211> 58
<212> DNA
<213> Artificial Sequence
<400> 29
accactggaa atttgggcag agtccgatcg atcgatcaaa tcacccgctc tagggaag 58
<210> 30
<211> 58
<212> DNA
<213> Artificial Sequence
<400> 30
aatgcatcac ttgtgccaga agaatccgat cgatcgaaaa tcacccgctc tagggaag 58
<210> 31
<211> 60
<212> DNA
<213> Artificial Sequence
<400> 31
gaatacagag ccctttggac atcttgccga tcgatcgata aatcacccgc tctagggaag 60
<210> 32
<211> 62
<212> DNA
<213> Artificial Sequence
<400> 32
ggggtcgctt ttagcgagaa gtgcgatcga tcgatcgatc gaaatcaccc gctctaggga 60
ag 62
<210> 33
<211> 63
<212> DNA
<213> Artificial Sequence
<400> 33
ggtggttctg cattgtacct gagaaacgat cgatcgatcg ataaatcacc cgctctaggg 60
aag 63
<210> 34
<211> 65
<212> DNA
<213> Artificial Sequence
<400> 34
catgtataca tatgcaggaa ggcacaagta ccgatcgatc gatcaaatca cccgctctag 60
ggaag 65
<210> 35
<211> 66
<212> DNA
<213> Artificial Sequence
<400> 35
ctctgagcct ggatttgttt tctgccgatc gatcgatcga tcgataaatc acccgctcta 60
gggaag 66
<210> 36
<211> 67
<212> DNA
<213> Artificial Sequence
<400> 36
aagttatgcc agtggacatt cctttgcgat cgatcgatcg atcgataaat cacccgctct 60
agggaag 67
Claims (2)
1. a kind of probe ligation amplification detection method of minigene group DNA, it is characterised in that comprise the following steps：
1) minigene group DNA sample is concentrated or is evaporated in powdered；
2) with the genomic DNA that concentrates or be evaporated as template is attached reaction, the volume of linked system is not higher than 20 μ L, template
Amount of DNA is not higher than 50ng；
3) micro linked system takes volatilization prevention measure, reduces the contact area of reaction system and air, such as covered in liquid level
Organic reagent, using the capillary of endcapped be attached reaction etc..
4) multiplexed PCR amplification is carried out by template of the product of coupled reaction；
5) amplified production is obtained.
2. probe ligation amplification detection method according to claim 1, it is characterised in that：The amplified production is used for follow-up
One or more experiment in experiment, including fluorescent capillary electrophoresis, the sequencing of the generation of high flux two or genechip detection.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710027293.6A CN106834452A (en) | 2017-01-13 | 2017-01-13 | The probe ligation amplification detection method of minigene group DNA |
| PCT/CN2018/072463 WO2018130208A1 (en) | 2017-01-13 | 2018-01-12 | Ligation-dependent probe amplification detection method for trace dna |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710027293.6A CN106834452A (en) | 2017-01-13 | 2017-01-13 | The probe ligation amplification detection method of minigene group DNA |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106834452A true CN106834452A (en) | 2017-06-13 |
Family
ID=59124895
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710027293.6A Pending CN106834452A (en) | 2017-01-13 | 2017-01-13 | The probe ligation amplification detection method of minigene group DNA |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN106834452A (en) |
| WO (1) | WO2018130208A1 (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108018339A (en) * | 2018-02-05 | 2018-05-11 | 中国科学院昆明植物研究所 | The detection primer of vegetalitas DNA highly in degraded sample |
| WO2018130208A1 (en) * | 2017-01-13 | 2018-07-19 | 天昊生物医药科技（苏州）有限公司 | Ligation-dependent probe amplification detection method for trace dna |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2008000045A (en) * | 2006-06-21 | 2008-01-10 | Olympus Corp | Method for detecting nucleic acid |
| EP1932924A1 (en) * | 2006-11-22 | 2008-06-18 | FUJIFILM Corporation | Nucleic acid amplification method using microchip and microchip, and nucleic acid amplification system using the same |
| JP6234463B2 (en) * | 2012-09-10 | 2017-11-22 | ジーンスカイ ダイアグノスティクス（スーツォウ） インコーポレーテッドＧｅｎｅｓｋｙ Ｄｉａｇｎｏｓｔｉｃｓ （Ｓｕｚｈｏｕ） Ｉｎｃ． | Nucleic acid multiplex analysis method |
| CN103898199B (en) * | 2012-12-27 | 2016-12-28 | 上海天昊生物科技有限公司 | A kind of high-throughput nucleic acid analysis method and application thereof |
| CN106834452A (en) * | 2017-01-13 | 2017-06-13 | 天昊生物医药科技（苏州）有限公司 | The probe ligation amplification detection method of minigene group DNA |
-
2017
- 2017-01-13 CN CN201710027293.6A patent/CN106834452A/en active Pending
-
2018
- 2018-01-12 WO PCT/CN2018/072463 patent/WO2018130208A1/en active Application Filing
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018130208A1 (en) * | 2017-01-13 | 2018-07-19 | 天昊生物医药科技（苏州）有限公司 | Ligation-dependent probe amplification detection method for trace dna |
| CN108018339A (en) * | 2018-02-05 | 2018-05-11 | 中国科学院昆明植物研究所 | The detection primer of vegetalitas DNA highly in degraded sample |
| CN108018339B (en) * | 2018-02-05 | 2021-03-19 | 中国科学院昆明植物研究所 | Detection primer for highly degrading plant DNA in sample |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2018130208A1 (en) | 2018-07-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102337338B (en) | Method for simultaneously and quickly detecting number of five types of chromosomes, and kit and application thereof | |
| CN106536735B (en) | Probe set for analyzing DNA sample and method for using the same | |
| CN107227361A (en) | Primer, probe and detection kit for detecting CYP2C19 gene pleiomorphisms | |
| CN106434940A (en) | Kit used for SNP detection of personalized medicine relaed genes of statin lipid-lowering medicine and detecting method thereof | |
| CN106701978A (en) | Human microsatellite instability (MSI) detection amplification primer composition and kit | |
| CN106498036A (en) | A kind of construction method in the Drug Discovery SNP variations library for high-flux sequence detection and its application | |
| CN108913757A (en) | A kind of primer sets of chromosome aneuploid numerical abnormality and detection kit and its application | |
| CN104120178A (en) | Method for detection of ESR1 gene mutations based on fluorescent PCR technology | |
| CN101805790A (en) | Method for simultaneously detecting polymorphism of 32 SNP loci on 24 sports-related genes | |
| CN106939334B (en) | Method for detecting fetal DNA content in plasma of pregnant woman | |
| CN109706145B (en) | Primer set and application thereof | |
| CN106834452A (en) | The probe ligation amplification detection method of minigene group DNA | |
| CN110846408A (en) | Primer combination for detecting TTN gene mutation and application thereof | |
| CN106906210A (en) | A kind of fusion primer combination of rapid build amplification sublibrary | |
| CN108070636A (en) | A kind of processing method and kit of fluorescent PCR amplified sample | |
| CN106497916A (en) | A kind of construction method in the NK cell polygenic variations library for high-flux sequence detection and its application | |
| CN109321651A (en) | A kind of composition, kit, sample treatment and application detecting people CYP2D6 gene pleiomorphism | |
| CN109355358A (en) | A kind of kit and method rapidly and efficiently detecting drug induccd skin adverse reaction related gene polymorphism | |
| CN113403381A (en) | Detection kit for statin curative effect prediction and detection method and application thereof | |
| CN107058309A (en) | A kind of SNP detection method of thio-modification primer and the application primer | |
| CN115418394A (en) | Composition, kit and method for detecting CHO cell genome DNA | |
| CN109735645A (en) | A kind of real-time fluorescence PCR primer, probe and kit detecting spherical sporothrix | |
| CN114438233A (en) | Group of X chromosome Multi-DIP synchronous typing detection systems for genetic relationship identification | |
| WO2018205157A1 (en) | Method and detection kit for detecting activity of dna polymerase | |
| CN105861690A (en) | Primer combination, reagent kit and method for detecting CYP2C19*2 and CYP2C19*3 polymorphism |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20170613 |
|
| WD01 | Invention patent application deemed withdrawn after publication |