CN106755461A - The IL-21 associated with primary biliary cholangitis and its application - Google Patents
The IL-21 associated with primary biliary cholangitis and its application Download PDFInfo
- Publication number
- CN106755461A CN106755461A CN201710015507.8A CN201710015507A CN106755461A CN 106755461 A CN106755461 A CN 106755461A CN 201710015507 A CN201710015507 A CN 201710015507A CN 106755461 A CN106755461 A CN 106755461A
- Authority
- CN
- China
- Prior art keywords
- pbc
- cholangitis
- primary biliary
- allele
- detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The present invention discloses IL-21（IL21）Application in the product for preparing detection or auxiliary detection, examination or prediction primary biliary cholangitis (Primary Biliary Cholangitis, PBC).Mononucleotide polymorphic site invention additionally discloses the IL-21 significantly correlated with primary biliary cholangitis neurological susceptibility is：rs17005934、rs17005953、rs28517551、rs925550、rs60318098、rs1026157、rs6811183.Present invention firstly discovers that multiple gene polymorphism sites of IL21 are significantly correlated with the generation of PBC, can be used for one of index of PBC onset risks prediction.
Description
Technical field
The invention belongs to field of immunology, and in particular to the IL-21 associated with primary biliary cholangitis
(IL21) and its application.
Background technology
Primary biliary cholangitis (primary biliary cholangitis, PBC), is once called as primary biliary
Cirrhosis (primary biliary cirrhosis), is a kind of Chronic Progressive autoimmunity for involving stones in intrahepatic bile duct system
Property disease, be mainly shown as that the destruction of small bile duct progressive is sexually revised with Portal inflammation in liver, ultimately result in fibrosis and cirrhosis.
This disease takes place mostly in women above middle age, and male's case only accounts for 10%.With continuous improvement and diagnosis to PBC disease cognitives
The foundation of method, the incidence of disease and illness rate of PBC is in rising trend in the whole world.2003, in District of Shanghai to 5011 health
(26-85 Sui) PBC specificity AMA (AMA) (PDC-E2) of examinee carries out examination, it is found that AMA positive rates are higher than
0.16%, it is higher than 0.3% [5] in female middle-aged.2006, in In Guangdong Province to the general of 8126 adults's (18-83 Sui)
The positive rate of middle discovery AMA (PDC-E2) is looked into higher than 0.05%, is higher than 0.15% in female middle-aged.Recently in District of Shanghai pair
The male and 0.94% women AMA of 19012 AMA screening results discoveries 0.40% of resident are positive, wherein 25 people
(0.13%) with PBC.With the aggravation of China human mortality aging, PBC will develop into a kind of more typical disease rapidly in China
Disease, the patients of 20-30 ten thousand were likely to be breached in 2025, and the patients of 35-50 ten thousand may be up to the year two thousand fifty.
Early diagnosis and therapy is the most effective means for controlling the development of PBC diseases.Treatment to PBC at present lacks effective
Method, urso is unique medicine being control effectively to early stage PBC patient (patient that especially jaundice does not occur)
Thing, but without healing effect, and the only resource for saving late period PBC patient is to implement liver transplant.China is virus hepatitis high
The country of hair, the clinical symptoms of PBC are similar to virus hepatitis, and PBC patient is often misdiagnosed as virus hepatitis or medicine early stage
Property hepatitis, has had a strong impact on the diagnosis and treatment of PBC patient.Therefore, early diagnosis and therapy is carried out to PBC patient, with important society
Can meaning.
PBC has very strong genetic predisposition, and the PBC incidences of disease of the first generation relatives of patient are higher than population 100 times.
The report of comprehensive North America, Europe and Japan, the familial incidence of PBC is 3.8-9%.2005, one in the extensive of North America
Investigation result shows that the relative risk (odds ratio) of patient PBC lineal relative morbidity is up to 10.7.By PBC patient
Homozygotic twin be analyzed, find its co-morbid rate up to 63%.Our team were past in 4 years to domestic PBC patient's
Be found that 3 couples of PBC patients of enzygotic twins in investigation, sister's disease symptom and disease time of the three couples of patients all closely,
With reference to international data with existing, the homozygotic twin co-morbid rate of PBC patient is up to 72.7%.
Since two thousand nine, to the series of results display PBC tools of white man PBC patient whole-genome association (GWAS)
There is very strong genetic predisposition.GWAS and specific site high density are used with the North America PBC cooperations group for applying for artificial core member
The method of Polymorphism Analysis, carries out cohort analysis, it was confirmed that the inheritance susceptible of PBC to North America PBC patient and control crowd
Property and the close phase in the site such as HLA-II classes antigen, IL12A, IL12RB2, STAT4, IRF5, ch17q12-21, MMEL1 and SPIB
Closing, and disclose the exception of IL12 signal transduction pathway and Toll-like acceptors (TLR)/TNF signal transduction pathway to lead
Cause the generation of PBC.It is closely related with PBC that the small-scale GWAS researchs of Japanese scholars have also discovered TNFSF15 sites.China pair
The certain basis of the genetics research of PBC, domestic scholar loses with regard to the gene locis such as HLA and CTLA4 and Han nationality PBC respectively
Passing neurological susceptibility has carried out Primary Study.
We start and complete to 1122 Illumina China chip scanning work of Han nationality's PBC samples, with reference to
4046 contrasting datas, have carried out large-scale cohort analysis, find and confirm the gene loci of IL21 first in the world
GWAS conspicuousnesses are reached, and has found IL21 overexpressions in PBC blood samples of patients first, its expression degree and liver organization
Fibrosis are proportional.
Patent document there is no to refer to the relation of IL21 gene locis and IL21 and PBC in the world at present.
The content of the invention
Goal of the invention：First technical problem to be solved by this invention there is provided IL21 and prepare detection or auxiliary inspection
Application in the product of survey, examination or prediction primary biliary cholangitis.
Second technical problem to be solved by this invention there is provided a series of notable with primary biliary cholangitis
Related mononucleotide polymorphic site (SNP), and find out wherein associated with primary biliary cholangitis neurological susceptibility it is most significant
Representative site, so as to provide that described mononucleotide polymorphic site (SNP) is easy for assessing primary biliary cholangitis
The purposes of perception.
3rd technical problem to be solved by this invention there is provided applications of the IL21 in PBC animal models are prepared.
4th technical problem to be solved by this invention there is provided IL21 answering in terms of PBC medicines are prepared
With.
Technical scheme：In order to solve the above-mentioned technical problem, the technical solution adopted in the present invention is：First aspect, there is provided
Applications of the IL21 in the product for preparing detection or auxiliary detection, examination or prediction primary biliary cholangitis.We open
Move and complete to 1122 Illumina China chip scanning work of Han nationality's PBC samples, with reference to 4036 contrasting datas, enter
Go large-scale cohort analysis, found and confirmed that the gene loci of IL21 has reached GWAS conspicuousnesses first in the world,
And finding IL21 first, that degree is expressed in PBC patient's liver organization is proportional with liver organization fibrosis；Especially by
Whole-genome association, the gene pleiomorphism and PBC morbidities for finding IL21 has substantial connection.
Second aspect provides a series of monokaryon glycosides with the significantly correlated IL21 of primary biliary cholangitis neurological susceptibility
Sour polymorphic site, is research object by 1122 China Han PBC Patient Sample As and 4036 normal human samples, is used
HumanOmniZhongHua-8 (v1.1) scannings carry out full-length genome associated data analysis, carry out dividing for gene pleiomorphism (SNP)
Type, the data obtained using chip, the comparative analysis using PLINK softwares to all polymorphic sites finds many of IL21 genes
There were significant differences in PBC and normal population for the frequency of individual SNP.It is significantly correlated with primary biliary cholangitis neurological susceptibility
The mononucleotide polymorphic site of IL21 is：Rs17005934, allele is C/T；Rs17005953, allele is T/C；
Rs28517551, allele is A/G；Rs925550, allele is A/C；Rs60318098, allele is G/A；
Rs1026157, allele is G/T；Rs6811183, allele is T/G.
The third aspect, the present invention carries out linkage disequilibrium value by the SNP to IL21 sites, find multiple SNP and
The linkage relationship of rs925550, rs17005934.Using the iPlex methods of Sequenom, for wherein rs925550,
Rs17005934 pleomorphism sites carry out checking test；And Impute2 and PLINK softwares are used, logistic regression principle is carried out, with
Sex is covariate, by synergistic effect model analysis；It is again seen that there were significant differences；All SNP in table 1 be in PBC and
There is the gene polymorphic site of marked difference between control, can be used for the risk profile to PBC.
Fourth aspect, by the present invention in that using PLINK softwares, logistic regression principle is analyzed assesses each SNP site
With the relation of primary biliary cholangitis, the relative risk (Odd ratio, OR) and 95% of dangerous allele is calculated
Credibility interval, obtains a series of dangerous allele of this SNP site.The dangerous allele of the SNP site of IL21 is respectively：
Rs17005934 pleomorphism sites are C；S17005953, pleomorphism site is T；Rs28517551 pleomorphism sites are A；
Rs925550 pleomorphism sites are A；Rs60318098 pleomorphism sites are G；Rs1026157, pleomorphism site is G；
Rs6811183 pleomorphism sites are T.
5th aspect, the present invention by IL21 special tissue chemical analysis to 30 PBC patients, 30 autoimmunities
Hepatitis (AIH), 25 chronic hepatitis B patients (CHB), and the liver tissue slices of 6 normal healthy controls (HC) are carried out
The expression of IL21 albumen is measured, it is found that IL21 significantly raises (P in PBC patient's liver organization<0.01), the expression of IL21
Level is proportionate with the degree of inflammation and fibrosis of PBC patient's liver organization.
6th aspect, introduces IL21 expression and prepares PBC animal models in the animal model that the present invention sets up, and by this model
For the screening of PBC medicines.
Beneficial effect：The present invention has following characteristic and advantage：
1) present invention firstly discovers that multiple gene polymorphism sites of IL21 are significantly correlated with the generation of PBC, can be used for PBC
One of index of onset risk prediction.
2) it is the target that can be used for PBC targeted therapies present invention discover that IL21 is significantly raised in PBC patient's liver organization
Point.
3) discovery of invention prepares PBC animal models possibly through chronic IL21 expression is introduced in animal model, and
This model is used for the screening of PBC medicines.
Brief description of the drawings
Fig. 1 is the associated diagram of identified IL21 gene regions mononucleotide polymorphism site and PBC in embodiment 1；Fig. 1
In：Abscissa " Position on chr " is the position (unit Mb) on chromosome；Ordinate is mononucleotide polymorphism site
Conspicuousness P values (- log10 (p-value)) are associated with PBC, right side Recombination rate are recombination fraction, unit (CM/
Mb)；Represent site rs925550 with ◆ represent.
Fig. 2 be in embodiment 3 tissue chemical analysis IL21 in 30 PBC patients, 30 autoimmune hepatitis (AIH) are suffered from
Person, the expression in 25 chronic hepatitis B (CHB) patients, and 6 liver tissue slices of normal healthy controls (HC).Fig. 2A is real
Apply in example 3 in 1 expression of the IL21 of PBC patient tissue liver tissue slices.Fig. 2 B be embodiment 3 in 1 AIH patient's group
Knit the expression of the IL21 of liver tissue slices.Fig. 2 C be embodiment 3 in 1 IL21 of CHB patient tissue liver tissue slices
Expression.Fig. 2 D are that the expression of the IL21 of liver tissue slices is organized in 1 HC in embodiment 3.Fig. 2 E are IL21 in embodiment 3
In 30 PBC patients, 30 AIH patients, 25 chronic hepatitis B (CHB) patients, and 6 liver groups of normal healthy controls (HC)
Knit section in expression statistic analysis result (* * be P<0.01, * is P<0.05).Fig. 2 F be embodiment 3 in IL21 at 30
The analysis result expressed with the liver organization degree of inflammation correlation of PBC patient in the liver tissue slices of PBC patient.Fig. 2 G
It is the liver organization fibrosis journey of expression and PBC patient of the IL21 in 30 liver tissue slices of PBC patient in embodiment 3
Spend the analysis result of correlation.
Specific embodiment
Below by specific embodiment and accompanying drawing, the present invention is further described.
Experiment material used, main agents and formula are as follows in the embodiment of the present invention：
Major experimental material and main agents：
1st, the DNA sample and serum of primary biliary cholangitis patient and normal control population；
2nd, whole-genome association chip analysis kit：Produced by Illumina companies
HumanOmniZhongHua-8 (v1.1) assay kit includes chip and reagent.
Main solution is prepared：
1st, phosphate buffer (PBS, 1L)：8g NaCl, 0.2g KCl, 0.24g KH2PO4, 3.628g Na2HPO4·
12H2O, distilled water is settled to 1L；
2nd, saturated nacl aqueous solution (5M NaCl, 1L)：292.5g NaCl, distilled water dissolving is settled to 1L；
3rd, 1M Tris-HCl buffer solutions (pH 8.0)：30.3g Tris base are dissolved in 200ml distilled waters, hydrochloric acid regulation
PH value is settled to 250ml to 8.0；
4、0.5M EDTA(PH 8.0)：36.5g EDTA are dissolved in NaOH solution, and pH is to 8.0 for regulation, is settled to 250ml；
5th, nuclei lysis buffer (Nuclei Lysis Buffer, 500ml)：40ml 5M NaCl, 2ml 0.5M EDTA
(PH 8.0), 5ml 1M Tris-HCl (pH 8.0), 453ml distilled waters；
6th, proteinase K buffer (Proteinase K buffer, 100ml)：50ml glycerol, 100ul 1M
Tris-HCl (pH 7.5), 200 μ l 1M CaCl2, 47ml distilled waters；
7th, Proteinase K (Proteinase K Solution, 10mg/ml)：100mg Proteinase K powder is dissolved in 10ml albumen
In enzyme K buffer solutions；
8th, digestive juice (Nuclei-SDS-Proteinase K-Master Mix Lysis buffer, 504ml)：420ml
Nuclei Lysis Buffer, 3.5ml Proteinase K (10mg/ml), 17.5ml 10%SDS, 0.35ml 0.5M
EDTA (PH 8.0), 62.65ml distilled waters；
9th, TE buffer solutions (PH 8.0)：1ml 1M Tris-HCl buffer solutions (pH 8.0), 0.2ml 0.5M EDTA (PH
8.0), distilled water is settled to 100ml；
10th, 6 × DNA spotting buffers (10ml):88mg EDTA, 5mg bromophenol blues, 5mg dimethylbenzene is blue or green, is dissolved in the double steamings of 4ml
In water, adjusted to PH7.0 using NaOH after adding 3.6ml glycerine, be settled to 10ml；
11st, 50 × TAE buffer solutions：242g Tris-base, 57.1ml glacial acetic acids, 200ml 0.5M EDTA (PH 8.0),
Distilled water is settled to 1L.
The whole-genome association of embodiment 1
The present invention is associated by following method and steps discovery IL21 gene locis and primary biliary cholangitis.
First, method
1122 China Han PBC Patient Sample As and 4036 normal human samples are have chosen in Chinese han population first
It is research object, carries out HumanOmniZhongHua-8 (v1.1) scannings, carry out the parting of gene pleiomorphism (SNP), uses
Comparative analysis of the PLINK softwares to all polymorphic sites, finds the frequency of multiple SNP of IL21 genes in PBC and normal population
In there were significant differences.
2nd, case and check sample inclusion criteria
All PBC patients for including research meet following standard：1), all patients are Han nationality；2), AMA-M2 serum
Learn tests positive；3), biochemical indicator display cholestasis evidence, is mainly shown as that ALP, GGT are raised；5), all kinds of hepatitis
Negative (HBsAg is negative, hepatitis B virus DNA in serum for poison infection and HIV infection's index
500 copy numbers/milliliter, viral hepatitis type E antigen negative, human immunity are less than less than HCVRNA in 200 copy numbers/milliliter, serum
Defective virus negative antibody)；6), without infection by Schistosoma history；7) patient main suit's drinking amount is less than 100ml/ days.
Genome-wide screening control population sample come from Anhui, Jiangsu, the normal Check-up crowd in Shandong, biochemical indicator is just
Often, characterized without clinical disease, readme body is good for.Case was screened between 22~85 years old, and average age is 54.7 years old；Compare is 15 years old
Screened between by 96 years old, average age is 34.8 years old.
3rd, the essential characteristic of crowd is tested
Its essential characteristic is as follows for chip detection sample for test crowd：
Table 1
4th, the preparation of the genome DNA sample of primary biliary cholangitis (PBC) patient and normal control population
1st, the non-anticoagulation of patient and normal person is gathered in non-anticoagulation collecting pipe by each hospital.Collecting pipe is centrifuged,
Separate serum and blood clot.The serum pipettor on the blood sample upper strata of defrosting is gently mixed in superclean bench, is dispensed
Enter 4 1.5ml blind nuts and preserve pipe, be stored in -80 DEG C.
2nd, separation gel is taken out with ladle, clot is poured into weighing boat, fully shredded clot with scissors, then inhaled with plastics
Be transferred to broken clot in 50ml centrifuge tubes by pipe.
3rd, rinsed with PBS and weigh boat and heparin tube, recovery and rinsing liquid is mixed to 50ml centrifuge tubes with plastic suction pipe
Liquid, centrifugation, 2500rpm, 15min, abandon supernatant by 4 DEG C.
4th, add 5ml digestive juices, mix, be put into water-bath constant temperature oscillator, 50 DEG C, 200rpm, digested overnight.
5th, add 1.5ml 5M NaCl after digesting completely, mix；10min is stored at room temperature, period, reverse mixing was multiple, centrifugation,
3800rpm, 30min, room temperature.
6th, transfer supernatant is fully mixed in 50ml centrifuge tubes, plus 2 times of volume absolute ethyl alcohols.
7th, the cotton-shaped DNA precipitations that be will be seen that with pipettor are transferred to the 2ml EP pipes containing the ethanol of 500 μ l 70% to be carried out clearly
Wash.
8th, it is centrifuged, 13000rpm, 5min, room temperature abandon supernatant；It is centrifuged again, 13000rpm, 1min, room temperature is abandoned with pipettor
Raffinate, dries to the greatest extent, is dissolved with distilled water.
5th, HumanOmniZhongHua-8 (v1.1) chip scanning partings and full-length genome associated data are analyzed
HumanOmniZhongHua-8 (v1.1) chip be purchased from ILLUMINA Inc., parting according to method for product require into
OK.Concrete operations severe steps are carried out by the experimental procedure of Illumina companies HumanOmniZhongHua-8 (v1.1) chip,
Associated description can equally be shown in document [Adler, A.J., Wiley, G.B., Gaffney, the P.M.Infinium Assay for delivering
for Large-scale SNP Genotyping Applications.J.Vis.Exp.(81),e50683,doi:
10.3791/50683(2013).].Each DNA sample uses 200 nanograms (ng), in strict accordance with Illumina companies
The explanation experimental procedure of HumanOmniZhongHua-8 (v1.1) chip is processed.
HumanOmniZhongHua-8 (v1.1) chip typing datas by ILLUMINA Inc. BeadStudio softwares
Manage and export, associated data analysis equally carries out [Zuo, X.et al.Whole-exome SNP array by the document delivered
Identifies 15new susceptibility loci for psoriasis.Nat Commun 6,6793,2015].
The typing data of BeadStudio outputs is analyzed using PLINK, according to the same pairing mechanism of state (pairwise identity-
By-state), repeat samples and relationship sample are excluded.Using smartpca softwares, according to principal component analysis principle
(principal component analysis), excludes colony's heterogeneous samples, has 1,122PBC patients and 4, and 036 is normal right
According to result, for statistical analysis.SNP of the parting success rate less than 98% is excluded, the frequency (minor in sample is analyzed is excluded
Allele frequency, MAF) 0.01 SNP is less than, exclude the Hardy-Weinberg in normal reference sample
Equilibrium values P<1×10-4SNP.By excluding, 776,516 autosomal SNP are had for comparing.Using
PLINK softwares, SNP correlation analyses, with sex as covariate (covariate), are imitated using the principle of linear regression using additivity
Principle (additive allelic effect) is answered, the conspicuousness that each SNP site is associated with PBC is assessed, dangerous equipotential is calculated
The relative risk (Odds ratio, OR) of gene and 95% credibility interval, directly obtained in analysis OR values, credibility interval and
P values, so as to obtain the dangerous allele in the site.(GWAS) analytical calculation is associated by full-length genome and obtains SNP chip
In each site significance (P values) is associated with PBC, found out between PBC according to significance (P values be less than 0.0001)
There is the chromosomal region of potential association, and obtain the mononucleotide polymorphism site and its equipotential of the significantly association of PBC neurological susceptibilities
Gene.The reckoning (Imputation) of SNP is that the Hans' result is reference value (Reference) with thousand Human Genome Programs,
Using IMPUTE2 softwares, with reference to 1,122PBC patients and 4, the result of 036 normal control is calculated.
As a result analysis result is displayed in IL21 gene regions referring to table 2 and Fig. 1, there is 7 mononucleotide polymorphism sites
(rs17005934, rs17005953, rs28517551, rs925550, rs60318098, rs1026157, rs6811183's)
Disease associated haplotype frequency is significantly higher than control crowd in PBC, and p value is that p value is less than 1.07 × 10-5.A series of this monokaryon
Nucleotide polymorphism site and its allele are：Rs17005934, allele is C/T；Rs17005953, allele is T/
C；Rs28517551, allele is A/G；Rs925550, allele is A/C；Rs60318098, allele is G/A；
Rs1026157, allele is G/T；Rs6811183, allele is T/G；Wherein dangerous allele is respectively：
Rs17005934 pleomorphism sites are C；Rs17005953 pleomorphism sites are T；Rs28517551 pleomorphism sites are A；
Rs925550 pleomorphism sites are A；Rs60318098 pleomorphism sites are G；Rs1026157 pleomorphism sites are G；
Rs6811183 pleomorphism sites are T.The individual relative risk that PBC occurs for carrying these dangerous allele is not carry
1.24-1.27 times of person.
IL21 gene region mononucleotide polymorphism site sequences：
As shown in the SEQ ID NO.1 in sequence table：
rs17005934
AATGACTAATTAACAAAGTGCAGACCAGGAAAACACAGACTC[C/T]
GTGAGATTTACCAAATTGGCTCCAAGACTACCCTGAAGTCACCCTTT
As shown in the SEQ ID NO.2 in sequence table：
rs17005953
TTCACCCAGGCGTCATGAAAATAGGTGACCTTGGTTCTAGAAAATTATGA[T/C]
GATGACTTCCCTATAGTTACATCCACCCAAAAAAGCCTG
As shown in the SEQ ID NO.3 in sequence table：
rs28517551
ACGGGCATATCCCCAGCAGAGATGA [A/G] GAGTAGCCCTCCCAAGGGACGCTGC are as in sequence table
Shown in SEQ ID NO.4：
rs925550
AAAATCACATATTGTGCTACAAAATTAATATCTATCAAA[A/C]
TGAATTTTATATTGGCTTCATTTGCCCTTTCTCCTTGTCCACAGA
As shown in the SEQ ID NO.5 in sequence table：
rs60318098
GTATATATGTAGGTTTATGTTTTAT[A/G]TACTATCTCATTGGTTGGTTGTTGT
As shown in the SEQ ID NO.6 in sequence table：
rs1026157
GGATGTTGACTGCATTGAATAGAAA[T/G]GCATCATGGCCAACCAAGAAGAGGT
As shown in the SEQ ID NO.7 in sequence table：
rs6811183
CTGATTCACACGCTTGAGGGGAAGA[T/G]TGCTGGAAAGTAGTAAAATAGAGCG
The IL21 gene region mononucleotide polymorphism sites that table 2 is significantly associated with primary biliary cholangitis
Wherein " OR (95%CI) ", represent compared with normal haploid individuality is carried, carry disease associated haplotype
The individual relative risk that PBC occurs.Chromosome position is with reference to Human Genome GRCh37/hg19..
The confirmatory experiment of embodiment 2rs17005934, rs925550
By for rs17005934, rs925550 907 PBC patients and 2027 normal controls checking, equally
It was found that there were significant differences.PBC patient's verification sample is as the standard in embodiment 1；Normal reference sample university southeast
Teacher's physical examination, biochemical indicator is normal, and ultrasound diagnosis is characterized without liver spleen exception without clinical disease, and readme body is good for.Confirmatory experiment is implemented
In material and the time such as without explanation, provided by Sequenom companies.
1st, IL21 gene region mononucleotide polymorphism site sequences are verified
Rs17005934 sequences
AATGACTAATTAACAAAGTGCAGACCAGGAAAACACAGACTC[C/T]
GTGAGATTTACCAAATTGGCTCCAAGACTACCCTGAAGTCACCCTTTTGGTTTGC
Rs925550 sequences
AAAATCACATATTGTGCTACAAAATTAATATCTATCAAA[A/C]
TGAATTTTATATTGGCTTCATTTGCCCTTTCTCCTTGTCCACAGA
2nd, design of primers
It is to be measured using Sequenom companies Genotyping Tools and MassARRAY Assay Design Software for Design
The pcr amplification primer thing and Single base extension primer of SNP site, and transfer to Integrated DNA Technologies to synthesize.
Design is as follows using DNA primer and probe：
rs17005934：
The sequence of primer 1, ACGTTGGATGAAAGTGCAGACCAGGAAAAC；
Primer 2 sequence, ACGTTGGATGAAAGGGTGACTTCAGGGTAG；
Probe sequence, GACCAGGAAAACACAGACTC
rs925550：
The sequence of primer 1, ACGTTGGATGGGGAGGGTAATTAAAATTAG；
Primer 2 sequence, ACGTTGGATGGGGCAAATGAAGCCAATATA；
Probe sequence, tTGCTACAAAATTAATATCTATCAAA
3rd, PCR amplifications
PCR amplifications use multiple PCR technique, are carried out in 384 orifice plates, and each reaction system cumulative volume is 5 μ l.At one
PCR master mix solution is prepared in new 1.5ml EP pipes.
Prepare PCR master mix liquid：
PCR Mix are reacted each, μ L
10×PCR Buffer 0.5μL
MgCl2(25mM)0.4μL
dNTP mix(25mM)0.1μL
HotStar Taq(5U/μL)0.1μL
Water 1.9μL
PCR primer mix (each 0.5pmol of primer 1 and 2) 1 μ L
Total Volume 4μL
Using 24 passage sample injectors, regulation injection volume is 4 μ L, and PCR is added in each well of 384 orifice plates
Master mix liquid.384 orifice plate is PCR reaction plates.The orifice plate of DNA sample 384 that taking-up has been prepared, uses 24 passages
Sample injector, regulation injection volume is 1 μ L, and template DNA 20-50ng, Hotstar Taq are included in each 5 μ lPCR reaction system
0.5U, every amplimer 0.5pmol, the 25mM dNTPs of 0.1 μ l.PCR reactions are set in the PCR instrument of compatible 384 orifice plate
Condition is：94 DEG C 4 minutes；94 DEG C 20 seconds, 56 DEG C 30 seconds, 72 DEG C 1 minute, 45 circulation；72 DEG C 3 minutes；4 DEG C of holdings.By 384
Hole PCR reaction plates are positioned in PCR instrument, start PCR reactions.
4th, PCR primer alkaline phosphatase treatment
After PCR reactions terminate, by PCR primer SAP (shrimp alkaline phosphatase, shrimp alkaline phosphatase
Enzyme) treatment, with remove system middle reaches from dNTPs.
(1) alkaline phosphatase treatment reaction solution, SAP Mix are prepared.
SAP Mix are reacted each, μ L
H2O1.53
SAP Buffer(10x)0.17
SAP Enzyme(1.7U/μL)0.3
Total Volume 2
(2) 24 passage sample injectors are used, regulation injection volume is 2 μ L, and SAP Mix are added into 384 hole PCR reaction plates.It is right
In each alkaline phosphatase treatment reacting hole, reaction system cumulative volume is 7 μ l, wherein the μ l of 5 μ l, SAP Mix of PCR primer 2.
(3) 384 orifice plates are placed in the PCR instrument of compatible 384 orifice plate, set PCR reaction conditions：37 DEG C 40 minutes；85
DEG C 5 minutes；4 DEG C of maintenances, starting PCR instrument carries out alkaline phosphatase treatment.
5th, Single base extension
(1) after alkaline phosphatase treatment terminates, single base extension, the μ l of reaction system cumulative volume 9 are carried out.
(2) single base extension liquid, EXTEND Mix are prepared.
EXTEND Mix are reacted each, μ l
(3) 24 passage sample injectors are used, regulation injection volume is 2 μ L, and EXTEND Mix correspondences are added into the reaction of 384 holes
Plate.For each reacting hole, single base extension system includes the μ l of 7 μ l and EXTEND Mix liquid of PCR primer 2 after SAP treatment
(wherein each μ l of 0.94 μ l, iPLEX enzyme of extension primer mixture 0.041 extend μ l of mixture 0.2).
(4) 384 orifice plates are placed in the PCR instrument of compatible 384 orifice plate, set PCR reaction conditions：
I.94℃for 30seconds；
II.94℃for 5seconds；
III.52℃for 5seconds；
IV.80℃for 5seconds；
V.GOTO III, 4more times；
VI.GOTO II, 39more times；
VII.72℃for 3minutes；
VIII.4℃forever；
Starting PCR instrument carries out single base extension.
6th, purifying resin
(1) by Clean Resin resins tiling to the resin plate of 6mg；
Plus 16 μ l water are in the corresponding aperture of extension products (2)；
(3) dried resin is poured into extension products plate, sealer, slow speed vertical rotate 30 minutes, make resin with it is anti-
Thing is answered to be fully contacted；
(4) centrifugation makes resin sink to bottom hole portion.
7th, chip point sample
Start MassARRAY Nanodispenser RS1000 point sample instruments, the extension products after purifying resin are moved to
On 384 hole SpectroCHIP chips.
8th, Mass Spectrometer Method
SpectroCHIP chips after point sample are used into MALDI-TOF (matrix-assisted laser
Desorption/ionization-time of fligh, matrix solid-dispersion flight time mass spectrum) analysis,
Testing result uses the softwares of TYPER 4.0 (sequenom) parting and output result.Totally 907 PBC samples and 2127 controls
Sample has obtained effective result.
Using PLINK softwares, logistic regression principle is carried out, with sex as covariate, by synergistic effect model to 907
PBC samples and 2127 results of control sample have carried out statistical analysis.Disease associated haplotype (G) frequency of rs17005934
(0.428) is significantly higher than control crowd (0.362) in PBC, and p value is 1.25 × 10-6.The disease associated haplotype of rs925550
(A) frequency (0.427) in PBC is significantly higher than control crowd (0.353), and p value is 7.44 × 10-8.By patient 1,122PBC and
The GWAS results of 4,036 normal controls, analysis is overlapped with the result in 907 PBC samples and 2127 control samples, is adopted
With fixed-effect model (I2<25%) principle, statistical analysis includes 2029 PBC samples and 6163 control samples altogether
Product.Result shows：Disease associated haplotype (G) frequency of rs17005934 is significantly higher than control crowd in PBC, and p value is
1.06×10-11, relative risk (odds ratio) value (96%CI) is 1.29 (1.21-1.39)；The disease phase of rs925550
Close monoploid (A) frequency and control crowd is significantly higher than in PBC, p value is 3.87 × 10-13, relative risk angle value (96%CI) is
1.31 (1.21-1.40) (being shown in Table 3).
Table 3：IL21 polymorphic site rs17005934 and rs925550 is in whole-genome association and checking find
As a result
The expression analysis of IL21 in the primary biliary cholangitis patient's liver organization of embodiment 3
All hepatic tissues, including 30 PBC patients, 30 autoimmune hepatitis (AIH) patients, 25 chronic hepatitis Bs
(CHB) patient is the Liver biopsy tissue instructed in Shanghai Ren Ji hospitals ultrasound.The liver organization of 6 normal healthy controls (HC) comes from
Liver transplant donor.Hepatic tissue is preserved through formalin fix and FFPE.The inflammation and fibrosis of hepatic tissue according to
" Scheuer " points-scoring system is evaluated.
1st, hepatic tissue section soaks 20 minutes in sodium citrate buffer solution；
2nd, 1 is added：The anti-IL21 antibody (ab5978, Abcam, Cambridge, USA) of 200 dilutions, room temperature is kept for 20 points
Clock；
3rd, slide is cleaned with sodium phosphate buffer；
4th, 1 is added：Goat anti-rabbit antibody (the full-automatic SABC machine secondary antibody group of the HRPO mark of 2000 dilutions
Close, 47101, Leica), immunohistochemical staining operation is carried out using the full-automatic SABC machines of Leica；
5th, the slide for dyeing is analyzed, region under choosing 5 mirrors immediately under the microscope that 40*10 amplifies, record
The positive cell number of dyeing, final result adds standard deviation to state by average value.Mann-Whitney U analysis principles (Mann-
Whitney U-test) for the statistical analysis of data, P values are considered as statistically-significant difference less than 0.05.All analyses are adopted
With Prism software systems (Prism software Version 6.0, Graphpad Software, La Jolla, CA,
USA) treatment.
Result shows, compared to hepatitis B, oneself immunity hepatitis and normal liver tissue, and IL21 is in PBC patient's liver group
Middle expression is knitted significantly to raise.In PBC patient, IL21 positive cell is inflammatory liver cell and the leaching on liver portal area periphery
The inflammation lymphocyte of profit.Test result indicate that, the fiber of the number of IL21 positive cells and the degree of inflammation of liver and liver
Change degree is proportional.Statistical analysis finds the number of IL21 positive cells and the degree of inflammation (hepatic of liver
Inflammation degree) positive correlation (r=0.45, p<0.05)；With the fibrosis (hepatic of liver
Fibrosis degree) positive correlation ((r=0.66, p<0.01), correlated results is shown in Fig. 2.
The preferred embodiment of the invention is above are only, for the person of ordinary skill of the art, this hair is not being departed from
On the premise of bright principle, can also make other changes in different forms, these should also belong to protection model of the invention
Enclose.
SEQUENCE LISTING
<110>Southeast China University
<120>The IL-21 associated with primary biliary cholangitis and its application
<130> SG20161226001
<160>13
<170> PatentIn version 3.3
<210> 1
<211>90
<212> DNA
<213>rs17005934
<221> misc_feature
<223> n is c or t
<400> 1
aatgactaat taacaaagtg cagaccagga aaacacagac tcngtgagat ttaccaaatt 60
ggctccaaga ctaccctgaa gtcacccttt 90
<210>2
<211> 90
<212> DNA
<213> rsrs17005953
<221> misc_feature
<223> n is t or c
<400>2
ttcacccagg cgtcatgaaa ataggtgacc ttggttctag aaaattatga ngatgacttc 60
cctatagtta catccaccca aaaaagcctg 90
<210>3
<211> 51
<212> DNA
<213>rs28517551
<220>
<221> misc_feature
<223> n is a or g
<400>3
acgggcatat ccccagcaga gatgangagt agccctccca agggacgctg c 51
<210>4
<211>85
<212> DNA
<213>rs925550
<221> misc_feature
<223> n is a or c
<400>4
aaaatcacat attgtgctac aaaattaata tctatcaaan tgaattttat attggcttca 60
tttgcccttt ctccttgtcc acaga 85
<210>5
<211> 51
<212> DNA
<213>rs60318098
<221> misc_feature
<223> n is a or g
<400>5
gtatatatgt aggtttatgt tttatntact atctcattgg ttggttgttg t 51
<210>6
<211> 51
<212> DNA
<213>rs1026157
<221> misc_feature
<223> n is t or g
<400>6
ggatgttgactgcattgaatagaaangcatcatggccaaccaagaagaggt 51
<210>7
<211> 51
<212> DNA
<213>rs6811183
<221> misc_feature
<223> n is t or g
<400>7
ctgattcacacgcttgaggggaagantgctggaaagtagtaaaatagagcg 51
<210>8
<211> 30
<212> DNA
<213>The sequence of primer 1 of rs17005934
<400>8
acgttggatg aaagtgcaga ccaggaaaac 30
<210>9
<211> 30
<212> DNA
<213>The primer 2 sequence of rs17005934
<400>9
acgttggatg aaagggtgac ttcagggtag 30
<210>10
<211> 20
<212> DNA
<213>The probe sequence of rs17005934
<400>10
gaccaggaaa acacagactc 20
<210>11
<211> 30
<212> DNA
<213>The sequence of primer 1 of rs925550
<400>11
acgttggatg gggagggtaa ttaaaattag 30
<210>12
<211> 30
<212> DNA
<213>The primer 2 sequence of rs925550
<400>12
acgttggatg gggcaaatga agccaatata 30
<210>13
<211> 26
<212> DNA
<213>The probe sequence of rs925550
<400>13
ttgctacaaa attaatatct atcaaa 26
Claims (10)
- Applications of the 1.IL21 in the product for preparing detection or auxiliary detection, examination or prediction primary biliary cholangitis.
- The reagent of 2.IL21 gene polymorphics site rs17005934 is preparing detection or auxiliary detection, examination or prediction primary courage Application in the product of juice cholangitis, rs17005934 sequences as shown in the SEQ ID NO.1 in sequence table, wherein, monokaryon Thuja acid n is higher than allele T for the risk of carrier's primary biliary cholangitis of C.
- The reagent of 3.IL21 gene polymorphics site rs17005953 is preparing detection or auxiliary detection, examination or prediction primary courage Application in the product of juice cholangitis, rs17005953 sequences as shown in the SEQ ID NO.2 in sequence table, wherein, monokaryon Thuja acid n is higher than allele C for the risk of carrier's primary biliary cholangitis of T.
- The reagent of 4.IL21 gene polymorphics site rs28517551 is preparing detection or auxiliary detection, examination or prediction primary courage Application in the product of juice cholangitis, rs28517551 sequences as shown in the SEQ ID NO.3 in sequence table, wherein, monokaryon Thuja acid n is higher than allele G for the risk of carrier's primary biliary cholangitis of A.
- The reagent of 5.IL21 gene polymorphics site rs925550 is preparing detection or auxiliary detection, examination or prediction primary biliary Application rs925550 sequences in the product of property cholangitis as shown in the SEQ ID NO.4 in sequence table, wherein, mononucleotide n For the risk of carrier's primary biliary cholangitis of A is higher than allele C.
- The reagent of 6.IL21 gene polymorphics site rs60318098 is preparing detection or auxiliary detection, examination or prediction primary courage Application in the product of juice cholangitis, rs60318098 sequences as shown in the SEQ ID NO.5 in sequence table, wherein, monokaryon Thuja acid n is higher than allele A for the risk of carrier's primary biliary cholangitis of G.
- The reagent of 7.IL21 gene polymorphics site rs1026157 is preparing detection or auxiliary detection, examination or prediction primary courage Application in the product of juice cholangitis, rs1026157 sequences as shown in the SEQ ID NO.6 in sequence table, wherein, monokaryon glycosides Sour n is higher than allele T for the risk of carrier's primary biliary cholangitis of G.
- The reagent of 8.IL21 gene polymorphics site rs6811183 is preparing detection or auxiliary detection, examination or prediction primary courage Application in the product of juice cholangitis, rs6811183 sequences as shown in the SEQ ID NO.7 in sequence table, wherein, monokaryon glycosides Sour n is higher than allele G for the risk of carrier's primary biliary cholangitis of T.
- Applications of the 9.IL21 in PBC animal models are prepared.
- Applications of the 10.IL21 in terms of PBC medicines are prepared.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710015507.8A CN106755461B (en) | 2017-01-10 | 2017-01-10 | With the associated interleukin 21 of primary biliary cholangitis and its application |
| PCT/CN2017/092504 WO2018129887A1 (en) | 2017-01-10 | 2017-07-11 | Primary biliary cholangitis-associated interleukin 21 and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710015507.8A CN106755461B (en) | 2017-01-10 | 2017-01-10 | With the associated interleukin 21 of primary biliary cholangitis and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106755461A true CN106755461A (en) | 2017-05-31 |
| CN106755461B CN106755461B (en) | 2019-04-30 |
Family
ID=58948907
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710015507.8A Active CN106755461B (en) | 2017-01-10 | 2017-01-10 | With the associated interleukin 21 of primary biliary cholangitis and its application |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN106755461B (en) |
| WO (1) | WO2018129887A1 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018129887A1 (en) * | 2017-01-10 | 2018-07-19 | 东南大学 | Primary biliary cholangitis-associated interleukin 21 and application thereof |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112695081B (en) * | 2020-12-30 | 2022-08-26 | 中国医学科学院北京协和医院 | New susceptibility gene of primary biliary cholangitis and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010102387A1 (en) * | 2009-03-09 | 2010-09-16 | University Health Network (Uhn) | Interleukin-12 polymorphisms for identifying risk for primary biliary cirrhosis |
| CN103602671A (en) * | 2013-10-16 | 2014-02-26 | 中国人民解放军第四军医大学 | SNP in KRT8 gene exon area and determination method thereof |
| CN103749388A (en) * | 2014-01-16 | 2014-04-30 | 中国科学技术大学 | Method for breeding IL-12p40 (-/-) IL-2R alpha (-/-) mice used as hepatic fibrosis and primary biliary cirrhosis animal models |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106755461B (en) * | 2017-01-10 | 2019-04-30 | 东南大学 | With the associated interleukin 21 of primary biliary cholangitis and its application |
-
2017
- 2017-01-10 CN CN201710015507.8A patent/CN106755461B/en active Active
- 2017-07-11 WO PCT/CN2017/092504 patent/WO2018129887A1/en active Application Filing
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010102387A1 (en) * | 2009-03-09 | 2010-09-16 | University Health Network (Uhn) | Interleukin-12 polymorphisms for identifying risk for primary biliary cirrhosis |
| CN103602671A (en) * | 2013-10-16 | 2014-02-26 | 中国人民解放军第四军医大学 | SNP in KRT8 gene exon area and determination method thereof |
| CN103749388A (en) * | 2014-01-16 | 2014-04-30 | 中国科学技术大学 | Method for breeding IL-12p40 (-/-) IL-2R alpha (-/-) mice used as hepatic fibrosis and primary biliary cirrhosis animal models |
Non-Patent Citations (4)
| Title |
|---|
| FANG QIU等: "A genome-wide association study identifies six novel risk loci for primary biliary cholangitis", 《NATURE COMMUNICATIONS》 * |
| GEORGE F MELLS等: "Genome-wide association study identifies 12 new susceptibility loci for primary biliary cirrhosis", 《NATURE GENETICS》 * |
| 杨焘: "血清IL-21水平与原发性胆汁性肝硬化的相关因素分析", 《中外医疗》 * |
| 黄勇武等: "IL-21在原发性胆汁性肝硬化发病机制中的作用", 《现代检验医学杂志》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018129887A1 (en) * | 2017-01-10 | 2018-07-19 | 东南大学 | Primary biliary cholangitis-associated interleukin 21 and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106755461B (en) | 2019-04-30 |
| WO2018129887A1 (en) | 2018-07-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102177436B (en) | Method of identifying disease risk factors | |
| Weeks et al. | Polygenic disease: methods for mapping complex disease traits | |
| CN1995380B (en) | Method for detecting and identifying mycobacterium tuberculosis strain and its dedicated reagent kit | |
| CN106399561A (en) | Prime, probe and kit for detecting polymorphism of CYP2C19 gene | |
| CN102399898B (en) | Single nucleotide polymorphism (SNP) marker related with clinically cryptogenic non-obstructive azoospermia aided diagnosis and application of SNP marker | |
| Yu et al. | Linkage analysis between loci in the renin-angiotensin axis and end-stage renal disease in African Americans. | |
| Nair et al. | Scanning chromosome 17 for psoriasis susceptibility: lack of evidence for a distal 17q locus | |
| CN102154527A (en) | Method for rapidly detecting multi-drug resistant tuberculosis | |
| CN106755461B (en) | With the associated interleukin 21 of primary biliary cholangitis and its application | |
| CN103773859A (en) | SNP marker of mitochondria DNA related to asthenospermia with unknown clinical causes and application thereof | |
| CN103911440B (en) | SNP marker related to liver toxicity of platinum type chemotherapeutic medicines and applications thereof | |
| CN106834449B (en) | With the associated interleukin 21 receptor of primary biliary cholangitis and its application | |
| CN106834448B (en) | With the associated interleukins 16 of primary biliary cholangitis and its application | |
| CN103397022A (en) | Nucleotide polymorphism markers related to Graves diseases or Graves eye diseases and application thereof | |
| CN103290006B (en) | A clinically unexplained NOA-related mitochondrial DNA SNP marker and applications thereof | |
| CN107447035A (en) | Warfarin drug science of heredity gene C YP2C9 and VKORC1 polymorphic detection kit | |
| CN107312867B (en) | Diagnose SNP and its application of hypothyroidism | |
| CN105112415A (en) | Genetic locus rs780092 and assay kit for type-2 diabetes disease risk assessment | |
| CN108949953A (en) | Detect primer, method and kit that ABCG8 introne 9 is mutated | |
| CN108753959A (en) | It is a kind of positioned at DISC1FP1 genes and the relevant SNP markers of Brain Radiation Injury caused by radiotherapy and its application | |
| CN103215265B (en) | Screening kit for age-related macular degenerative disease | |
| CN108753970A (en) | Nonfunctioning pituitary adenoma detection device and application | |
| CN104263822B (en) | A kind of NOA agnogenic to clinic auxiliary diagnoses relevant low frequency SNV mark and application thereof | |
| CN100368564C (en) | Primer, method and kit for identifying PGC-1 gene promotor 1998 point SNP molecular mark | |
| EP1217081A2 (en) | Methods and reagents for detecting increased risk of developing an inflammatory disorder |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |