CN108753970A - Nonfunctioning pituitary adenoma detection device and application - Google Patents
Nonfunctioning pituitary adenoma detection device and application Download PDFInfo
- Publication number
- CN108753970A CN108753970A CN201810613112.2A CN201810613112A CN108753970A CN 108753970 A CN108753970 A CN 108753970A CN 201810613112 A CN201810613112 A CN 201810613112A CN 108753970 A CN108753970 A CN 108753970A
- Authority
- CN
- China
- Prior art keywords
- primer
- pcr
- detection
- polymorphism
- pituitary adenoma
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The present invention provides a kind of nonfunctioning pituitary adenoma detection devices, and application.Apparatus of the present invention carry out the detection of Massarray SNP partings for the mononucleotide polymorphism site rs2981582 of sample to be tested.The morbidity of the site and nonfunctioning hypophysoma has significant correlation.The different genetic models in this site can provide certain foundation for the diagnosis of nonfunctioning hypophysoma, have higher clinical value.The present invention can provide easy reliable diagnostic method for the early diagnosis of nonfunctional hypophysoma patient.
Description
Technical field
The invention belongs to molecular biology fields, and in particular to a kind of nonfunctioning pituitary adenoma detection device and application.
Background technology
Hypophysoma is common one of the neuroendocrine that pituitary hormone secretion can be caused unbalance, incidence row
After glioma and meningioma, the third position of intracranial tumors incidence is occupied.Epidemiological study shows in population
The incidence of hypophysoma is up to 16.7%, can be happened at any age, in the majority with 30-50 year persons.Nonfunctional adenoma in hypophysoma
Account for about 15%-54%.Since Nonfunctional pituitary adenoma can not embody hormone correlation syndrome, lack apparent relevant clinical disease
Shape, therefore early diagnosed in clinic extremely difficult.
Hypophysoma patient can different times have weight not equal clinical manifestation after being ill in.Predominantly tumour is to outside saddle, saddle
Upper extension compressing adjacent tissue has a headache, based on after two temples, forehead, eyeball or nasion portion distending pain.Optic nerve access by
Pressure, causes different types of defect of visual field, hypopsia.Due to many sings and symptoms of hypophysoma and some common disease classes
Seemingly, therefore many patients are usually failed to pinpoint a disease in diagnosis.Incidence of occult, slow-growing, when clinical symptoms occurs in patient, tumour has been in invade
Life is attacked, compressing closes on important anatomy structure, and patient is caused a series of nerve function lesion occur.In addition to this, hypophysoma is led
Cause hypofunction of anterior pituitary, childhood show as of short and small stature and sexual dyspenesis.Patient's gonad function of adult 3/4
Decline, due to pituitary adrenocorticotropic hormone (Adreno Cortico Tropic Hormone, ACTH) under-reserve, goes out
Existing adrenal cortex function decaying.As effects of tumors to hypothalamus and posterior pituitary can cause diabetes insipidus.About 5%~10% patient
Palsy occurs, acute pituitary function failure occur in some patients.
With the progress of modus operandi, the development of new drug, the raising of radiotherapy localization accuracy, incidence of complications by
It gradually reduces, disease amelioration rate is gradually increased.But the pathogenesis of hypophysoma is still unclear, early diagnosis is still relatively more tired at present
Difficulty, as can make specific diagnosis in tumour early period of origination, for prevent caused by tumour persistently hides growth compressing can not
Inverse nerve function lesion and reduction Operative risk have very important meaning.
Single nucleotide polymorphism (Single Nucleotide Polymorphisms, SNP), refers in a certain crowd
Single different bases existing for specific nucleotide position in normal individual genome, and frequency is at least more than 1%.Due to SNP's
Low mutation rate, high density, be easy to detection make SNP be considered as after first generation Restriction fragment length polymorphism markers and the second generation
Third generation genetic marker after microsatellite polymorphism label.The mankind have had now been found that millions of a single nucleotide polymorphism
Site, and further study its frequency and distribution in the genome, using SNP explore the hereditary basis of disease there has also been
Many examples.Most representative is the genetic research of A Erci Mo's diseases.Using the correlation analysis of SNP polymorphisms, people is studied
Member has found that the 4 allele Ahl tribulus sea silent sickness of ε of APOE genes is related.It is adult-onset diabetes in addition to this
(NIDDM), research has shown that the morbidity of at least 16 SNPs and NIDDM is closely related, wherein peroxisome proliferator activated receptor y
Gene (PPARG) and NIDDM correlations are most strong.Therefore the definite mutator for causing disease is found using SNP, will will be with SNP
The research on basis is applied to clinic, could improve the omission factor of disease in this way, patient is instructed to intervene in advance, reduces disease institute
The pain brought and financial burden.
Invention content
Therefore, the purpose of the present invention is to overcome the defects in the prior art, provides a kind of nonfunctioning pituitary adenoma inspection
Survey device and application.
Before illustrating the content of present invention, it is as follows to define term used herein：
Term " SNP " refers to：Single nucleotide polymorphism.
Term " PBS " refers to：Phosphate buffered saline solution.
Term " TE " refers to：TE buffer solutions, are formulated by Tris and EDTA.
Term " SBS " refers to：Lauryl sodium sulfate.
Term " PCR " refers to：PCR.
Term " FGFR2 " refers to：Fibroblast growth factor receptor 2, also known as CD332, by No. 10 chromosomes
People's source protein of FGFR2 gene codes.
Term " rs2981582 " refers to：(the fibroblast growth factor of fibroblast growth factor receptor 2
Receptor 2, FGFR2) gene intron 2 rs2981582, gene order is：
10621tcccagcact catcgccact taatgaacct gtttgtggag agtccacctg
gtgcctgcct
10681ggctttagga acccgcagca gtccgagtgg tgtctggggt aagctgagct
gctctgggaa
To achieve the above object, the first aspect of the present invention provides a kind of nonfunctioning pituitary adenoma detection device, institute
It states device and carries out the detection of Massarray SNP partings, the dress for the mononucleotide polymorphism site rs2981582 of sample to be tested
It sets including consisting of mechanism：
Primer combination mechanism, it is preferable that the primer is：Forward primer sequence is SEQ ID No:1, the reverse primer
Sequence is SEQ ID No:2；
Pattern detection quantitative mechanism；
PCR reaction mechanisms；
Single base extension mechanism；With
COMPUTER DETECTION and analysis institution.
Device according to a first aspect of the present invention, wherein described device further includes one or more compositions selected from the following
Mechanism：
Mononucleotide polymorphism site rs2981582 sequence analyses mechanism；
Design of primers mechanism；
SAP purifies reaction mechanism；With
Purifying resin mechanism.
Preferably, the primer combination mechanism includes but not limited to：Three Lipase absobed mechanism of solid phase phosphoramidite, BioRP/
OPC purifies mechanism, and HPLC purifies mechanism and/or PAGE purifies mechanism；
The pattern detection quantitative mechanism includes but not limited to：Uv-spectrophotometric mechanism, electrophoresis mechanism；
The PCR reaction mechanisms include but not limited to：Heat start PCR mechanism, touchdown PCR mechanism and/or nest-type PRC machine
Structure；
The SAP purifies reaction mechanism：Dephosphorylation process mechanism；
The single base extension mechanism includes but not limited to：SNaPshot mechanisms；
The COMPUTER DETECTION and analysis institution include but not limited to：Statistical analysis mechanism；
The mononucleotide polymorphism site rs2981582 sequence analyses mechanism includes but not limited to：Electrophoresis mechanism；
The design of primers mechanism includes but not limited to：Gene order obtains mechanism；
The purifying resin mechanism includes but not limited to：Ion exchange resin mechanism.
The second aspect of the present invention provides the operating method of the detection device described in first aspect, the method includes：
(1) pass through primer combination mechanism synthetic primer；Preferably, pass through mononucleotide polymorphism site before primer synthesis
Rs2981582 sequence analyses mechanism analyzes sequence, and carries out design of primers by design of primers mechanism；
(2) DNA extractions and quality testing are carried out by pattern detection quantitative mechanism；
(3) DNA of primer pair step (2) extraction synthesized using step (1) is expanded by PCR reaction mechanisms；
Preferably, reaction mechanism is purified by SAP after PCR reactions and alkaline phosphatase treatment is carried out to product；
(4) single base extension is carried out to the product obtained by step (3) as single base extension mechanism；It is preferred that
Ground carries out purifying resin after the single base extension to product；
(5) step (4) products therefrom is detected and analyzed by COMPUTER DETECTION and analysis institution.
The third aspect of the present invention provides a kind of PCR primer and/or single base of single nucleotide polymorphism rs2981582
Extension primer, the forward primer sequence are SEQ ID No:1, the reverse primer sequences are SEQ ID No:2.
The fourth aspect of the present invention provides a kind of detection nonfunctioning pituitary adenoma kit, is wrapped in the kit
It includes：The polymorphism of single nucleotide polymorphism rs2981582 or the substance of genotype；With
Genotyping reagent.
Kit according to a fourth aspect of the present invention, wherein the polymorphism of the single nucleotide polymorphism rs2981582 or
The substance of genotype is the PCR primer and/or Single base extension primer described in claim 5.
Kit according to a fourth aspect of the present invention, wherein the Genotyping reagent includes：DNTP Mix, HotStar
Taq, iPLEX Termination mix, iPLEX Enzyme.
The fifth aspect of the present invention provide the polymorphism of single nucleotide polymorphism rs2981582 or the substance of genotype,
The primer described in detection device, the third aspect described in first aspect or the kit described in fourth aspect are being prepared for detecting
Nonfunctioning pituitary adenoma neurological susceptibility or for the application in the product of screening nonfunctioning pituitary adenoma.
The sixth aspect of the present invention provide the polymorphism of single nucleotide polymorphism rs2981582 or the substance of genotype,
The primer described in detection device, the third aspect described in first aspect or the kit described in fourth aspect are being prepared for idle
Application in the product of energy type pituitary adenoma early diagnosis.
With the progress of medical technology and the development of molecular biology, work of the research gene played in tumor development
With having great importance.Non-functional pituitary adenoma difference SNP site is screened using molecular biology, can contribute to hypophysis
The early detection and diagnosis of tumor provide Molecular tools and theoretical foundation for the treatment and research of hypophysoma.Understand inherent cause to exist
Effect in disease is the diagnosis for being beneficial to disease, treats and prevents, it helps understands environmental factor in disease generation
Effect.
Early diagnosis, early prevention, early treatment have a very important significance the treatment of nonfunctioning hypophysoma.
However since Nonfunctional pituitary adenoma can not embody hormone correlation syndrome, lack apparent associated clinical symptoms, in clinic
In be difficult in time find.When continued tumor growth is big or Huge Pituitary Adenoma, the nerve fiber around hypophysis can be oppressed, is caused
Related symptoms, such as the eyesight visual field change, primary pituitary hypofunction.Simultaneously because the special anatomical structure of hypophysis, huge
Pituitary adenoma will appear occupation time process, generate neurological dysfunction.Therefore a kind of small to patient trauma there is an urgent need to find, it is easy
The survey method inexpensively examined.
Clinically it is used to make a definite diagnosis the nuclear magnetic resonance check of pituitary adenoma at present, not only somewhat expensive is difficult to use in clinical case
Extensive screening, and due to being limited by resolution ratio, it is difficult to find diameter<Micro- adenoma of 0.5cm.And nonfunctional pituitary gland
Tumor can not embody hormone correlation syndrome, lack apparent associated clinical symptoms, be difficult to find in time in clinic.Therefore it is
Above-mentioned realistic problem is solved, the present invention is using MALDI-TOF MS to the rs2981582 of hypophysoma patient and normal healthy controls sample
Site is detected, the inventors discovered that the morbidity of this site and nonfunctioning hypophysoma has significant correlation.This hair
It is bright that easy reliable diagnostic method can be provided for the early diagnosis of nonfunctional hypophysoma patient.
The nonfunctioning pituitary adenoma detection device of the present invention can have but be not limited to following advantageous effect：
The morbidity of the site and nonfunctioning hypophysoma has significant correlation.The different genetic models in this site can be
The diagnosis of nonfunctioning hypophysoma provides certain foundation, has higher clinical value.The present invention can be nonfunctional hypophysis
The early diagnosis of tumor patient provides easy reliable diagnostic method.
Description of the drawings
Hereinafter, carry out the embodiment that the present invention will be described in detail in conjunction with attached drawing, wherein：
Fig. 1 shows Massarray SNP typing assay flows of the present invention.
Fig. 2 a show the NCBI webpages for the website that gene order is obtained in embodiment 1, and Fig. 2 b are shown will in embodiment 1
Sequence where SNP site is sent in the mailbox of the websites My agena registration.
Fig. 3 shows in embodiment 1 and the result of generation is replicated in new text file .txt.
Fig. 4 is shown in embodiment 1 to reaction tuple setting.
Fig. 5 shows DNA quality measurements in embodiment 1.
Fig. 6 shows that SNP partings detect scatter plot in embodiment 1.
Specific implementation mode
It is further illustrated the present invention below by specific embodiment, it should be understood, however, that, these embodiments are only
It is used for specifically describing in more detail, and is not to be construed as limiting the present invention in any form.
This part carries out general description to the material and test method that are arrived used in present invention experiment.Although being
Realize that many materials and operating method used in the object of the invention are it is known in the art that still the present invention still uses up herein
It may detailed description.It will be apparent to those skilled in the art that within a context, if not specified, material therefor of the present invention and behaviour
It is well known in the art as method.
The reagent and instrument used in following embodiment is as follows：
Reagent：
PBS, TE, SDS, Proteinase K are purchased from Beijing Puli's lema gene Technology Co., Ltd.；
Saturated phenol, chloroform, isoamyl alcohol, NaAC, ethyl alcohol are purchased from Beijing chemical reagents corporation；
Resin, PCR Buffer, MgCl2, dNTP Mix, HotStar Taq, SAP, iPLEX Buffer Plus,
IPLEX Termination mix, iPLEX Enzyme are purchased from Agena companies；
DNA extraction kit, sample-loading buffer are purchased from BioTeKe companies；
Agarose (containing EB), gel was purchased from BIOWEST companies；
PCR reaction plates, Dimple plates are purchased from Axygen companies；
EDTA anticoagulant blood-collecting pipes are purchased from BD companies.
Instrument：
Ultramicrospectrophotometer is purchased from Thermo Scientific, model NanoDrop2000；
PCR instrument, purchased from American AB I companies, model ABI veriti-384PCR instrument；
Point sample instrument is purchased from MassARRAY Nanodispenser, model RS1000.
Embodiment 1
Case group 79, in the pituitary adenoma patients that Baijing Tiantan Hospital is medical and performs the operation.Institute
There are pituitary adenoma patients through clinical manifestation, endocrine laboratory examination, imageological examination is non-functional pituitary adenoma patients.
All patients exclude other malignant diseases (such as meningioma, glioma, lymthoma etc.)；Healthy control group 144 is all from this
Institute same period health examination personnel.All crowds for being included in research be do not suffer from pituitary adenoma and without pituitary adenoma family history just
Normal Healthy People.Research object general information is as shown in table 1.
1 research object general information of table
| Control | Patient | |
| Gender (male/female) | 142(69/73) | 79(41/38) |
| Age | 42.12±11.63 | 41.37±11.63 |
| Weight | 69.04±14.35 | 72.26±13 |
| Tobacco smoking status (%) | ||
| It is | 17.6% | 24.5% |
| It is no | 82.4% | 75.9% |
| Situation of drinking (%) | ||
| It is | 16.8% | 13.9% |
| It is no | 83.2% | 86.1% |
1.Massarray SNP typing assay flows
As shown in Figure 1, Massarray SNP typing assay flows include the following steps：
(1) SNP sequence informations are arranged into reference format；(2) it is input to software progress SNP and does not put design of primers, determine mesh
Site；(3) synthetic primer；(4) pattern detection is quantitative；(5) PCR reacts；(6) SAP purifying reaction；(7) Single base extension is anti-
It answers；(8) purifying resin；(9) machine testing on；(10) data are collected.
2.Massarray SNP typing assay detailed processes
2.1 design of primers and synthesis, dilution
2.1.1. the acquisition of gene order
(1) user is registered in the websites My agena.
(2) in NCBI webpages (http://www.ncbi.nlm.nih.gov/projects/SNP/) in input SNP site
Title, shown according to dbSNP batch reportor formats, as shown in Figure 2 a.
(3) by sequence (tcccagcact catcgccact taatgaacct gtttgtggag where SNP site
agtccacctg gtgcctgcctggctttagga acccgcagca gtccgagtgg tgtctggggt aagctgagct
Gctctgggaa it) is sent in the mailbox of the websites My agena registration, as shown in Figure 2 b.
(4) Genotyping is selected in the TOOLS toolbars of the websites My agena.
(5) RS format are clicked, the websites NCBI is selected to be sent to the file of mailbox in Browse buttons.
(6) website after the completion of the formatting of sequence in the columns Sent to, selecting ProxSNP.
(7) start ProxSNP, click Begin Start.
(8) after the completion of above-mentioned steps, PreXTEND is selected in the columns Sent to.
(9) start ProxSNP, click Begin Start.
(10) in the result of generation, OUTPUT is selected, and file content is replicated in new text file .txt, such as
Shown in Fig. 3.
2.1.2. it combines document and design of primers PCR reactions and single base is carried out using AssayDesigner3.1 softwares and expand
Primer is opened up, and Huada gene company is transferred to be synthesized.Rs2981582 primer sequences are as follows：
Forward primer F:ACGTTGGATGACTGCTGCGGGTTCCTAAAG
Reverse primer R：ACGTTGGATGGCACTCATCGCCACTTAATG
2.1.3 primer dilutes
(1) PCR master mix primers configure：Primer is diluted with pure water, makes single tube PCR master to concentration
100 μM, all single tube PCR master of deionized water mixing, which are added, makes a concentration of 0.5 μM of end reaction PCR master mix.
(2) EXTEND Mix primers configure：Single tube extension primer is diluted to 500 μM of final concentration with pure water, and it is mixed that primer is added
So that 8 μM, 10 μM, 15 μM of each primer concentration after conjunction.This primer molecule amount, matter are calculated according to DNA sintetics operation instructions
Number and molal quantity are measured, and then calculates the amount that deionized water need to be added according to required concentration.The single tube extension primer that will be mixed
It according to molecular size range, takes respectively 1 times of (be less than 6300Da), 1.2 times of (6300Da to 7200Da), 1.5 times of (being more than 7200Da)
Volume mix for use.
2.2 DNA are extracted and quality testing
2.2.1 DNA is extracted
The method of Proteinase K-phenol chloroform genomic DNA extracts the genomic DNA in blood specimen.Detailed step is shown in
Under：
A. take 200 microlitres of EDTA anticoagulated bloods that 500 microlitres of PBS washings are added, 2500g centrifuges 5min.
B. supernatant is discarded, into precipitation plus 500 microlitres of PBS carry out second and wash, and 2500g centrifuges 5min.
C. supernatant is discarded, 500 microlitres of TE, the Proteinase K of 25 microlitres of 20%SDS and 4 microlitre of 10mg/ml are added into precipitation.
D.55 DEG C incubation 3 hours, aperiodically shake up.
E. 700 microlitres of saturated phenols, the mixing that turns upside down 10min is added, until two-phase is formed.
F.12000g high speed centrifugation 10min takes supernatant.
Plus 700 microlitres of Tris saturated phenols G.：Chloroform：Isoamyl alcohol (25：24：1) mixing that, turns upside down 10min.
H.12000g high speed centrifugation 15min takes supernatant.
Plus 700 microlitres of chloroforms I.：Isoamyl alcohol (24：1) mixing that, turns upside down 10min.
J.12000g high speed centrifugation, 15min take supernatant.
K. 0 DEG C of precooling absolute ethyl alcohol of 3M NaAC (PH4.8) and 2.5 times of volumes of 1/10 volume is added.
L.12000g, 4 DEG C of high speed centrifugation 15min.
M. supernatant is abandoned, 200 microlitres of 0 DEG C of 70% ethyl alcohol of precooling are added.
N.12000g, 4 " C high speed centrifugations 15min.
O. remove 70% ethyl alcohol, room temperature air-dries.
P. 20 microlitres of aseptic deionized waters are added, -20 DEG C save backup.
2.2.2 DNA quality testings
The DNA in blood sample is extracted using kit (BioTeKe companies).OD value inspections are carried out using NanoDrop2000 instruments
It surveys.5 microlitres of DNA samples extracted according to 2.2.1 methods and 1 microlitre of sample-loading buffer (6X) mixing are taken, in 0.8% agarose
Electrophoresis on (containing EB) gel, 120V electrophoresis 30 minutes or so observe electrophoresis result under ultraviolet lamp.Reach through analyzing DNA degree
Requirement of experiment, electrophoresis result show that all sample standard deviations obtain complete clearly DNA bands, show DNA without fracture or serious degradation.
All DNA samples store for future use for -20 DEG C.
2.3 Agena MassArray system gene typing steps
2.3.1 parting principle：
The target fragment containing SNP site to be checked is amplified by PCR reactions, then uses and is remained in SAP enzymes removal PCR system
Remaining deoxyribonucleoside triphosphate (dNTP) and primer add Single base extension primer, 3 ' terminal bases closely SNP
Point, and with the base complete complementary in target fragment, substitute dNTP using four kinds of ddNTP, in this way, probe at SNP site only
Extend a base, connected ddNTP is corresponding with the allele of SNP site.With substance assistant laser desorpted ionized flight
Time mass spectrum (MALDI-TOF MS) detects the molecular weight difference between extension products and non-extension primer, determines base at the point.
2.3.2 pcr amplification reaction
(1) configuration PCR master mix in 1.5mlEP pipes are taken, and vibrate low-speed centrifugal.Reactive component is as shown in table 2.
2 PCR master mix of table react related reagent formulation components
(2) 8 Dao Huo, 12 pipettors are selected, 4 μ l PCR master mix are added in each well of 384 orifice plates,
It is eventually adding 1 μ l template DNAs (20ng/ μ l) mixing, 384 hole sealing plate films is carefully covered, and fasten each hole, prevents PCR programs
When phenomena such as evaporating.1000rpm centrifuges 1minute.
(3) pcr amplification reaction program as shown in table 3 is set, PCR reaction plates are positioned in PCR instrument, startup program.
3 pcr amplification reaction program of table
2.3.3 product alkaline phosphatase treatment
(1) PCR after reaction, by PCR product with SAP (shrimp alkaline phosphatase, shrimp alkalinity
Phosphatase) processing, with remove system middle reaches from dNTPs.
(2) alkaline phosphatase treatment reaction solution is prepared in new 1.5mlEP pipes, SAP Mix reactive components are as shown in table 4.
4 SAP reactive components of table
| SAP mix reagents | Concentration | Volume (1rxn) |
| Pure water (HPLC grad) | NA | 1.53μl |
| SAP Buffer | 10x | 0.17μl |
| SAP Enzyme | 1U/μl | 0.30μl |
| Total volume | - | 2.00μl |
(3) 384 hole PCR reaction plates are added in SAP mix, for each alkaline phosphatase treatment reacting hole, reaction is overall
Product is 7 μ l, wherein 5 μ l, SAP mix of PCR product, 2 μ l.
(4) after the completion of liquid relief, 384 hole sealing plate films are carefully covered, and fasten each hole, prevents from evaporating when PCR programs
Phenomena such as, carry out following response procedures after centrifugation.
(5) SAP response procedures are set：37℃20min；85℃5min；4℃∞.And 384 hole reaction plates are positioned over PCR
On instrument, startup program.
2.3.4 single base extension
(1) after alkaline phosphatase treatment, single base extension, 9 μ l of reaction system total volume are carried out.
(2) single base extension liquid is prepared in new 1.5mlEP pipes, EXTEND Mix reactive components are as shown in table 5.
5 extension component of table
| Extension reagent | 9 μ l concentration | Volume (1rxm) |
| Pure water (HPLC grade) | NA | 0.619μl |
| iPLEX Buffer Plus | 0.222x | 0.200μl |
| iPLEX Termination mix | 1x | 0.200μl |
| Primer Mix(7μM:14μM) | 0.625uM:1.25uM | 0.940μl |
| iPLEX Enzyme | 1x | 0.041μl |
| Volume | - | 2μl |
(3) EXTEND Mix are corresponded to and 384 hole reaction plates is added.For each reacting hole, single base extension system
As shown in table 6.
6 single base extension system of table
(4) after the completion of liquid relief, 384 hole sealing plate films are carefully covered, and fasten each hole, prevents from evaporating when PCR programs
Phenomena such as, carry out following response procedures after centrifugation.
(5) extension program is set, as shown in table 7.
7 single base extension system extension program of table
2.3.5 purifying resin
(1) anion exchange resin is uniformly filled in 384/6MG Dimple plates and placing 10 minutes makes it dry.
(2) in 16 μ L water of each Kong Zhongjia of 384 sample planes.
(3) 384 sample planes are gently turned and is buckled on Dimple plates, then tapping makes resin fall into the every of sample plane
In a hole.
(4) 384 sample planes are placed into room temperature rotation mixing 30 minutes in overturning centrifuge.
2.3.6 chip point sample
Start MassARRAY Nanodispenser RS1000 point sample instruments, the extension products after purifying resin are moved to
On 384-well SpectroCHIP bioarray.
2.3.7 Mass Spectrometer Method and data output
MALDI-TOF spectrometer analysis, testing result is used to use TYPER4.0 the SpectroCHIP chips after point sample
Software obtains initial data and Genotyping figure, checks the integrality and correctness of data file, result is saved into and is accordingly deposited
Store up medium.
2.3.8 statistical analysis
Measurement data for meeting normal distribution indicates its average level with mean ± standard deviation, does not meet normal distribution
Then its average level is indicated with median (interquartile range)；Enumeration data frequency and composition ratio indicate.Metering money
If material meets normal distribution, two group differences compare to be examined using t, normal distribution is not met such as, using rank sum test；It counts
Data, which compares, uses Chi-square Test.Whether Hardy-Weinberg is met using Chi-square Test analysis SNP site Gene frequency distribution
Group of the sample from genetic equilibrium is thought in the law of genetic equilibrium, P >=0.01, has preferable representative.Using Logistic
SNP83 gene pleiomorphisms combine endpoints generation (recurrence, death etc. with Post stroke under analysis of regression model difference genetic model
Joint endpoints) and prognosis mala (mRS > 1 divide) association, and ratio calculated ratio (odds ratio, OR) and 95% credible
Section (confidence interval, CI).All statistical analysis are analyzed with P-link and SPSS17.0 softwares, P <
0.05 indicates that difference is significant.
3, SNP partings detect scatter plot：
Dendrogram is also referred to as scatter plot：It is that all partings of SNP site are calculated according to DNA product peak area size is dotted
Figure.2 homozygote partings are clustered close to the horizontal, longitudinal axis respectively according to product peak height in normal dendrogram, between individually
One group of cluster is heterozygote.As seen from Figure 6, this parting success, credible result.
Find that rs2981582 is expressed in nonfunctioning hypophysoma blood samples of patients in differentiation by information analysis.
Rs2981582 (FGFR2, G>A) be located at No. 10 chromosome long arms (the allele G and A of the rs2981582 provided in the present invention,
The allele of the rs2981582 provided in Pubmed databases is allele C and T on its complementary strand).This detection
In there are 3 samples not detect genotype, recall rate 98.65%.Obtained data are analyzed using P-link, people
It is 1 (P that the site minimum gene frequency (MAF), which is 0.3455, HWE inspections (Hardy-Weinberg), in group>0.05).Knot
Fruit shows that sample has preferable populational representation.
It is for statistical analysis to the different genotype of rs2981582 by Chi-square Test, the inventors discovered that normal healthy controls
There are significant difference (p=0.01812) between three kinds of genotype (AA, GA, GG) between group and case group, while equipotential base
Because of (p=0.02728), there is also significant differences between recessive inheritance model (p=0.007324), as shown in table 8.
8 control group of table and case group rs2981582 different genotype Chi-square Tests
It is compared with wild GG genotype by Logistic regression analyses, hypophysoma patient AA genotype obviously causes to hang down
The morbidity (p=0.008727) of body tumor, correction gender, the age, weight, smoke, drink after with wild type GG genes compare AA bases
Because there are still significant difference (p=0.008435) for type, as shown in table 9.
The Logistic of tri- kinds of genotype of table 9rs2981582 is returned
* gender is corrected, at the age, weight, smokes, drink
By to equipotential genetic model (G vs.A), dominant inheritance model (AG+AA vs.GG) and recessive inheritance model (AA
Vs.AG+GG regression analysis) is carried out, the inventors discovered that, rs2981582 is deposited in allele model and stealthy genetic model
In significant difference (p=0.0315, OR=1.541,95%CI：1.039-2.286；P=0.004893, OR=3.051,
95%CI:1.403-6.635).By correct gender, the age, weight, smoke, drink after difference still have conspicuousness, such as table 10
It is shown.
The Logistic of 10 rs2981582 difference genetic models of table is returned
* gender is corrected, at the age, weight, smokes, drink
Although present invention has been a degree of descriptions, it will be apparent that, do not departing from the spirit and scope of the present invention
Under the conditions of, the appropriate variation of each condition can be carried out.It is appreciated that the present invention is not limited to the embodiments, and it is attributed to right
It is required that range comprising the equivalent replacement of each factor.
Sequence table
<110>Baijing Tiantan Hospital
<120>Nonfunctioning pituitary adenoma detection device and application
<130> YZDI-180026
<141> 2018-06-14
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 30
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 1
acgttggatg actgctgcgg gttcctaaag 30
<210> 2
<211> 30
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 2
acgttggatg gcactcatcg ccacttaatg 30
<210> 3
<211> 60
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 3
tcccagcact catcgccact taatgaacct gtttgtggag agtccacctg gtgcctgcct 60
<210> 4
<211> 60
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 4
ggctttagga acccgcagca gtccgagtgg tgtctggggt aagctgagct gctctgggaa 60
Claims (10)
1. a kind of nonfunctioning pituitary adenoma detection device, which is characterized in that described device is directed to the mononucleotide of sample to be tested
Polymorphic site rs2981582 carries out the detection of Massarray SNP partings, which includes consisting of mechanism：
Primer combination mechanism, it is preferable that the primer is：Forward primer sequence is SEQ ID No:1, the reverse primer sequences
For SEQ ID No:2；
Pattern detection quantitative mechanism；
PCR reaction mechanisms；
Single base extension mechanism；With
COMPUTER DETECTION and analysis institution.
2. detection device as described in claim 1, which is characterized in that described device further includes selected from the following one or more
Composition mechanism：
Mononucleotide polymorphism site rs2981582 sequence analyses mechanism；
Design of primers mechanism；
SAP purifies reaction mechanism；With
Purifying resin mechanism.
3. detection device as claimed in claim 1 or 2, it is characterised in that：
The primer combination mechanism includes but not limited to：Three Lipase absobed mechanism of solid phase phosphoramidite, BioRP/OPC purify mechanism,
HPLC purifies mechanism and/or PAGE purifies mechanism；
The pattern detection quantitative mechanism includes but not limited to：Uv-spectrophotometric mechanism, electrophoresis mechanism；
The PCR reaction mechanisms include but not limited to：Heat start PCR mechanism, touchdown PCR mechanism and/or nest-type PRC mechanism；
The SAP purifies reaction mechanism：Dephosphorylation process mechanism；
The single base extension mechanism includes but not limited to：SNaPshot mechanisms；
The COMPUTER DETECTION and analysis institution include but not limited to：Statistical analysis mechanism；
The mononucleotide polymorphism site rs2981582 sequence analyses mechanism includes but not limited to：Electrophoresis mechanism；
The design of primers mechanism includes but not limited to：Gene order obtains mechanism；
The purifying resin mechanism includes but not limited to：Ion exchange resin mechanism.
4. the operating method of claim 1-3 any one of them detection devices, which is characterized in that the method includes：
(1) pass through primer combination mechanism synthetic primer；Preferably, pass through mononucleotide polymorphism site before primer synthesis
Rs2981582 sequence analyses mechanism analyzes sequence, and carries out design of primers by design of primers mechanism；
(2) DNA extractions and quality testing are carried out by pattern detection quantitative mechanism；
(3) DNA of primer pair step (2) extraction synthesized using step (1) is expanded by PCR reaction mechanisms；It is preferred that
Ground purifies reaction mechanism to product progress alkaline phosphatase treatment after PCR reactions by SAP；
(4) single base extension is carried out to the product obtained by step (3) as single base extension mechanism；Preferably, exist
Purifying resin is carried out to product after the single base extension；
(5) step (4) products therefrom is detected and analyzed by COMPUTER DETECTION and analysis institution.
5. the PCR primer and/or Single base extension primer of a kind of single nucleotide polymorphism rs2981582, which is characterized in that described
Forward primer sequence is SEQ ID No:1, the reverse primer sequences are SEQ ID No:2.
6. a kind of detection nonfunctioning pituitary adenoma kit, which is characterized in that the kit includes：Mononucleotide polymorphic
The property polymorphism of rs2981582 or the substance of genotype；With
Genotyping reagent.
7. kit according to claim 6, which is characterized in that the single nucleotide polymorphism rs2981582's is polymorphic
Property or genotype substance be claim 5 described in PCR primer and/or Single base extension primer.
8. kit according to claim 6, which is characterized in that the Genotyping reagent includes：DNTP Mix,
HotStar Taq, iPLEX Termination mix, iPLEX Enzyme.
9. the polymorphism of single nucleotide polymorphism rs2981582 or the substance of genotype, the inspection of claim 1-3 any one of them
Primer or claim 6-8 any one of them kit described in device, claim 5 is surveyed to prepare for detecting nonfunctional
Type pituitary adenoma neurological susceptibility or for the application in the product of screening nonfunctioning pituitary adenoma.
10. the polymorphism of single nucleotide polymorphism rs2981582 or the substance of genotype, claim 1-3 any one of them
Primer or claim 6-8 any one of them kit described in detection device, claim 5 are being prepared for nonfunctioning
Application in the product of pituitary adenoma early diagnosis.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810613112.2A CN108753970B (en) | 2018-06-14 | 2018-06-14 | Nonfunctional pituitary adenoma detection device and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810613112.2A CN108753970B (en) | 2018-06-14 | 2018-06-14 | Nonfunctional pituitary adenoma detection device and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108753970A true CN108753970A (en) | 2018-11-06 |
| CN108753970B CN108753970B (en) | 2022-05-03 |
Family
ID=64022352
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810613112.2A Active CN108753970B (en) | 2018-06-14 | 2018-06-14 | Nonfunctional pituitary adenoma detection device and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108753970B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110438217A (en) * | 2019-06-21 | 2019-11-12 | 首都医科大学附属北京天坛医院 | Single nucleotide polymorphism rs976754 detects statin related myopathy device and application |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103060427A (en) * | 2011-10-20 | 2013-04-24 | 上海华翼生物科技有限公司 | Flight mass spectrum biochip for health risk assessment and its detection method |
-
2018
- 2018-06-14 CN CN201810613112.2A patent/CN108753970B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103060427A (en) * | 2011-10-20 | 2013-04-24 | 上海华翼生物科技有限公司 | Flight mass spectrum biochip for health risk assessment and its detection method |
Non-Patent Citations (1)
| Title |
|---|
| BRIGITA GLEBAUSKIENE等: "Association of FGFR2 rs2981582, SIRT1 rs12778366, STAT3 rs744166 gene polymorphisms with pituitary adenoma", 《ONCOLOGY LETTERS》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110438217A (en) * | 2019-06-21 | 2019-11-12 | 首都医科大学附属北京天坛医院 | Single nucleotide polymorphism rs976754 detects statin related myopathy device and application |
| CN110438217B (en) * | 2019-06-21 | 2022-11-04 | 首都医科大学附属北京天坛医院 | Device for detecting statin-related myopathy through single nucleotide polymorphism rs976754 and application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108753970B (en) | 2022-05-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Wu et al. | IL-1 receptor antagonist gene as a predictive biomarker of progression of knee osteoarthritis in a population cohort | |
| Zhu et al. | Immune gene expression profiling reveals heterogeneity in luminal breast tumors | |
| Vrgoc et al. | Interleukin‐17 and Toll‐like Receptor 10 genetic polymorphisms and susceptibility to large joint osteoarthritis | |
| CN102399898A (en) | Single nucleotide polymorphism (SNP) marker related with clinically cryptogenic non-obstructive azoospermia aided diagnosis and application of SNP marker | |
| CN110055327A (en) | For predicting the endothelial cell marker object and kit of cancer immunotherapy effect | |
| Wang et al. | Clinical and genetic analysis of 63 families demonstrating early and advanced characteristic fundus as the signature of CRB1 mutations | |
| US20110306512A1 (en) | Gene Expression Profiling for Identification, Monitoring, and Treatment of Osteoarthritis | |
| CN108715893B (en) | SNP markers related to radioactive brain injury caused by radiotherapy and application thereof | |
| Abu-Asab et al. | Endometriosis gene expression heterogeneity and biosignature: a phylogenetic analysis | |
| Aissani et al. | Genetic determinants of uterine fibroid size in the multiethnic NIEHS uterine fibroid study | |
| CN108753970A (en) | Nonfunctioning pituitary adenoma detection device and application | |
| CN108707548A (en) | Nonfunctioning pituitary adenoma detection device and application | |
| CN103502469B (en) | Ankylosing spondylitis susceptibility and mononucleotide polymorphism detection method, kit and use thereof | |
| Bulai Livideanu et al. | Bone marrow tryptase as a possible diagnostic criterion for adult systemic mastocytosis | |
| Evans et al. | A major quantitative trait locus for CD4–CD8 ratio is located on chromosome 11 | |
| Coller et al. | Lack of association between the A118G polymorphism of the mu opioid receptor gene (OPRM1) and opioid dependence: A meta-analysis | |
| CN105442053A (en) | Deoxyribonucleic acid (DNA) library for detecting and diagnosing disease-causing genes of ion channel diseases and application thereof | |
| CN105039581A (en) | SNP mark related to woman PTC onset risks and application of SNP mark | |
| Giambona et al. | Very early prenatal diagnosis of Cockayne’s syndrome by coelocentesis | |
| CN109182490A (en) | LRSAM1 gene SNP mutational site serotype specific primer and its application in coronary disease disease forecasting | |
| Jalali et al. | Status of FAS and FAS Ligand Gene Polymorphisms in patients with breast Cancer in Northeastern IRAN | |
| CN103290006B (en) | A clinically unexplained NOA-related mitochondrial DNA SNP marker and applications thereof | |
| CN110438217A (en) | Single nucleotide polymorphism rs976754 detects statin related myopathy device and application | |
| Huang et al. | Association between the vascular endothelial growth factor gene polymorphisms and the risk of polycystic ovary syndrome in Northern Chinese women | |
| Verma et al. | Hemoglobinopathies in India—clinical and laboratory aspects |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |