CN106906210A - A kind of fusion primer combination of rapid build amplification sublibrary - Google Patents
A kind of fusion primer combination of rapid build amplification sublibrary Download PDFInfo
- Publication number
- CN106906210A CN106906210A CN201710219007.6A CN201710219007A CN106906210A CN 106906210 A CN106906210 A CN 106906210A CN 201710219007 A CN201710219007 A CN 201710219007A CN 106906210 A CN106906210 A CN 106906210A
- Authority
- CN
- China
- Prior art keywords
- amplicon
- sequence
- seq
- genes
- design
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1034—Isolating an individual clone by screening libraries
- C12N15/1093—General methods of preparing gene libraries, not provided for in other subgroups
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- C—CHEMISTRY; METALLURGY
- C40—COMBINATORIAL TECHNOLOGY
- C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
- C40B50/00—Methods of creating libraries, e.g. combinatorial synthesis
- C40B50/06—Biochemical methods, e.g. using enzymes or whole viable microorganisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Plant Pathology (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Crystallography & Structural Chemistry (AREA)
- Bioinformatics & Computational Biology (AREA)
- General Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Immunology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of fusion primer combination of rapid build amplification sublibrary, it includes that primer is merged in the fused upstream primer designed according to target amplicon and the downstream designed according to target amplicon, wherein：The fused upstream primer designed according to target amplicon includes the first joint sequence being arranged in order according to 5 ' to 3 ' direction, barcode sequences, the second joint sequence and the specific forward primer sequence designed according to target amplicon；The downstream fusion primer designed according to target amplicon includes the 3rd joint sequence being arranged in order according to 5 ' to 3 ' direction and the specific Down Stream primer sequence designed according to target amplicon.Being combined using the fusion primer can build amplification sublibrary with easy, quick through 1 step PCR, and due to just introducing barcode in PCR startings, so that the possibility of cross pollution is substantially reduced between sample and library, and the requirement of experimental site subregion can be simplified, single sample can also be set up the cost control in library in 30 yuan/by fusion primer combination.
Description
Technical field
The present invention relates to a kind of field of biological detection, more particularly to a kind of rapid build expands the fusion primer sets of sublibrary
Close.
Background technology
The next generation sequencing (next-generation sequencing, NGS) due to high flux, high sensitivity, highly from
The characteristics such as dynamicization, are employed more and more in the research and diagnoses and treatment of disease in recent years.NGS technologies can realize polygenes
Parallel testing, sample is saved than traditional detection method, and sensitivity is higher, can more truly reduce tumour variation panorama.But Life
The method and step of structure amplification sublibrary traditional in NGS platforms is cumbersome, it is necessary to by PCR amplifications, digestion, adjunction head, purifying
Etc. step, it is necessary to spend about 5h；And due to needing to uncap in multi-step operation, therefore library is easily contaminated, library loss late
It is high；In addition in the method for traditional structure amplification sublibrary, single sample sets up the relatively costly of library, is 200-1000
Unit/example.
The information for being disclosed in the background section is merely intended to increase the understanding to general background of the invention, without answering
In being considered as recognizing or imply in any form that the information structure has been the prior art well known to persons skilled in the art.
The content of the invention
It is an object of the invention to provide a kind of fusion primer combination of rapid build amplification sublibrary.Drawn using the fusion
Thing combination can build amplification sublibrary with easy, quick through 1 step PCR, and due to just introducing barcode in PCR startings, make
Obtain the possibility of cross pollution between sample and library to substantially reduce, and the requirement of experimental site subregion can be simplified, the fusion primer
Single sample can also be set up the cost control in library in 30 yuan/by combination.
To achieve the above object, the invention provides following technical scheme：
A kind of fusion primer combination of the amplification sublibrary for constructed dna sample, including：Designed according to target amplicon
Fused upstream primer and according to target amplicon design downstream merge primer, wherein：
The fused upstream primer designed according to target amplicon includes be arranged in order according to 5 ' to 3 ' direction the
One joint sequence (A sequences), barcode sequences, the second joint sequence and according to target amplicon design specific upstream draw
Thing sequence；
The downstream fusion primer designed according to target amplicon includes be arranged in order according to 5 ' to 3 ' direction the
Three joint sequences (trP1 sequences) and the specific Down Stream primer sequence designed according to target amplicon.
The fusion primer combination of the above-mentioned amplification sublibrary for constructed dna sample is in another embodiment, described
First joint sequence includes SEQ ID:1 sequence, SEQ ID:The nucleotides sequence of 1 sequence is classified as
CCATCTCATCCCTGCGTGTCTCCGACTCAG。
The fusion primer combination of the above-mentioned amplification sublibrary for constructed dna sample in another embodiment, is used for
In the fusion primer combination of the amplification sublibrary for building same DNA sample, the barcode sequence phases in fused upstream primer
Together；During fusion primer for building the amplification sublibrary of different DNA samples is combined, the barcode sequences in fused upstream primer
Row are different.
The fusion primer combination of the above-mentioned amplification sublibrary for constructed dna sample is in another embodiment, described
Second joint sequence includes nucleotide sequence GAT.
The fusion primer combination of the above-mentioned amplification sublibrary for constructed dna sample is in another embodiment, described
3rd joint sequence includes SEQ ID:2 sequences, SEQ ID:The nucleotides sequence of 2 sequences is classified as
CCTCTCTATGGGCAGTCGGTGAT。
It is above-mentioned for constructed dna sample amplification sublibrary fusion primer combination in another embodiment, according to
The fused upstream primer of any one target amplicon design and the downstream fusion designed according to any one target amplicon are drawn
The concentration of thing is 100 μM.
The fusion primer of the above-mentioned amplification sublibrary for constructed dna sample is combined in another embodiment, when same
During the quantity ＞ 1 of the target amplicon in one PCR reaction, the fused upstream primer designed according to target amplicon is root
The combination of the fused upstream primer designed according to each target amplicon, the downstream fusion designed according to target amplicon is drawn
The combination of primer is merged in the downstream of each target amplicon design according to thing.
It is above-mentioned for constructed dna sample amplification sublibrary fusion primer combination in another embodiment, according to
Rubbing for primer is merged in the fused upstream primer of any one target amplicon design and the downstream designed according to the target amplicon
You are than being 1:1.
The fusion primer combination of the above-mentioned amplification sublibrary for constructed dna sample is in another embodiment, described
DNA sample is genomic DNA.
The fusion primer of the above-mentioned amplification sublibrary for constructed dna sample is combined in another embodiment, gene
Group DNA extracts from tissue samples or formalin fix FFPE sample.
The fusion primer combination of the above-mentioned amplification sublibrary for constructed dna sample is in another embodiment, described
Target amplicon includes being selected from the group at least one of 22 kinds of target amplicons：
The Chr2 of ALK gene:29432588-29432707 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 3：
TAAGGGACAAGCAGCCACACCCCATTCTTGAGGGGCTGAGGTGGAAGAGACAGGCCCGGAGGGGTGAGGCAGTCTTT
ACTCACCTGTAGATGTCTCGGGCCATCCCGAAGTCTCCAATCTTGGCCACTCTTCCAGGGCCTGGACAGGTCAAGAG
GCAGT；
The Chr2 of ALK gene:29443616-29443730 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 4：
CGGAGGAAGGACTTGAGGTCTCCCCCCGCCATGAGCTCCAGCAGGATGAACCGGGGCAGGGATTGCAGGCTCACCCC
AATGCAGCGAACAATGTTCTGGTGGTTGAATTTGCTGCAGAGCAGAGAGGGATGTAACCAAAATTAACTGAGCTGAG
TCTGG；
The Chr7 of BRAF gene:140453091-140453197 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 5：
CCTCAATTCTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACT
GTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGGTGTAGTAAGTAAAGGA
AAACAGTAG；
The Chr7 of EGFR gene:55241604-55241726 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 6：
TGACCCTTGTCTCTGTGTTCTTGTCCCCCCCAGCTTGTGGAGCCTCTTACACCCAGTGGAGAAGCTCCCAACCAAGC
TCTCTTGAGGATCTTGAAGGAAACTGAATTCAAAAAGATCAAAGTGCTGGGCTCCGGTGCGTTCGGCACGGTGTATA
AGGTAAGGTCCCTGG；
The Chr7 of EGFR gene:55242398-55242513 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 7：
ACAATTGCCAGTTAACGTCTTCCTTCTCTCTCTGTCATAGGGACTCTGGATCCCAGAAGGTGAGAAAGTTAAAATTC
CCGTCGCTATCAAGGAATTAAGAGAAGCAACATCTCCGAAAGCCAACAAGGAAATCCTCGATGTGAGTTTCTGCTTT
GCTGTGT；
The Chr7 of EGFR gene:55248970-55249096 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 8：
GAAGCCACACTGACGTGCCTCTCCCTCCCTCCAGGAAGCCTACGTGATGGCCAGCGTGGACAACCCCCACGTGTGCC
GCCTGCTGGGCATCTGCCTCACCTCCACCGTGCAGCTCATCACGCAGCTCATGCCCTTCGGCTGCCTCCTGGACTAT
GTCCGGGAACAC；
The Chr7 of EGFR gene:55259505-55259621 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 9：
CCGCAGCATGTCAAGATCACAGATTTTGGGCTGGCCAAACTGCTGGGTGCGGAAGAGAAAGAATACCATGCAGAAGG
AGGCAAAGTAAGGAGGTGG CTTTAGGTCAGCCAGCATTTTCCTGACACCAGGGACCAGGCTGCCTTCCCACTAGCT
GTATTGTTTA；
The Chr17 of ERBB2 genes:37880969-37881082 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 10：
CATACCCTCTCAGCGTACCCTTGTCCCCAGGAAGCATACGTGATGGCTGGTGTGGGCTCCCCATATGTCTCCCGCCT
TCTGGGCATCTGCCTGACATCCACGGTGCAGCTGGTGACACAGCTTATGCCCTATGGCTGCCTCTTAGACCATGTCC
G；
The Chr12 of KRAS genes:25380261-25380363 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 11：
AGTCCTCATGTACTGGTCCCTCATTGCACTGTACTCCTCTTGACCTGCTGTGTCGAGAATATCCAAGAGACAGGTTT
CTCCATCAATTACTACTTGCTTCCTGTAGGAATCCTGAGAAGGGAGAAACACAGTCTGGATTATTACAGTGCA；
The Chr12 of KRAS genes:25398183-25398310 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 12：
AAAGAATGGTCCTGCACCAGTAATATGCATATTAAAACAAGATTTACCTCTATTGTTGGATCATATTCGTCCACAAA
ATGATTCTGAATTAGCTGTATCGTCAAGGCACTCTTGCCTACGCCACCAGCTCCAACTACCACAAGTTTATATTCAG
TCATTTTCAGCAGGCCTT；
The Chr7 of MET genes:116340233-116340335 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 13：
TCGATCTGCCATGTGTGCATTCCCTATCAAATATGTCAACGACTTCTTCAACAAGATCGTCAACAAAAACAATGTGA
GATGTCTCCAGCATTTTTACGGACCCAATCATGAGCACTGCTTTAATAGGGTAAGTCACATCAGTTCCC；
The Chr7 of MET genes:116411880-116412005 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 14：
CCATGATAGCCGTCTTTAACAAGCTCTTTCTTTCTCTCTGTTTTAAGATCTGGGCAGTGAATTAGTTCGCTACGATG
CAAGAGTACACACTCCTCATTTGGATAGGCTTGTAAGTGCCCGAAGTGTAAGCCCAACTACAGAAATGGTTTCAAAT
GAATCTGTAGACTACCGAGCT；
The Chr7 of MET genes:116417426-116417546 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 15：
ATGTTACGCAGTGCTAACCAAGTTCTTTCTTTTGCACAGGGCATTTTGGTTGTGTATATCATGGGACTTTGTTGGAC
AATGATGGCAAGAAAATTCACTGTGCTGTGAAATCCTTGAACAGTAAGTGGCATTTTATTTAACCATGGAGTATACT
TTTGTGGTTTGCAAC；
The Chr7 of MET genes:116423399-116423499 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 16：
CAGTCAAGGTTGCTGATTTTGGTCTTGCCAGAGACATGTATGATAAAGAATACTATAGTGTACACAACAAAACAGGT
GCAAAGCTGCCAGTGAAGTGGATGGCTTTGGAAAGTCTGCAAACTCAAAAGTTTACCACCAAGTCAGATGTG；
The Chr1 of NRAS genes:115256507-115256586 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 17：
TTCGCCTGTCCTCATGTATTGGTCTCTCATGGCACTGTACTCTTCTTGTCCAGCTGTATCCAGTATGTCCAACAAAC
AGGTTTCACCATCTATAACCACTTGTTTTCTGTAAGAATCCTGGGGGTG；
The Chr1 of NRAS genes:115258651-115258755 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 18：
TGAGAGACAGGATCAGGTCAGCGGGCTACCACTGGGCCTCACCTCTATGGTGGGATCATATTCATCTACAAAGTGGT
TCTGGATTAGCTGGATTGTCAGTGCGCTTTTCCCAACACCACCTGCTCCAACCACCACCAGTTTGTACTCA G；
The Chr3 of PIK3CA genes:178936056-178936179 (Hg19) amplicon, its sequence such as SEQ ID:19 institutes
Show：GGAAAATGACAAAGAACAGCTCAAAGCAATTTCTACACGAGATCCTCTCTCTGAAATCACTGAGCAGGAGAAAG
ATTTTCTATGGAGTCACAGGTAAGTGCTAAAATGGAGATTCTCTGTTTCTTTTTCTTTATTACAGAAAAAATAACTG
AATTTGGCTGATCTCAGCATGTT；
The Chr3 of PIK3CA genes:178952000-178952092 (Hg19) amplicon, its sequence such as SEQ ID:20 institutes
Show：ATGCCAGAACTACAATCTTTTGATGACATTGCATACATTCGAAAGACCCTAGCCTTAGATAAAACTGAGCAAGA
GGCTTTGGAGTATTTCATGAAACAAATGAATGATGCACATCATGGTGGCTGGACAACAAAAATGGATTG；
The Chr17 of TP53 genes:7577027-7577154 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 21：
CTTCTTGTCCTGCTTGCTTACCTCGCTTAGTGCTCCCTGGGGGCAGCTCGTGGTGAGGCTCCCCTTTCTTGCGGAGA
TTCTCTTCCTCTGTGCGCCGGTCTCTCCCAGGACAGGCACAAACACGCACCTCAAAGCTGTTCCGTCCCAGTAGATT
ACCACTACTCAGGATAGGAAAAGAG；
The Chr17 of TP53 genes:7577507-7577613 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 22：
GCAAGTGGCTCCTGACCTGGAGTCTTCCAGTGTGATGATGGTGAGGATGGGCCTCCGGTTCATGCCGCCCATGCAGG
AACTGTTACACATGTAGTTGTAGTGGATGGTGGTACAGTCAGAGCCAACCTAGGAGATAACACAGGCCCAAGA；
The Chr17 of TP53 genes:7578182-7578298 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 23：
CCCCAGTTGCAAACCAGACCTCAGGCGGCTCATAGGGCACCACCACACTATGTCGAAAAGTGTTTCTGTCATCCAAA
TACTCCACACGCAAATTTCCTTCCACTCGGATAAGATGCTGAGGAGGGGCCAGACCTAAGAGCAATCAGTGAGGAAT
CAGAGG；
The Chr17 of TP53 genes:7578389-7578537 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 24：
ACCATCGCTATCTGAGCAGCGCTCATGGTGGGGGCAGCGCCTCACAACCTCCGTCATGTGCTGTGACTGCTTGTAGA
TGGCCATGGCGCGGACGCGGGTGCCGGGCGGGGGTGTGGAATCAACCCACAGCTGCACAGGGCAGGTCTTGGCCAGT
TGGCAAAACATCTTGTTGAGGGCAGGGGAGTACTG。
It is above-mentioned for constructed dna sample amplification sublibrary fusion primer combination in another embodiment, according to
The Chr2 of ALK gene:The specific forward primer sequence such as SEQ ID of 29432588-29432707 (Hg19) amplicon design:
Shown in 25：ACTGCCTCTTGACCTGTCC；According to the Chr2 of ALK gene:29432588-29432707 (Hg19) amplicon sets
The specific Down Stream primer sequence of meter such as SEQ ID:Shown in 26：TAAGGGACAAGCAGCCACAC.
It is above-mentioned for constructed dna sample amplification sublibrary fusion primer combination in another embodiment, according to
The Chr2 of ALK gene:The specific forward primer sequence such as SEQ ID of 29443616-29443730 (Hg19) amplicon design:
Shown in 27：CCAGACTCAGCTCAGTTAATTTTGG；According to the Chr2 of ALK gene:29443616-29443730 (Hg19) expands
Increase the specific Down Stream primer sequence such as SEQ ID of son design:Shown in 28：CGGAGGAAGGACTTGAGGT.
It is above-mentioned for constructed dna sample amplification sublibrary fusion primer combination in another embodiment, according to
The Chr7 of BRAF gene:The specific forward primer sequence such as SEQ of 140453091-140453197 (Hg19) amplicon design
ID:Shown in 29：CTACTGTTTTCCTTTACTTACTACACCTC；According to the Chr7 of BRAF gene:140453091-
The specific Down Stream primer sequence such as SEQ ID of 140453197 (Hg19) amplicons design:Shown in 30：
CCTCAATTCTTACCATCCACAAAATGG。
It is above-mentioned for constructed dna sample amplification sublibrary fusion primer combination in another embodiment, according to
The Chr7 of EGFR gene:The specific forward primer sequence such as SEQ ID of 55241604-55241726 (Hg19) amplicon design:
Shown in 31：TGACCCTTGTCTCTGTGTTCTTG；According to the Chr7 of EGFR gene:55241604-55241726 (Hg19) is expanded
The specific Down Stream primer sequence such as SEQ ID of son design:Shown in 32：CCAGGGACCTTACCTTATACACC.
It is above-mentioned for constructed dna sample amplification sublibrary fusion primer combination in another embodiment, according to
The Chr7 of EGFR gene:The specific forward primer sequence such as SEQ ID of 55242398-55242513 (Hg19) amplicon design:
Shown in 33：ACAATTGCCAGTTAACGTCTTCC；According to the Chr7 of EGFR gene:55242398-55242513 (Hg19) is expanded
The specific Down Stream primer sequence such as SEQ ID of son design:Shown in 34：ACACAGCAAAGCAGAAACTCAC.
It is above-mentioned for constructed dna sample amplification sublibrary fusion primer combination in another embodiment, according to
The Chr7 of EGFR gene:The specific forward primer sequence such as SEQ ID of 55248970-55249096 (Hg19) amplicon design:
Shown in 35：GAAGCCACACTGACGTGC；According to the Chr7 of EGFR gene:55248970-55249096 (Hg19) amplicon sets
The specific Down Stream primer sequence of meter such as SEQ ID:Shown in 36：GTGTTCCCGGACATAGTCCAG.
It is above-mentioned for constructed dna sample amplification sublibrary fusion primer combination in another embodiment, according to
The Chr7 of EGFR gene:The specific forward primer sequence such as SEQ ID of 55259505-55259621 (Hg19) amplicon design:
Shown in 37：CCGCAGCATGTCAAGATCACA；According to the Chr7 of EGFR gene:55259505-55259621 (Hg19) amplicon
The specific Down Stream primer sequence of design such as SEQ ID:Shown in 38：TAAACAATACAGCTAGTGGGAAGGC.
It is above-mentioned for constructed dna sample amplification sublibrary fusion primer combination in another embodiment, according to
The Chr17 of ERBB2 genes:The specific forward primer sequence such as SEQ of 37880969-37881082 (Hg19) amplicon design
ID:Shown in 39：CATACCCTCTCAGCGTACCC；According to the Chr17 of ERBB2 genes:37880969-37881082 (Hg19) expands
Increase the specific Down Stream primer sequence such as SEQ ID of son design:Shown in 40：CGGACATGGTCTAAGAGGCAG.
It is above-mentioned for constructed dna sample amplification sublibrary fusion primer combination in another embodiment, according to
The Chr12 of KRAS genes:The specific forward primer sequence such as SEQ of 25380261-25380363 (Hg19) amplicon design
ID:Shown in 41：TGCACTGTAATAATCCAGACTGTGT；According to the Chr12 of KRAS genes:25380261-25380363
(Hg19) the specific Down Stream primer sequence such as SEQ ID of amplicon design:Shown in 42：AGTCCTCATGTACTGGTCCCTC.
It is above-mentioned for constructed dna sample amplification sublibrary fusion primer combination in another embodiment, according to
The Chr12 of KRAS genes:The specific forward primer sequence such as SEQ of 25398183-25398310 (Hg19) amplicon design
ID:Shown in 43：AAGGCCTGCTGAAAATGACTGA；According to the Chr12 of KRAS genes:25398183-25398310(Hg19)
The specific Down Stream primer sequence such as SEQ ID of amplicon design:Shown in 44：AAAGAATGGTCCTGCACCAGTA.
It is above-mentioned for constructed dna sample amplification sublibrary fusion primer combination in another embodiment, according to
The Chr7 of MET genes:The specific forward primer sequence such as SEQ of 116340233-116340335 (Hg19) amplicon design
ID:Shown in 45：TCGATCTGCCATGTGTGCATT；According to the Chr7 of MET genes:116340233-116340335 (Hg19) expands
Increase the specific Down Stream primer sequence such as SEQ ID of son design:Shown in 46：GGGAACTGATGTGACTTACCCT.
The fusion primer of the above-mentioned amplification sublibrary for constructed dna sample is combined in another embodiment, according to MET
The Chr7 of gene:The specific forward primer sequence such as SEQ ID of 116411880-116412005 (Hg19) amplicon design:47
It is shown：CCATGATAGCCGTCTTTAACAAGC；According to the Chr7 of MET genes:116411880-116412005 (Hg19) is expanded
The specific Down Stream primer sequence such as SEQ ID of son design:Shown in 48：AGCTCGGTAGTCTACAGATTCATTT.
It is above-mentioned for constructed dna sample amplification sublibrary fusion primer combination in another embodiment, according to
The Chr7 of MET genes:The specific forward primer sequence such as SEQ of 116417426-116417546 (Hg19) amplicon design
ID:Shown in 49：ATGTTACGCAGTGCTAACCAAG；According to the Chr7 of MET genes:116417426-116417546(Hg19)
The specific Down Stream primer sequence such as SEQ ID of amplicon design:Shown in 50：GTTGCAAACCACAAAAGTATACTCCA.
It is above-mentioned for constructed dna sample amplification sublibrary fusion primer combination in another embodiment, according to
The Chr7 of MET genes:The specific forward primer sequence such as SEQ of 116423399-116423499 (Hg19) amplicon design
ID:Shown in 51：CAGTCAAGGTTGCTGATTTTGGTC；According to the Chr7 of MET genes:116423399-116423499
(Hg19) the specific Down Stream primer sequence such as SEQ ID of amplicon design:Shown in 52：CACATCTGACTTGGTGGTAAACTT.
It is above-mentioned for constructed dna sample amplification sublibrary fusion primer combination in another embodiment, according to
The Chr1 of NRAS genes:The specific forward primer sequence such as SEQ of 115256507-115256586 (Hg19) amplicon design
ID:Shown in 53：CACCCCCAGGATTCTTACAGAAAA；According to the Chr1 of NRAS genes:115256507-115256586
(Hg19) the specific Down Stream primer sequence such as SEQ ID of amplicon design:Shown in 54：TTCGCCTGTCCTCATGTATTGG.
It is above-mentioned for constructed dna sample amplification sublibrary fusion primer combination in another embodiment, according to
The Chr1 of NRAS genes:The specific forward primer sequence such as SEQ of 115258651-115258755 (Hg19) amplicon design
ID:Shown in 55：CTGAGTACAAACTGGTGGTGGT；According to the Chr1 of NRAS genes:115258651-115258755(Hg19)
The specific Down Stream primer sequence such as SEQ ID of amplicon design:Shown in 56：TGAGAGACAGGATCAGGTCAGC.
It is above-mentioned for constructed dna sample amplification sublibrary fusion primer combination in another embodiment, according to
The Chr3 of PIK3CA genes:The specific forward primer sequence such as SEQ of 178936056-178936179 (Hg19) amplicon design
ID:Shown in 57：GGAAAATGACAAAGAACAGCTCAAAG；According to the Chr3 of PIK3CA genes:178936056-178936179
(Hg19) the specific Down Stream primer sequence such as SEQ ID of amplicon design:Shown in 58：AACATGCTGAGATCAGCCAAATTC.
It is above-mentioned for constructed dna sample amplification sublibrary fusion primer combination in another embodiment, according to
The Chr3 of PIK3CA genes:The specific forward primer sequence such as SEQ ID of 178952000-178952092 (Hg19) amplicon design:
Shown in 59：ATGCCAGAACTACAATCTTTTGATGAC；According to the Chr3 of PIK3CA genes:178952000-178952092
(Hg19) the specific Down Stream primer sequence such as SEQ ID of amplicon design:Shown in 60：CAATCCATTTTTGTTGTCCAGCC.
It is above-mentioned for constructed dna sample amplification sublibrary fusion primer combination in another embodiment, according to
The Chr17 of TP53 genes:The specific forward primer sequence such as SEQ ID of 7577027-7577154 (Hg19) amplicon design:
Shown in 61：CTCTTTTCCTATCCTGAGTAGTGGTAATC；According to the Chr17 of TP53 genes:7577027-7577154
(Hg19) the specific Down Stream primer sequence such as SEQ ID of amplicon design:Shown in 62：CTTCTTGTCCTGCTTGCTTACC.
It is above-mentioned for constructed dna sample amplification sublibrary fusion primer combination in another embodiment, according to
The Chr17 of TP53 genes:The specific forward primer sequence such as SEQ ID of 7577507-7577613 (Hg19) amplicon design:
Shown in 63：TCTTGGGCCTGTGTTATCTCCTAG；According to the Chr17 of TP53 genes:7577507-7577613 (Hg19) is expanded
The specific Down Stream primer sequence such as SEQ ID of son design:Shown in 64：GCAAGTGGCTCCTGACCTG.
It is above-mentioned for constructed dna sample amplification sublibrary fusion primer combination in another embodiment, according to
The Chr17 of TP53 genes:The specific forward primer sequence such as SEQ ID of 7578182-7578298 (Hg19) amplicon design:
Shown in 65：CCTCTGATTCCTCACTGATTGCTC；According to the Chr17 of TP53 genes:7578182-7578298 (Hg19) is expanded
The specific Down Stream primer sequence such as SEQ ID of son design:Shown in 66：CCCCAGTTGCAAACCAGAC.
It is above-mentioned for constructed dna sample amplification sublibrary fusion primer combination in another embodiment, according to
The Chr17 of TP53 genes:The specific forward primer sequence such as SEQ ID of 7578389-7578537 (Hg19) amplicon design:
Shown in 67：CAGTACTCCCCTGCCCTCAA；According to the Chr17 of TP53 genes:7578389-7578537 (Hg19) amplicon sets
The specific Down Stream primer sequence of meter such as SEQ ID:Shown in 68：ACCATCGCTATCTGAGCAGC.
The fusion primer combination of the above-mentioned amplification sublibrary for constructed dna sample is in another embodiment, described
Target amplicon is following 22 kinds：
The Chr2 of ALK gene:29432588-29432707 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 3；
The Chr2 of ALK gene:29443616-29443730 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 4；
The Chr7 of BRAF gene:140453091-140453197 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 5；
The Chr7 of EGFR gene:55241604-55241726 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 6；
The Chr7 of EGFR gene:55242398-55242513 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 7；
The Chr7 of EGFR gene:55248970-55249096 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 8；
The Chr7 of EGFR gene:55259505-55259621 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 9；
The Chr17 of ERBB2 genes:37880969-37881082 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 10；
The Chr12 of KRAS genes:25380261-25380363 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 11；
The Chr12 of KRAS genes:25398183-25398310 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 12；
The Chr7 of MET genes:116340233-116340335 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 13；
The Chr7 of MET genes:116411880-116412005 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 14；
The Chr7 of MET genes:116417426-116417546 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 15；
The Chr7 of MET genes:116423399-116423499 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 16；
The Chr1 of NRAS genes:115256507-115256586 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 17；
The Chr1 of NRAS genes:115258651-115258755 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 18；
The Chr3 of PIK3CA genes:178936056-178936179 (Hg19) amplicon, its sequence such as SEQ ID:19 institutes
Show；
The Chr3 of PIK3CA genes:178952000-178952092 (Hg19) amplicon, its sequence such as SEQ ID:20 institutes
Show；
The Chr17 of TP53 genes:7577027-7577154 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 21；
The Chr17 of TP53 genes:7577507-7577613 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 22；
The Chr17 of TP53 genes:7578182-7578298 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 23；With
The Chr17 of TP53 genes:7578389-7578537 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 24.
It is above-mentioned for constructed dna sample amplification sublibrary fusion primer combination in another embodiment, according to
The Chr2 of ALK gene:29432588-29432707 (Hg19) amplicon design fused upstream primer, according to ALK gene
Chr2:Fused upstream primer, the Chr7 according to BRAF gene of 29443616-29443730 (Hg19) amplicon design:
Fused upstream primer, the Chr7 according to EGFR gene of 140453091-140453197 (Hg19) amplicon design:
Fused upstream primer, the Chr7 according to EGFR gene of 55241604-55241726 (Hg19) amplicon design:55242398-
Fused upstream primer, the Chr7 according to EGFR gene of 55242513 (Hg19) amplicons design:55248970-55249096
(Hg19) fused upstream primer, the Chr7 according to EGFR gene of amplicon design:55259505-55259621 (Hg19) is expanded
Fused upstream primer, the Chr17 according to ERBB2 genes of son design:The design of 37880969-37881082 (Hg19) amplicon
Fused upstream primer；The Chr12 of KRAS genes:The fused upstream primer of 25380261-25380363 (Hg19) amplicon design,
According to the Chr12 of KRAS genes:The fused upstream primer of 25398183-25398310 (Hg19) amplicon design；According to MET bases
The Chr7 of cause:Fused upstream primer, the Chr7 according to MET genes of 116340233-116340335 (Hg19) amplicon design:
Fused upstream primer, the Chr7 according to MET genes of 116411880-116412005 (Hg19) amplicon design:
Fused upstream primer, the Chr7 according to MET genes of 116417426-116417546 (Hg19) amplicon design:
Fused upstream primer, the Chr1 according to NRAS genes of 116423399-116423499 (Hg19) amplicon design:
Fused upstream primer, the Chr1 according to NRAS genes of 115256507-115256586 (Hg19) amplicon design:
Fused upstream primer, the Chr3 according to PIK3CA genes of 115258651-115258755 (Hg19) amplicon design:
Fused upstream primer, the Chr3 according to PIK3CA genes of 178936056-178936179 (Hg19) amplicon design:
Fused upstream primer, the Chr17 according to TP53 genes of 178952000-178952092 (Hg19) amplicon design:
Fused upstream primer, the Chr17 according to TP53 genes of 7577027-7577154 (Hg19) amplicon design:7577507-
Fused upstream primer, the Chr17 according to TP53 genes of 7577613 (Hg19) amplicons design:7578182-7578298
(Hg19) the fused upstream primer and the Chr17 according to TP53 genes of amplicon design:7578389-7578537 (Hg19) expands
The mol ratio for increasing the fused upstream primer of son design is 2:1:1:4:1:1:2:4:2:1:2:2:1:4:4:2:2:4:2:2:4:2.
The fusion primer combination of the above-mentioned amplification sublibrary for constructed dna sample is in another embodiment, described
PCR reaction systems when fusion primer combination carries out PCR include following components：
| PCR premixed liquids | 10μl； |
| DNA sample | The common 20ng of 1-8 μ l； |
| Primer combination for building the amplification sublibrary of same DNA sample | 2μl； |
| Complement to 20 μ l. |
The fusion primer combination of the above-mentioned amplification sublibrary for constructed dna sample is in another embodiment, described
PCR premixed liquids are KAPA HiFi PCR Kits.
Compared with prior art, the present invention has the advantages that：
1st, it is easy to operate, it is time-consuming.Present invention fusion primer combination is the design based on PGM platforms for quick structure
Amplification sublibrary is built, existing commercial kit is only related to expanding complex steps during sublibrary is prepared, the present invention
And one wheel PCR reaction and correspondence product purification steps, the operation that amplicon builds storehouse is greatly simplified, saving build the storehouse time, from text
Storehouse is building up to the whole flow process that machine terminates and bioinformatic analysis are completed and can be completed in 32 hours.
2nd, sample and library pollution are effectively prevented.The greatly simplifying of operating process makes us build storehouse process more safely may be used
Lean on, Barcode just introduced before PCR so that the possibility of cross pollution during subsequent operation between different samples is greatly reduced,
Other operating process and the reduction of step have effectively prevented to build the library pollution being likely to cause during storehouse.
3rd, the bioinformatic analysis flow for simplifying.Amplicon structure library obtained by the method is single, data reliability,
The DNA composition in gained library is simple and clear, and follow-up bioinformatic analysis more simplify.
Brief description of the drawings
Fig. 1 is to detect the amplified production distribution map for obtaining after the completion of amplicon library construction in the embodiment of the present invention 1.
Fig. 2 is 22 relevant parameters of amplicon in gained library in the embodiment of the present invention 1.
Specific embodiment
Below in conjunction with the accompanying drawings, specific embodiment of the invention is described in detail, it is to be understood that guarantor of the invention
Shield scope is not limited by specific embodiment.
Embodiment 1
Sample to be tested be 5 parts of FFPE samples (i.e.：Formalin fix FFPE sample, FFPE represents Formalin-
Fixed and Parrffin-Embedded), wherein 3 parts is the FFPE samples of Patients with Non-small-cell Lung, 2 parts is non-in addition
The FFPE samples of tumor patient.Amplicon is built to 5 parts of FFPE samples using one-step method using the fusion primer of specific designs
DNA library, detailed process is as follows：
1st, the extraction of genomic DNA：FFPE samples are extracted using Qiagen FFPE DNA Kit (centrifugation column type) kit
In genomic DNA, gained genomic DNA is dissolved in Tris-HCl buffer solutions with reference to kit operating instruction by specific steps,
Nano Drop detections DNA extracts quality, after detecting sample DNA concentration with Qubit3.0, by every part of genomic DNA Sample Dilution
It is 20ng/ μ l to concentration.
2nd, amplification sublibrary fusion primer sequence information used is built as follows：
The primer started with FB in Primer in below table represents fused upstream primer, is represented with the primer that R starts
Primer is merged in downstream, and its middle and lower reaches fusion primer sequence is several groups of sample universals.In fused upstream primer, nucleotide sequence
CCATCTCATCCCTGCGTGTCTCCGACTCAG represents the first joint sequence, and tri- nucleotides of GAT represent the second joint sequence,
Sequence between first joint sequence and the second joint sequence is barcode sequences, and the sequence after the second joint sequence is spy
Different in nature upstream primer sequence.In downstream fusion primer, CCTCTCTATGGGCAGTCGGTGAT sequences represent the 3rd joint sequence,
Remaining is specific Down Stream primer sequence.Synthesize each fusion primer according to following table.
3rd, PCR reaction systems are formed, specific PCR reaction systems are as follows：
| PCR reaction system components | Content |
| KAPA HiFi PCR Kits | 10μl |
| Genomic DNA (concentration 10ng/ μ l itself)) | 2μl |
| Fusion primer combination | 2μl |
| Supply surplus | |
| Amount to | 20μl |
Fusion primer combination is prepared by the following method, and each fusion primer synthesized in step 2 is dissolved in water to concentration
100 μM, the fused upstream primer with identical barcode sequence labels is mixed to get the combination of fused upstream primer, will carried
The downstream fusion primer of identical barcode sequence labels mixes according to the isometric mode of its corresponding fused upstream primer
Primer combination is merged to downstream, then isometric mixing, 5 are combined into the combination of fused upstream primer and downstream fusion primer
Barcode sequence labels correspond to 5 groups of different samples to be checked respectively.
4th, performing PCR program is entered, PCR instrument uses 2720Thermal Cycler, the PCR reactions of Applied bio-system
Program is as follows：
5th, after PCR reactions terminate, with the Agencourt AMPure XP Kit (article No.s of Beckman Coulter companies
A63880/A63881/A63882) purified.Operating procedure is as follows：
1) shift to an earlier date 30 minutes and take out Agencourt AMPure XP Kit, after being fully vortexed, be stored at room temperature.
2) PCR reaction terminate after, magnetic bead is fully vortexed again, in system add 20ul magnetic beads, repeatedly blow and beat 5 times with
Upper or abundant vortex, is stored at room temperature 5 minutes.
3) EP pipes are transferred to and are placed on magnetic frame, after standing is clarified for 5 minutes to solution, carefully removed with liquid-transfering gun
Clearly, it is careful not to touch magnetic bead.
4) often pipe adds 80% ethanol solution of the fresh configurations of 100ul, and EP pipes are placed on magnetic frame slow rotation 2 and enclose, quiet
Put 5m, supernatant discarded.
5) 4 steps are repeated once.
6) EP pipes are opened, is stored at room temperature, make to evaporate totally, be defined by magnetic bead surfaces tarnish, be careful not to
Divide and dry magnetic bead.
7) EP pipes are removed from magnetic frame, PCR grades of purified water of 30ul is added, is vortexed after mixing, be stored at room temperature 10 minutes.
8) the EP pipes of upper step are placed in magnetic frame upper 2 minute or up to after solution clarification, with liquid-transfering gun away from magnetite
Simultaneously careful Aspirate supernatant, is careful not to touch magnetic bead.
So far, amplicon library construction is completed, and Fig. 1 is Agilent 2200TapeStation after the completion of library construction
The amplified production distribution map that Systems detections are obtained, abscissa is fragment length, and ordinate is signal intensity (FU), lower peaks
For 25bp positions marker, upper peak is 1500bp positions marker, gained PCR primer collection after being expanded through PCR as shown in Figure 1
In in the range of 200-260bp, Fig. 1 explanation experimental result and experimental design be consistent, it can be determined that the size in constructed library
And library concentration.
6th, upper machine sequencing and interpretation of result
Above by the amplification sublibrary that fusion primer one-step method is obtained, using 318 chips of Ion PGM platforms, carry out
Amplicon is sequenced, and the data volume in each library is 250~500M bps.Gained sequencing result is as shown in Fig. 2 can be further right
Whether each amplicon of 22 amplicons has carried out amplification and the amplification homogeneity of each amplicon is analyzed.
The result of sequencing by obtained after data processing, bioinformatic analysis detect gene catastrophe.Data
Processing procedure includes the changing of sequencing data, Quality Control, sequence alignment (reference gene group be NCBI GRCh37/Hg19), is mutated position
The processes such as point analysis, the abrupt information by obtaining detecting sample after Data Management Analysis.
The actual pattern detection situation collected is as follows：In 5 parts of FFPE samples of person under inspection, 2 parts of normal person's samples are not detected
To tumour related mutation, in 3 parts of FFPE pattern detection results of tumor patient, Sample1 detects p.V157F mutation,
C.181C sample2 detects>A and p.Q61K is mutated, and sample3 detects p.L858R mutation.The result and sanger are detected
Result it is consistent.Practical application of the invention and good specificity are absolutely proved.
The foregoing description to specific illustrative embodiment of the invention be in order to illustrate and illustration purpose.These descriptions
It is not wishing to limit the invention to disclosed precise forms, and it will be apparent that according to above-mentioned teaching, can be much changed
And change.The purpose of selecting and describing the exemplary embodiment is that explaining that certain principles of the invention and its reality should
With so that those skilled in the art can realize and using a variety of exemplaries of the invention and
A variety of selections and change.The scope of the present invention is intended to be limited by claims and its equivalents.
SEQUENCE LISTING
<110>Beijing pangen Laboratory of medical test Co., Ltd
<120>A kind of fusion primer combination of rapid build amplification sublibrary
<130> P163149DD1F
<160> 68
<170> PatentIn version 3.5
<210> 1
<211> 30
<212> DNA
<213>Artificial sequence
<400> 1
ccatctcatc cctgcgtgtc tccgactcag 30
<210> 2
<211> 23
<212> DNA
<213>Artificial sequence
<400> 2
cctctctatg ggcagtcggt gat 23
<210> 3
<211> 159
<212> DNA
<213>The Chr2 of people's ALK gene:29432588-29432707 amplicons
<400> 3
taagggacaa gcagccacac cccattcttg aggggctgag gtggaagaga caggcccgga 60
ggggtgaggc agtctttact cacctgtaga tgtctcgggc catcccgaag tctccaatct 120
tggccactct tccagggcct ggacaggtca agaggcagt 159
<210> 4
<211> 159
<212> DNA
<213>The Chr2 of people's ALK gene:29443616-29443730 amplicons
<400> 4
cggaggaagg acttgaggtc tccccccgcc atgagctcca gcaggatgaa ccggggcagg 60
gattgcaggc tcaccccaat gcagcgaaca atgttctggt ggttgaattt gctgcagagc 120
agagagggat gtaaccaaaa ttaactgagc tgagtctgg 159
<210> 5
<211> 163
<212> DNA
<213>The Chr7 of people's BRAF gene:140453091-140453197 amplicons
<400> 5
cctcaattct taccatccac aaaatggatc cagacaactg ttcaaactga tgggacccac 60
tccatcgaga tttcactgta gctagaccaa aatcacctat ttttactgtg aggtcttcat 120
gaagaaatat atctgaggtg tagtaagtaa aggaaaacag tag 163
<210> 6
<211> 169
<212> DNA
<213>The Chr7 of Human epidermal growth factor receptor gene:55241604-55241726 amplicons
<400> 6
tgacccttgt ctctgtgttc ttgtcccccc cagcttgtgg agcctcttac acccagtgga 60
gaagctccca accaagctct cttgaggatc ttgaaggaaa ctgaattcaa aaagatcaaa 120
gtgctgggct ccggtgcgtt cggcacggtg tataaggtaa ggtccctgg 169
<210> 7
<211> 161
<212> DNA
<213>The Chr7 of Human epidermal growth factor receptor gene:55242398-55242513 amplicons
<400> 7
acaattgcca gttaacgtct tccttctctc tctgtcatag ggactctgga tcccagaagg 60
tgagaaagtt aaaattcccg tcgctatcaa ggaattaaga gaagcaacat ctccgaaagc 120
caacaaggaa atcctcgatg tgagtttctg ctttgctgtg t 161
<210> 8
<211> 166
<212> DNA
<213>The Chr7 of Human epidermal growth factor receptor gene:55248970-55249096 amplicons
<400> 8
gaagccacac tgacgtgcct ctccctccct ccaggaagcc tacgtgatgg ccagcgtgga 60
caacccccac gtgtgccgcc tgctgggcat ctgcctcacc tccaccgtgc agctcatcac 120
gcagctcatg cccttcggct gcctcctgga ctatgtccgg gaacac 166
<210> 9
<211> 163
<212> DNA
<213>The Chr7 of Human epidermal growth factor receptor gene:55259505-55259621 amplicons
<400> 9
ccgcagcatg tcaagatcac agattttggg ctggccaaac tgctgggtgc ggaagagaaa 60
gaataccatg cagaaggagg caaagtaagg aggtggcttt aggtcagcca gcattttcct 120
gacaccaggg accaggctgc cttcccacta gctgtattgt tta 163
<210> 10
<211> 155
<212> DNA
<213>The Chr17 of people's ERBB2 genes:37880969-37881082 amplicons
<400> 10
cataccctct cagcgtaccc ttgtccccag gaagcatacg tgatggctgg tgtgggctcc 60
ccatatgtct cccgccttct gggcatctgc ctgacatcca cggtgcagct ggtgacacag 120
cttatgccct atggctgcct cttagaccat gtccg 155
<210> 11
<211> 150
<212> DNA
<213>The Chr12 of people's KRAS genes:25380261-25380363 amplicons
<400> 11
agtcctcatg tactggtccc tcattgcact gtactcctct tgacctgctg tgtcgagaat 60
atccaagaga caggtttctc catcaattac tacttgcttc ctgtaggaat cctgagaagg 120
gagaaacaca gtctggatta ttacagtgca 150
<210> 12
<211> 172
<212> DNA
<213>The Chr12 of people's KRAS genes:25398183-25398310 amplicons
<400> 12
aaagaatggt cctgcaccag taatatgcat attaaaacaa gatttacctc tattgttgga 60
tcatattcgt ccacaaaatg attctgaatt agctgtatcg tcaaggcact cttgcctacg 120
ccaccagctc caactaccac aagtttatat tcagtcattt tcagcaggcc tt 172
<210> 13
<211> 146
<212> DNA
<213>The Chr7 of people's MET genes:116340233-116340335 amplicons
<400> 13
tcgatctgcc atgtgtgcat tccctatcaa atatgtcaac gacttcttca acaagatcgt 60
caacaaaaac aatgtgagat gtctccagca tttttacgga cccaatcatg agcactgctt 120
taatagggta agtcacatca gttccc 146
<210> 14
<211> 175
<212> DNA
<213>The Chr7 of people's MET genes:116411880-116412005 amplicons
<400> 14
ccatgatagc cgtctttaac aagctctttc tttctctctg ttttaagatc tgggcagtga 60
attagttcgc tacgatgcaa gagtacacac tcctcatttg gataggcttg taagtgcccg 120
aagtgtaagc ccaactacag aaatggtttc aaatgaatct gtagactacc gagct 175
<210> 15
<211> 169
<212> DNA
<213>The Chr7 of people's MET genes:116417426-116417546 amplicons
<400> 15
atgttacgca gtgctaacca agttctttct tttgcacagg gcattttggt tgtgtatatc 60
atgggacttt gttggacaat gatggcaaga aaattcactg tgctgtgaaa tccttgaaca 120
gtaagtggca ttttatttaa ccatggagta tacttttgtg gtttgcaac 169
<210> 16
<211> 149
<212> DNA
<213>The Chr7 of MET genes:116423399-116423499 amplicons
<400> 16
cagtcaaggt tgctgatttt ggtcttgcca gagacatgta tgataaagaa tactatagtg 60
tacacaacaa aacaggtgca aagctgccag tgaagtggat ggctttggaa agtctgcaaa 120
ctcaaaagtt taccaccaag tcagatgtg 149
<210> 17
<211> 126
<212> DNA
<213>The Chr1 of people's NRAS genes:115256507-115256586 amplicons
<400> 17
ttcgcctgtc ctcatgtatt ggtctctcat ggcactgtac tcttcttgtc cagctgtatc 60
cagtatgtcc aacaaacagg tttcaccatc tataaccact tgttttctgt aagaatcctg 120
ggggtg 126
<210> 18
<211> 149
<212> DNA
<213>The Chr1 of people's NRAS genes:115258651-115258755 amplicons
<400> 18
tgagagacag gatcaggtca gcgggctacc actgggcctc acctctatgg tgggatcata 60
ttcatctaca aagtggttct ggattagctg gattgtcagt gcgcttttcc caacaccacc 120
tgctccaacc accaccagtt tgtactcag 149
<210> 19
<211> 174
<212> DNA
<213>The Chr3 of people's PIK3CA genes:178936056-178936179 amplicons
<400> 19
ggaaaatgac aaagaacagc tcaaagcaat ttctacacga gatcctctct ctgaaatcac 60
tgagcaggag aaagattttc tatggagtca caggtaagtg ctaaaatgga gattctctgt 120
ttctttttct ttattacaga aaaaataact gaatttggct gatctcagca tgtt 174
<210> 20
<211> 143
<212> DNA
<213>The Chr3 of people's PIK3CA genes:178952000-178952092 amplicons
<400> 20
atgccagaac tacaatcttt tgatgacatt gcatacattc gaaagaccct agccttagat 60
aaaactgagc aagaggcttt ggagtatttc atgaaacaaa tgaatgatgc acatcatggt 120
ggctggacaa caaaaatgga ttg 143
<210> 21
<211> 179
<212> DNA
<213>The Chr17 of people's TP53 genes:7577027-7577154 amplicons
<400> 21
cttcttgtcc tgcttgctta cctcgcttag tgctccctgg gggcagctcg tggtgaggct 60
cccctttctt gcggagattc tcttcctctg tgcgccggtc tctcccagga caggcacaaa 120
cacgcacctc aaagctgttc cgtcccagta gattaccact actcaggata ggaaaagag 179
<210> 22
<211> 150
<212> DNA
<213>The Chr17 of people's TP53 genes:7577507-7577613 amplicons
<400> 22
gcaagtggct cctgacctgg agtcttccag tgtgatgatg gtgaggatgg gcctccggtt 60
catgccgccc atgcaggaac tgttacacat gtagttgtag tggatggtgg tacagtcaga 120
gccaacctag gagataacac aggcccaaga 150
<210> 23
<211> 160
<212> DNA
<213>The Chr17 of people's TP53 genes:7578182-7578298 amplicons
<400> 23
ccccagttgc aaaccagacc tcaggcggct catagggcac caccacacta tgtcgaaaag 60
tgtttctgtc atccaaatac tccacacgca aatttccttc cactcggata agatgctgag 120
gaggggccag acctaagagc aatcagtgag gaatcagagg 160
<210> 24
<211> 189
<212> DNA
<213>The Chr17 of people's TP53 genes:7578389-7578537 amplicons
<400> 24
accatcgcta tctgagcagc gctcatggtg ggggcagcgc ctcacaacct ccgtcatgtg 60
ctgtgactgc ttgtagatgg ccatggcgcg gacgcgggtg ccgggcgggg gtgtggaatc 120
aacccacagc tgcacagggc aggtcttggc cagttggcaa aacatcttgt tgagggcagg 180
ggagtactg 189
<210> 25
<211> 19
<212> DNA
<213>Artificial sequence
<400> 25
actgcctctt gacctgtcc 19
<210> 26
<211> 20
<212> DNA
<213>Artificial sequence
<400> 26
taagggacaa gcagccacac 20
<210> 27
<211> 25
<212> DNA
<213>Artificial sequence
<400> 27
ccagactcag ctcagttaat tttgg 25
<210> 28
<211> 19
<212> DNA
<213>Artificial sequence
<400> 28
cggaggaagg acttgaggt 19
<210> 29
<211> 29
<212> DNA
<213>Artificial sequence
<400> 29
ctactgtttt cctttactta ctacacctc 29
<210> 30
<211> 27
<212> DNA
<213>Artificial sequence
<400> 30
cctcaattct taccatccac aaaatgg 27
<210> 31
<211> 23
<212> DNA
<213>Artificial sequence
<400> 31
tgacccttgt ctctgtgttc ttg 23
<210> 32
<211> 23
<212> DNA
<213>Artificial sequence
<400> 32
ccagggacct taccttatac acc 23
<210> 33
<211> 23
<212> DNA
<213>Artificial sequence
<400> 33
acaattgcca gttaacgtct tcc 23
<210> 34
<211> 22
<212> DNA
<213>Artificial sequence
<400> 34
acacagcaaa gcagaaactc ac 22
<210> 35
<211> 18
<212> DNA
<213>Artificial sequence
<400> 35
gaagccacac tgacgtgc 18
<210> 36
<211> 21
<212> DNA
<213>Artificial sequence
<400> 36
gtgttcccgg acatagtcca g 21
<210> 37
<211> 21
<212> DNA
<213>Artificial sequence
<400> 37
ccgcagcatg tcaagatcac a 21
<210> 38
<211> 25
<212> DNA
<213>Artificial sequence
<400> 38
taaacaatac agctagtggg aaggc 25
<210> 39
<211> 20
<212> DNA
<213>Artificial sequence
<400> 39
cataccctct cagcgtaccc 20
<210> 40
<211> 21
<212> DNA
<213>Artificial sequence
<400> 40
cggacatggt ctaagaggca g 21
<210> 41
<211> 25
<212> DNA
<213>Artificial sequence
<400> 41
tgcactgtaa taatccagac tgtgt 25
<210> 42
<211> 22
<212> DNA
<213>Artificial sequence
<400> 42
agtcctcatg tactggtccc tc 22
<210> 43
<211> 22
<212> DNA
<213>Artificial sequence
<400> 43
aaggcctgct gaaaatgact ga 22
<210> 44
<211> 22
<212> DNA
<213>Artificial sequence
<400> 44
aaagaatggt cctgcaccag ta 22
<210> 45
<211> 21
<212> DNA
<213>Artificial sequence
<400> 45
tcgatctgcc atgtgtgcat t 21
<210> 46
<211> 22
<212> DNA
<213>Artificial sequence
<400> 46
gggaactgat gtgacttacc ct 22
<210> 47
<211> 24
<212> DNA
<213>Artificial sequence
<400> 47
ccatgatagc cgtctttaac aagc 24
<210> 48
<211> 25
<212> DNA
<213>Artificial sequence
<400> 48
agctcggtag tctacagatt cattt 25
<210> 49
<211> 22
<212> DNA
<213>Artificial sequence
<400> 49
atgttacgca gtgctaacca ag 22
<210> 50
<211> 26
<212> DNA
<213>Artificial sequence
<400> 50
gttgcaaacc acaaaagtat actcca 26
<210> 51
<211> 24
<212> DNA
<213>Artificial sequence
<400> 51
cagtcaaggt tgctgatttt ggtc 24
<210> 52
<211> 24
<212> DNA
<213>Artificial sequence
<400> 52
cacatctgac ttggtggtaa actt 24
<210> 53
<211> 24
<212> DNA
<213>Artificial sequence
<400> 53
cacccccagg attcttacag aaaa 24
<210> 54
<211> 22
<212> DNA
<213>Artificial sequence
<400> 54
ttcgcctgtc ctcatgtatt gg 22
<210> 55
<211> 22
<212> DNA
<213>Artificial sequence
<400> 55
ctgagtacaa actggtggtg gt 22
<210> 56
<211> 22
<212> DNA
<213>Artificial sequence
<400> 56
tgagagacag gatcaggtca gc 22
<210> 57
<211> 26
<212> DNA
<213>Artificial sequence
<400> 57
ggaaaatgac aaagaacagc tcaaag 26
<210> 58
<211> 24
<212> DNA
<213>Artificial sequence
<400> 58
aacatgctga gatcagccaa attc 24
<210> 59
<211> 27
<212> DNA
<213>Artificial sequence
<400> 59
atgccagaac tacaatcttt tgatgac 27
<210> 60
<211> 23
<212> DNA
<213>Artificial sequence
<400> 60
caatccattt ttgttgtcca gcc 23
<210> 61
<211> 29
<212> DNA
<213>Artificial sequence
<400> 61
ctcttttcct atcctgagta gtggtaatc 29
<210> 62
<211> 22
<212> DNA
<213>Artificial sequence
<400> 62
cttcttgtcc tgcttgctta cc 22
<210> 63
<211> 24
<212> DNA
<213>Artificial sequence
<400> 63
tcttgggcct gtgttatctc ctag 24
<210> 64
<211> 19
<212> DNA
<213>Artificial sequence
<400> 64
gcaagtggct cctgacctg 19
<210> 65
<211> 24
<212> DNA
<213>Artificial sequence
<400> 65
cctctgattc ctcactgatt gctc 24
<210> 66
<211> 19
<212> DNA
<213>Artificial sequence
<400> 66
ccccagttgc aaaccagac 19
<210> 67
<211> 20
<212> DNA
<213>Artificial sequence
<400> 67
cagtactccc ctgccctcaa 20
<210> 68
<211> 20
<212> DNA
<213>Artificial sequence
<400> 68
accatcgcta tctgagcagc 20
Claims (10)
1. the fusion primer combination of a kind of amplification sublibrary for constructed dna sample, it is characterised in that including：According to target
Primer is merged in the fused upstream primer of amplicon design and the downstream designed according to target amplicon, wherein：
The fused upstream primer designed according to target amplicon includes that be arranged in order according to 5 ' to 3 ' direction first connects
Header sequence (A sequences), barcode sequences, the second joint sequence and the specific forward primer sequence designed according to target amplicon
Row；
The downstream fusion primer designed according to target amplicon includes that the be arranged in order according to 5 ' to 3 ' direction the 3rd connects
Header sequence (trP1 sequences) and the specific Down Stream primer sequence designed according to target amplicon.
2. the fusion primer combination of the amplification sublibrary for being used for constructed dna sample as claimed in claim 1, it is characterised in that：
First joint sequence includes SEQ ID:1 sequence；Optionally, second joint sequence includes nucleotide sequence GAT；Can
Choosing, the 3rd joint sequence includes SEQ ID:2 sequences；Optionally, the barcode sequences be it is corresponding with sample,
Barcode sequences between different samples are different, as long as can distinguish different samples just can be with.
3. the fusion primer combination of the amplification sublibrary for being used for constructed dna sample as claimed in claim 1, it is characterised in that：
As the quantity ＞ 1 of the target amplicon in same PCR reactions, the fused upstream primer designed according to target amplicon
According to each target amplicon design fused upstream primer combination, it is described according to target amplicon design downstream melt
The combination of primer is merged in the downstream of each target amplicon design according to conjunction primer.
4. the fusion primer combination of the amplification sublibrary for being used for constructed dna sample as claimed in claim 1, it is characterised in that：
Primer is merged in the fused upstream primer designed according to any one target amplicon and the downstream designed according to the target amplicon
Mol ratio be 1:1.
5. the fusion primer combination of the amplification sublibrary for being used for constructed dna sample as claimed in claim 1, it is characterised in that：
The DNA sample is genomic DNA；Optionally, extracting genome DNA self-organizing sample or formalin fix FFPE sample
This.
6. the fusion primer combination of the amplification sublibrary for being used for constructed dna sample as claimed in claim 1, it is characterised in that：
The target amplicon includes being selected from the group at least one of 22 kinds of target amplicons：
The Chr2 of ALK gene:29432588-29432707 (Hg19) amplicon, its sequence such as SEQ ID:3 institutes；
The Chr2 of ALK gene:29443616-29443730 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 4；
The Chr7 of BRAF gene:140453091-140453197 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 5；
The Chr7 of EGFR gene:55241604-55241726 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 6；
The Chr7 of EGFR gene:55242398-55242513 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 7；
The Chr7 of EGFR gene:55248970-55249096 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 8；
The Chr7 of EGFR gene:55259505-55259621 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 9；
The Chr17 of ERBB2 genes:37880969-37881082 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 10；
The Chr12 of KRAS genes:25380261-25380363 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 11；
The Chr12 of KRAS genes:25398183-25398310 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 12；
The Chr7 of MET genes:116340233-116340335 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 13；
The Chr7 of MET genes:116411880-116412005 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 14；
The Chr7 of MET genes:116417426-116417546 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 15；
The Chr7 of MET genes:116423399-116423499 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 16；
The Chr1 of NRAS genes:115256507-115256586 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 17；
The Chr1 of NRAS genes:115258651-115258755 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 18；
The Chr3 of PIK3CA genes:178936056-178936179 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 19；
The Chr3 of PIK3CA genes:178952000-178952092 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 20；
The Chr17 of TP53 genes:7577027-7577154 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 21；
The Chr17 of TP53 genes:7577507-7577613 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 22；
The Chr17 of TP53 genes:7578182-7578298 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 23；
The Chr17 of TP53 genes:7578389-7578537 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 24.
7. the fusion primer combination of the amplification sublibrary for being used for constructed dna sample as claimed in claim 6, it is characterised in that：
According to the Chr2 of ALK gene:The specific forward primer sequence of 29432588-29432707 (Hg19) amplicon design is such as
SEQ ID:Shown in 25：ACTGCCTCTTGACCTGTCC；According to the Chr2 of ALK gene:29432588-29432707 (Hg19) expands
Increase the specific Down Stream primer sequence such as SEQ ID of son design:Shown in 26：TAAGGGACAAGCAGCCACAC；
Optionally, according to the Chr2 of ALK gene:The specific upstream of 29443616-29443730 (Hg19) amplicon design draws
Thing sequence such as SEQ ID:Shown in 27：CCAGACTCAGCTCAGTTAATTTTGG；According to the Chr2 of ALK gene:29443616-
The specific Down Stream primer sequence such as SEQ ID of 29443730 (Hg19) amplicons design:Shown in 28：
CGGAGGAAGGACTTGAGGT；
Optionally, according to the Chr7 of BRAF gene:The specific upstream of 140453091-140453197 (Hg19) amplicon design
Primer sequence such as SEQ ID:Shown in 29：CTACTGTTTTCCTTTACTTACTACACCTC；According to the Chr7 of BRAF gene:
The specific Down Stream primer sequence such as SEQ ID of 140453091-140453197 (Hg19) amplicon design:Shown in 30：
CCTCAATTCTTACCATCCACAAAATGG；
Optionally, according to the Chr7 of EGFR gene:The specific upstream of 55241604-55241726 (Hg19) amplicon design draws
Thing sequence such as SEQ ID:Shown in 31：TGACCCTTGTCTCTGTGTTCTTG；According to the Chr7 of EGFR gene:55241604-
The specific Down Stream primer sequence such as SEQ ID of 55241726 (Hg19) amplicons design:Shown in 32：
CCAGGGACCTTACCTTATACACC；
Optionally, according to the Chr7 of EGFR gene:The specific upstream of 55242398-55242513 (Hg19) amplicon design draws
Thing sequence such as SEQ ID:Shown in 33：ACAATTGCCAGTTAACGTCTTCC；According to the Chr7 of EGFR gene:55242398-
The specific Down Stream primer sequence such as SEQ ID of 55242513 (Hg19) amplicons design:Shown in 34：
ACACAGCAAAGCAGAAACTCAC；
Optionally, according to the Chr7 of EGFR gene:The specific upstream of 55248970-55249096 (Hg19) amplicon design draws
Thing sequence such as SEQ ID:Shown in 35：GAAGCCACACTGACGTGC；According to the Chr7 of EGFR gene:55248970-55249096
(Hg19) the specific Down Stream primer sequence such as SEQ ID of amplicon design:Shown in 36：GTGTTCCCGGACATAGTCCAG；
Optionally, according to the Chr7 of EGFR gene:The specific upstream of 55259505-55259621 (Hg19) amplicon design draws
Thing sequence such as SEQ ID:Shown in 37：CCGCAGCATGTCAAGATCACA；According to the Chr7 of EGFR gene:55259505-
The specific Down Stream primer sequence such as SEQ ID of 55259621 (Hg19) amplicons design:Shown in 38：
TAAACAATACAGCTAGTGGGAAGGC；
Optionally, according to the Chr17 of ERBB2 genes:The specific upstream of 37880969-37881082 (Hg19) amplicon design
Primer sequence such as SEQ ID:Shown in 39：CATACCCTCTCAGCGTACCC；According to the Chr17 of ERBB2 genes:37880969-
The specific Down Stream primer sequence such as SEQ ID of 37881082 (Hg19) amplicons design:Shown in 40：
CGGACATGGTCTAAGAGGCAG；
Optionally, according to the Chr12 of KRAS genes:The specific upstream of 25380261-25380363 (Hg19) amplicon design
Primer sequence such as SEQ ID:Shown in 41：TGCACTGTAATAATCCAGACTGTGT；According to the Chr12 of KRAS genes:
The specific Down Stream primer sequence such as SEQ ID of 25380261-25380363 (Hg19) amplicon design:Shown in 42：
AGTCCTCATGTACTGGTCCCTC；
Optionally, according to the Chr12 of KRAS genes:The specific upstream of 25398183-25398310 (Hg19) amplicon design
Primer sequence such as SEQ ID:Shown in 43：AAGGCCTGCTGAAAATGACTGA；According to the Chr12 of KRAS genes:25398183-
The specific Down Stream primer sequence such as SEQ ID of 25398310 (Hg19) amplicons design:Shown in 44：
AAAGAATGGTCCTGCACCAGTA；
Optionally, according to the Chr7 of MET genes:The specific upstream of 116340233-116340335 (Hg19) amplicon design
Primer sequence such as SEQ ID:Shown in 45：TCGATCTGCCATGTGTGCATT；According to the Chr7 of MET genes:116340233-
The specific Down Stream primer sequence such as SEQ ID of 116340335 (Hg19) amplicons design:Shown in 46：
GGGAACTGATGTGACTTACCCT；
Optionally, according to the Chr7 of MET genes:The specific upstream of 116411880-116412005 (Hg19) amplicon design
Primer sequence such as SEQ ID:Shown in 47：CCATGATAGCCGTCTTTAACAAGC；According to the Chr7 of MET genes:116411880-
The specific Down Stream primer sequence such as SEQ ID of 116412005 (Hg19) amplicons design:Shown in 48：
AGCTCGGTAGTCTACAGATTCATTT；
Optionally, according to the Chr7 of MET genes:The specific upstream of 116417426-116417546 (Hg19) amplicon design
Primer sequence such as SEQ ID:Shown in 49：ATGTTACGCAGTGCTAACCAAG；According to the Chr7 of MET genes:116417426-
The specific Down Stream primer sequence such as SEQ ID of 116417546 (Hg19) amplicons design:Shown in 50：
GTTGCAAACCACAAAAGTATACTCCA；
Optionally, according to the Chr7 of MET genes:The specific upstream of 116423399-116423499 (Hg19) amplicon design
Primer sequence such as SEQ ID:Shown in 51：CAGTCAAGGTTGCTGATTTTGGTC；According to the Chr7 of MET genes:116423399-
The specific Down Stream primer sequence such as SEQ ID of 116423499 (Hg19) amplicons design:Shown in 52：
CACATCTGACTTGGTGGTAAACTT；
Optionally, according to the Chr1 of NRAS genes:The specific upstream of 115256507-115256586 (Hg19) amplicon design
Primer sequence such as SEQ ID:Shown in 53：CACCCCCAGGATTCTTACAGAAAA；According to the Chr1 of NRAS genes:
The specific Down Stream primer sequence such as SEQ ID of 115256507-115256586 (Hg19) amplicon design:Shown in 54：
TTCGCCTGTCCTCATGTATTGG；
Optionally, according to the Chr1 of NRAS genes:The specific upstream of 115258651-115258755 (Hg19) amplicon design
Primer sequence such as SEQ ID:Shown in 55：CTGAGTACAAACTGGTGGTGGT；According to the Chr1 of NRAS genes:115258651-
The specific Down Stream primer sequence such as SEQ ID of 115258755 (Hg19) amplicons design:Shown in 56：
TGAGAGACAGGATCAGGTCAGC；
Optionally, according to the Chr3 of PIK3CA genes:In the specificity of 178936056-178936179 (Hg19) amplicon design
Trip primer sequence such as SEQ ID:Shown in 57：GGAAAATGACAAAGAACAGCTCAAAG；According to the Chr3 of PIK3CA genes:
The specific Down Stream primer sequence such as SEQ ID of 178936056-178936179 (Hg19) amplicon design:Shown in 58：
AACATGCTGAGATCAGCCAAATTC；
Optionally, according to the Chr3 of PIK3CA genes:In the specificity of 178952000-178952092 (Hg19) amplicon design
Trip primer sequence such as SEQ ID:Shown in 59：ATGCCAGAACTACAATCTTTTGATGAC；According to the Chr3 of PIK3CA genes:
The specific Down Stream primer sequence such as SEQ ID of 178952000-178952092 (Hg19) amplicon design:Shown in 60：
CAATCCATTTTTGTTGTCCAGCC；
Optionally, according to the Chr17 of TP53 genes:The specific upstream of 7577027-7577154 (Hg19) amplicon design draws
Thing sequence such as SEQ ID:Shown in 61：CTCTTTTCCTATCCTGAGTAGTGGTAATC；According to the Chr17 of TP53 genes:
The specific Down Stream primer sequence such as SEQ ID of 7577027-7577154 (Hg19) amplicon design:Shown in 62：
CTTCTTGTCCTGCTTGCTTACC；
Optionally, according to the Chr17 of TP53 genes:The specific upstream of 7577507-7577613 (Hg19) amplicon design draws
Thing sequence such as SEQ ID:Shown in 63：TCTTGGGCCTGTGTTATCTCCTAG；According to the Chr17 of TP53 genes:7577507-
The specific Down Stream primer sequence such as SEQ ID of 7577613 (Hg19) amplicons design:Shown in 64：
GCAAGTGGCTCCTGACCTG；
Optionally, according to the Chr17 of TP53 genes:The specific upstream of 7578182-7578298 (Hg19) amplicon design draws
Thing sequence such as SEQ ID:Shown in 65：CCTCTGATTCCTCACTGATTGCTC；According to the Chr17 of TP53 genes:7578182-
The specific Down Stream primer sequence such as SEQ ID of 7578298 (Hg19) amplicons design:Shown in 66：
CCCCAGTTGCAAACCAGAC；
Optionally, according to the Chr17 of TP53 genes:The specific upstream of 7578389-7578537 (Hg19) amplicon design draws
Thing sequence such as SEQ ID:Shown in 67：CAGTACTCCCCTGCCCTCAA；According to the Chr17 of TP53 genes:7578389-
The specific Down Stream primer sequence such as SEQ ID of 7578537 (Hg19) amplicons design:Shown in 68：
ACCATCGCTATCTGAGCAGC。
8. the fusion primer combination of the amplification sublibrary for being used for constructed dna sample as claimed in claim 6, it is characterised in that：
The target amplicon is following 22 kinds：
The Chr2 of ALK gene:29432588-29432707 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 3；
The Chr2 of ALK gene:29443616-29443730 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 4；
The Chr7 of BRAF gene:140453091-140453197 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 5；
The Chr7 of EGFR gene:55241604-55241726 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 6；
The Chr7 of EGFR gene:55242398-55242513 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 7；
The Chr7 of EGFR gene:55248970-55249096 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 8；
The Chr7 of EGFR gene:55259505-55259621 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 9；
The Chr17 of ERBB2 genes:37880969-37881082 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 10；
The Chr12 of KRAS genes:25380261-25380363 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 11；
The Chr12 of KRAS genes:25398183-25398310 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 12；
The Chr7 of MET genes:116340233-116340335 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 13；
The Chr7 of MET genes:116411880-116412005 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 14；
The Chr7 of MET genes:116417426-116417546 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 15；
The Chr7 of MET genes:116423399-116423499 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 16；
The Chr1 of NRAS genes:115256507-115256586 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 17；
The Chr1 of NRAS genes:115258651-115258755 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 18；
The Chr3 of PIK3CA genes:178936056-178936179 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 19；
The Chr3 of PIK3CA genes:178952000-178952092 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 20；
The Chr17 of TP53 genes:7577027-7577154 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 21；
The Chr17 of TP53 genes:7577507-7577613 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 22；
The Chr17 of TP53 genes:7578182-7578298 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 23；With
The Chr17 of TP53 genes:7578389-7578537 (Hg19) amplicon, its sequence such as SEQ ID:Shown in 24.
9. the fusion primer combination of the amplification sublibrary for being used for constructed dna sample as claimed in claim 8, it is characterised in that：
According to the Chr2 of ALK gene:29432588-29432707 (Hg19) amplicon design fused upstream primer, according to ALK
The Chr2 of gene:29443616-29443730 (Hg19) amplicon design fused upstream primer, according to BRAF gene
Chr7:Fused upstream primer, the Chr7 according to EGFR gene of 140453091-140453197 (Hg19) amplicon design:
Fused upstream primer, the Chr7 according to EGFR gene of 55241604-55241726 (Hg19) amplicon design:55242398-
Fused upstream primer, the Chr7 according to EGFR gene of 55242513 (Hg19) amplicons design:55248970-55249096
(Hg19) fused upstream primer, the Chr7 according to EGFR gene of amplicon design:55259505-55259621 (Hg19) is expanded
Fused upstream primer, the Chr17 according to ERBB2 genes of son design:The design of 37880969-37881082 (Hg19) amplicon
Fused upstream primer；The Chr12 of KRAS genes:The fused upstream primer of 25380261-25380363 (Hg19) amplicon design,
According to the Chr12 of KRAS genes:The fused upstream primer of 25398183-25398310 (Hg19) amplicon design；According to MET bases
The Chr7 of cause:Fused upstream primer, the Chr7 according to MET genes of 116340233-116340335 (Hg19) amplicon design:
Fused upstream primer, the Chr7 according to MET genes of 116411880-116412005 (Hg19) amplicon design:
Fused upstream primer, the Chr7 according to MET genes of 116417426-116417546 (Hg19) amplicon design:
Fused upstream primer, the Chr1 according to NRAS genes of 116423399-116423499 (Hg19) amplicon design:
Fused upstream primer, the Chr1 according to NRAS genes of 115256507-115256586 (Hg19) amplicon design:
Fused upstream primer, the Chr3 according to PIK3CA genes of 115258651-115258755 (Hg19) amplicon design:
Fused upstream primer, the Chr3 according to PIK3CA genes of 178936056-178936179 (Hg19) amplicon design:
Fused upstream primer, the Chr17 according to TP53 genes of 178952000-178952092 (Hg19) amplicon design:
Fused upstream primer, the Chr17 according to TP53 genes of 7577027-7577154 (Hg19) amplicon design:7577507-
Fused upstream primer, the Chr17 according to TP53 genes of 7577613 (Hg19) amplicons design:7578182-7578298
(Hg19) the fused upstream primer and the Chr17 according to TP53 genes of amplicon design:7578389-7578537 (Hg19) expands
The mol ratio for increasing the fused upstream primer of son design is 2:1:1:4:1:1:2:4:2:1:2:2:1:4:4:2:2:4:2:2:4:2.
10. a kind of fusion primer combination for building the amplification sublibrary of at least two DNA samples, it is characterised in that：It is described
PCR reaction systems when fusion primer combination carries out PCR include following components：
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710219007.6A CN106906210A (en) | 2017-04-05 | 2017-04-05 | A kind of fusion primer combination of rapid build amplification sublibrary |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710219007.6A CN106906210A (en) | 2017-04-05 | 2017-04-05 | A kind of fusion primer combination of rapid build amplification sublibrary |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106906210A true CN106906210A (en) | 2017-06-30 |
Family
ID=59193902
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710219007.6A Pending CN106906210A (en) | 2017-04-05 | 2017-04-05 | A kind of fusion primer combination of rapid build amplification sublibrary |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106906210A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107604067A (en) * | 2017-10-19 | 2018-01-19 | 北京泛生子基因科技有限公司 | A kind of primer and kit for the mutation of testing goal gene low frequency |
| CN107604045A (en) * | 2017-10-19 | 2018-01-19 | 北京泛生子基因科技有限公司 | A kind of construction method of amplification sublibrary for the mutation of testing goal gene low frequency |
| WO2018184495A1 (en) * | 2017-04-05 | 2018-10-11 | 北京泛生子基因科技有限公司 | Method for constructing amplicon library through one-step process |
| CN111304306A (en) * | 2020-03-06 | 2020-06-19 | 北京良芯生物科技发展有限公司 | Method and kit for constructing sequencing library by fusion primer |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103045726A (en) * | 2012-11-20 | 2013-04-17 | 南方科技大学 | Method and apparatus for gene sequencing of multiple mixed DNA or RNA sequences |
| US8481698B2 (en) * | 2009-03-19 | 2013-07-09 | The President And Fellows Of Harvard College | Parallel proximity ligation event analysis |
| CN104293783A (en) * | 2014-09-30 | 2015-01-21 | 天津诺禾致源生物信息科技有限公司 | Primer applicable to amplicon sequencing library construction, construction method, amplicon library and kit comprising amplicon library |
| CN104630375A (en) * | 2015-02-16 | 2015-05-20 | 北京圣谷同创科技发展有限公司 | Cancer gene mutation and gene amplification detection |
| CN105219766A (en) * | 2015-11-10 | 2016-01-06 | 东华大学 | A kind of multiple PCR method of three-wheel amplification |
| CN106048008A (en) * | 2016-06-03 | 2016-10-26 | 人和未来生物科技（长沙）有限公司 | EGFR gene ultralow frequency mutation detection kit |
| CN106350590A (en) * | 2016-09-06 | 2017-01-25 | 承启医学（深圳）科技有限公司 | DNA library construction method for high-throughput sequencing |
-
2017
- 2017-04-05 CN CN201710219007.6A patent/CN106906210A/en active Pending
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8481698B2 (en) * | 2009-03-19 | 2013-07-09 | The President And Fellows Of Harvard College | Parallel proximity ligation event analysis |
| CN103045726A (en) * | 2012-11-20 | 2013-04-17 | 南方科技大学 | Method and apparatus for gene sequencing of multiple mixed DNA or RNA sequences |
| CN104293783A (en) * | 2014-09-30 | 2015-01-21 | 天津诺禾致源生物信息科技有限公司 | Primer applicable to amplicon sequencing library construction, construction method, amplicon library and kit comprising amplicon library |
| CN104630375A (en) * | 2015-02-16 | 2015-05-20 | 北京圣谷同创科技发展有限公司 | Cancer gene mutation and gene amplification detection |
| CN105219766A (en) * | 2015-11-10 | 2016-01-06 | 东华大学 | A kind of multiple PCR method of three-wheel amplification |
| CN106048008A (en) * | 2016-06-03 | 2016-10-26 | 人和未来生物科技（长沙）有限公司 | EGFR gene ultralow frequency mutation detection kit |
| CN106350590A (en) * | 2016-09-06 | 2017-01-25 | 承启医学（深圳）科技有限公司 | DNA library construction method for high-throughput sequencing |
Non-Patent Citations (2)
| Title |
|---|
| SATU MÄKI-NEVALA等: "Hot spot mutations in Finnish non-small cell lung cancers", 《LUNG CANCER》 * |
| SYLVIE SANSCHAGRIN等: "Next-generation Sequencing of 16S Ribosomal RNA Gene Amplicons", 《JOURNAL OF VISUALIZED EXPERIMENTS》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018184495A1 (en) * | 2017-04-05 | 2018-10-11 | 北京泛生子基因科技有限公司 | Method for constructing amplicon library through one-step process |
| US11155862B2 (en) | 2017-04-05 | 2021-10-26 | Genetron Health (Beijing) Co., Ltd. | Method for rapidly constructing amplicon library through one-step process |
| CN107604067A (en) * | 2017-10-19 | 2018-01-19 | 北京泛生子基因科技有限公司 | A kind of primer and kit for the mutation of testing goal gene low frequency |
| CN107604045A (en) * | 2017-10-19 | 2018-01-19 | 北京泛生子基因科技有限公司 | A kind of construction method of amplification sublibrary for the mutation of testing goal gene low frequency |
| WO2019076018A1 (en) * | 2017-10-19 | 2019-04-25 | 北京泛生子基因科技有限公司 | Method for constructing amplicon library for detecting low-frequency mutation of target gene |
| CN111304306A (en) * | 2020-03-06 | 2020-06-19 | 北京良芯生物科技发展有限公司 | Method and kit for constructing sequencing library by fusion primer |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106835292B (en) | The method of one-step method rapid build amplification sublibrary | |
| CN104818320B (en) | Primer, probe, detection architecture and the kit of disposable detection lung cancer multiple gene | |
| CN105861710B (en) | Sequence measuring joints, its preparation method and its application in ultralow frequency variation detection | |
| CN107012139A (en) | A kind of method that rapid build expands sublibrary | |
| CN107955835B (en) | Primer pool and detection method for detecting BRCA1/2 gene mutation | |
| CN106834275A (en) | The analysis method of the construction method, kit and library detection data in ctDNA ultralow frequency abrupt climatic changes library | |
| CN104263848B (en) | A kind of deaf susceptibility gene mutation detection kit and preparation method thereof and application | |
| CN106906210A (en) | A kind of fusion primer combination of rapid build amplification sublibrary | |
| CN107904666A (en) | A kind of library construction and quantitative approach applied to tumour driving genetic test | |
| CN106834286A (en) | The primer combination of one-step method rapid build amplification sublibrary | |
| CN106498035A (en) | A kind of construction method and its application for detecting chemotherapeutics gene SNP variation library for high-flux sequence | |
| CN107604045A (en) | A kind of construction method of amplification sublibrary for the mutation of testing goal gene low frequency | |
| CN105861700A (en) | High throughput test method for neuromuscular disorders | |
| CN107513578A (en) | A kind of nucleic acid Mass Spectrometry detection method early sieved for lung cancer driving gene and tumor susceptibility gene | |
| CN106498036A (en) | A kind of construction method in the Drug Discovery SNP variations library for high-flux sequence detection and its application | |
| CN106701978A (en) | Human microsatellite instability (MSI) detection amplification primer composition and kit | |
| CN104789677A (en) | Circulating tumor DNA EGFR detecting technology and reagent kit thereof | |
| CN106497916A (en) | A kind of construction method in the NK cell polygenic variations library for high-flux sequence detection and its application | |
| CN108977534B (en) | A kind of targeting sequencing kit and its application method and targeting sequencing approach | |
| CN101899438B (en) | Multiplex PCR primer for amplifying human EGFR gene and design method thereof | |
| CN109680054A (en) | A kind of detection method of low frequency DNA mutation | |
| CN110819710A (en) | High-throughput sequencing detection of myeloid tumors | |
| CN112011622B (en) | Method and system for analyzing non-east Asia and European population sources of individuals with unknown sources | |
| CN108165629A (en) | A kind of DNA point mutation quantitative detecting method | |
| CN111020710A (en) | ctDNA high-throughput detection of hematopoietic and lymphoid tissue tumors |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170630 |