CN106754963A - NtRRS3 genes and its application in tobacco resistance to bacterial wilt - Google Patents

Abstract

The invention discloses tobacco CC NBS LRR class disease-resistant genesNtRRS3And its application in tobacco resistance to bacterial wilt, belong to plant genetic engineering field.Obtained present invention firstly provides the clone from tobacco resistance to bacterial wilt kind rock cigarette 97NtRRS3Gene, its nucleotides sequence is classified as shown in SEQ ID No.1.The present invention further will be above-mentionedNtRRS3Gene carries out functional verification in being transferred to tobacco.Result shows, overexpressesNtRRS3Gene can significantly increase resistance of the susceptible variety to Ralstonia solanacearum.What the present invention was separateNtRRS3Gene is to regulate and control tobacco to the important gene of Ralstonia solanacearum resistance, can improve resistance of the tobacco to bacterial wilt, has important application prospect at aspects such as tobacco resistance to bacterial wilt molecular breedings.

Description

NtRRS3 genes and its application in tobacco resistance to bacterial wilt

Technical field

The present invention relates toNtRRS3Gene and its application in tobacco resistance to bacterial wilt, belong to plant gene engineering technology neck Domain.

Background technology

Tobacco is the important industrial crops of China.Tobacco bacterial wilt is one of important disease of tobacco, and the disease dependent territory is passed Property bacterial disease, invaded from root or wound, cause plant withered death, be commonly called as " cigarette pest " in China.The disease is distributed more Extensively, it is distributed mainly on the hot and humid torrid zone and subtropical zone.Show in recent years gradually to high latitude, High aititude frigid zone The trend of area extension.Disease serious harm China Yangtze river basin and southern tobacco leaf producing region, huge damage is caused to tobacco grower Lose, cause the cigarette district for having the multiple province such as Fujian, Guangdong, Guangxi of serious production loss.Not yet have cost-effective anti-at present Tobacco bacterial wilt means are controlled, and the effective way for fundamentally solving is to cultivate disease-resistant variety, compared with traditional breeding way, profit The resistance to bacterial wilt kind for cultivating good quality and high output with genetic engineering breeding means can more effectively solve the problems, such as tobacco bacterial wilt.

Current China has carried out the examining order of tobacco gene group, and completes two genomes surveys of wild original species Sequence, but cultigen genome sequence still in an assembling process.This clone for being beneficial to tobacco Bacterial wilt resistance gene and identification, Promote tobacco resistance to bacterial wilt molecular breeding.The bacterial wilt host range that causes harm is very wide, but except arabidopsis, not yet from forward direction Science of heredity means obtain Bacterial wilt resistance gene.At present on arabidopsis obtain the anti-blue or green cumyl of TIR-NB-LRR classes becauseRRS1-RWith The anti-blue or green cumyl of LRR-RLK classes becauseERECTA.And NBS-LRR classes resistant gene often includes nucleotide binding site（NBS）It is bright with richness Propylhomoserin is repeated（LRR）Domain.The conserved domain of NBS contains what multiple played a crucial role during plant signaling transduction Conservative functional areas, such as P-Loop, Kinase-2, Kinase-3a and GLPL etc..LRR domains then mediate pathogen-associated molecular mould The immune response that formula triggers（PTI）In.After plant suffers pathogen invasion, it will usually infecting position by producing allergy anti- Answer to resist the diffusion and breeding of pathogen, and then activate a series of related defense response in downstream.The defense reaction mistake of plant Journey is the result of the signal transduction regulated and control network effect of complexity, and the regulated and control network is by plant hormones such as resistance passage or SA, ET, JA The signal transduction pathway of participation is intersected to form.In current tobacco the anti-blue or green cumyl of NBS-LRR classes because report it is very few, the anti-green grass or young crops of tobacco is withered Molecule mechanism and its regulated and control network research it is very few, this seriously constrains the molecular breeding process of tobacco resistance to bacterial wilt.

The present invention is directed to background above technology, and research is based on the tobacco gene chip data analysis result of laboratory early stage, Be found that one through Ralstonia solanacearum induce after in disease-resistant variety up-regulated expression, the CC-NBS-LRR of expression is lowered in susceptible variety Class resistant gene, is named asNtRRS3, as resistance to bacterial wilt key candidate gene.Using Race technologies from tobacco disease resistance kind rock The full length sequence of the gene has been cloned in cigarette 97, it is bright comprising CC motifs, NB-ARC and multiple richnesses comprising complete ORFs Propylhomoserin motif（LRR-RI）Conserved domain, the characteristics of meet the disease-resistant gene family of CC-NBS-LRR classes.Using Gateway skills Art constructs overexpression vector, and digestion connection method constructs RNAi carrier, and the big gold dollar of susceptible variety safflower and disease-resistant is transferred to respectively In kind rock cigarette 97, genetic complement functional verification is carried out.Ralstonia solanacearum inoculated identification is carried out to transgenic tobacco plant, is as a result foundNtRRS3Overexpression transfer-gen plant makes susceptible variety show slightly resistance, and NtRRS3-RNAi interference of transgene plant make Susceptible variety shows obvious susceptible.After Ralstonia solanacearum is inoculated with, defense-related gene is induced in overexpression transfer-gen plant Up-regulated expression, makes it produce Defense response to react；And after defense-related gene is induced in the RNAi transfer-gen plants significantly under Mileometer adjustment reaches, and it is increased the susceptibility to bacterial wilt.This is illustratedNtRRS3Gene may participate in rock cigarette 97 and Ralstonia solanacearum is resisted Property passage, may be non-allelic genes in anti-sense kind, its signals-modulating network has different resistance path and SA, JA etc. many Bars transduction pathway is intersected to form, and discloses the diversity and complexity of tobacco resistance to bacterial wilt molecule mechanism.The present invention is profit Resistance to bacterial wilt new product of tobacco is cultivated with genetic engineering means and provide genetic resources, with important application prospect.

The content of the invention

The invention providesNtRRS3Gene and its application in tobacco resistance to bacterial wilt.Its object is to provide tobacco CC-NBS-LRR class disease-resistant genesNtRRS3The coded sequence of gene and its coded albumen, there is provided containing above-mentionedNtRRS3Base The over-express vector and RNAi interference carriers of cause, and be applied to improve resistance of the tobacco to Ralstonia solanacearum, and then it is withered to cultivate anti-green grass or young crops Sick new product of tobacco（System）.Genetic resources is provided to cultivate resistance to bacterial wilt new product of tobacco using genetic engineering means, is had Important application prospect.

To achieve the above object, the present invention is adopted the following technical scheme that：

The present invention is cloned by designing primer from resistance to bacterial wilt tobacco bred rock cigarette 97NtRRS3Gene, its nucleotide sequence Shown in SEQ ID NO.1, its amino acid sequence is shown in SEQ ID NO.2.

The invention provides containing the tobacco CC-NBS-LRR class disease-resistant genesNtRRS3The over-express vector of gene with And RNAi carrier.Using Gateway technologies, willNtRRS3Gene is incorporated into over-express vector pEarleyGate 205, by increasing Strong type promoter 35S drives, and carrier is named as p35S:: NtRRS3-TAP；Using digestion connection method, willNtRRS3Gene Forward and reverse Insert Fragment is inserted into RNAi expression vector pGSA2285, is named asNtRRS3-RNAi.Above-mentioned carrier is turned respectively Change EHA105 Agrobacteriums, be conducted into the sense big gold dollar of bacterial wilt kind safflower and resistance to bacterial wilt kind rock respectively by leaf disk method In cigarette 97.Ralstonia solanacearum inoculated identification is carried out to transgenic progeny plant, is as a result shownNtRRS3The overexpression of gene can be notable Strengthen resistance of the tobacco plant to Ralstonia solanacearum, the gene silencing can reduce resistance of the tobacco plant to Ralstonia solanacearum.

Beneficial effect

The tobacco CC-NBS-LRR class disease-resistant genes of present invention cloneNtRRS3Gene can improve resistance of the tobacco to Ralstonia solanacearum, right In the genetic improvement and cultivation resistance to bacterial wilt new product of tobacco of tobacco resistance to bacterial wilt（System）With important application value.

Brief description of the drawings

Fig. 1 RACE are obtainedNtRRS33 ' the unknown nucleotide sequences and 5 ' unknown nucleotide sequences and ORF frame electrophoretograms of gene.A：5’ RACE purpose fragments；B：3 ' RACE purpose fragments；C：CDNA purpose fragments.M1: DL2,000 DNA Marker; M2: DL15,000 DNA Marker。

The Multiple Sequence Alignment of Fig. 2-1 NtRRS3 protein structure domains.

The Multiple Sequence Alignment of Fig. 2-2 NtRRS3 protein structure domains.

The Multiple Sequence Alignment of Fig. 2-3 NtRRS3 protein structure domains.

Fig. 3NtRRS3Overexpression vector（A）And RNAi carrier（B）Structure schematic diagram.

Fig. 4NtRRS3The T0 generation identifications of overexpression transgene tobacco.Identification in A.DNA levels；B. on rna level Identification；M：DL2,000 DNA Marker.1：Negative control；2：Positive control；Remaining swimming lane is the DNA for individual plants with T0 Or sscDNA is the amplified production of template.

Fig. 5NtRRS3-RNAiTransgene tobacco T0 generation identifications.A. the identification in DNA levels；B. on rna level Identification；M：DL2,000 DNA Marker；1：Negative control；2：Positive control；Remaining swimming lane is the DNA for individual plants with T0 Or sscDNA is the amplified production of template.

Fig. 6NtRRS3The phenotype and its disease index of overexpression transgene tobacco inoculation Ralstonia solanacearum.

Fig. 7 RNAi disturb silenceNtRRS3The phenotype and its disease index of transgene tobacco inoculation Ralstonia solanacearum.

Specific embodiment

【Embodiment 1】RACE is obtainedNtRRS3The unknown nucleotide sequence of gene 3 ' and 5 ' unknown nucleotide sequences

This research be based on laboratory early stage tobacco gene chip data analysis result, it was found that one through Ralstonia solanacearum induce after Up-regulated expression in disease-resistant variety, lowers the CC-NBS-LRR class resistant genes of expression in susceptible variety, is named asNtRRS3.Root According to the genetic fragment, design primer NtRRS3-3 ' race-F（5’-AGATTAGGCACTGGAGAGCCAGTTG-3’）With NtRRS3-5’race-R（5’-CTGTGCTGCATGCTAGCTCTATCAC-3’）, pair of primers is designed according to template joint sequence NtLib45-F（5’-GATTCTGTGGATAACCGTATTACCGCCTTACGCGTGTAAAACGAC-3’）And NtLib39-R（5’- ACCAGGATCTCCTAGGGAAACAGCTATGACCATGTTCAC-3’）, with NtRRS3-5 ' race-R primers and NtLib45-F Primer and NtRRS2-3 ' race-F primers and the pairing of NtLib39-R primers carry out 5 ' and 3 '-RACE and react respectively, 5 '- RACE reaction conditions are 95 DEG C, 5 min →（95 DEG C, 30 s → 72 DEG C, 2 min）5 cycles →（95 DEG C, 30 s → 55 DEG C, 30 s → 72 DEG C, 30 s）30 cycles → 72 DEG C, 10 min；3 '-RACE reaction conditions are 95 DEG C, 5 min →（95 DEG C, 30 s → 72 DEG C, 2 min）5 cycles →（95 DEG C, 30 s → 55 DEG C, 30 s → 72 DEG C, 30 s）30 cycles → 72 DEG C, 10 min.

Pcr amplification product is separated by electrophoresis with the Ago-Gel that concentration is 2%, according to the mesh of Bioinformatics Prediction Stripe size recovery autotelic to product and be connected to carrier pMD18-T, then transformed competence colibacillus Escherichia coliDH5ɑ, choose Monoclonal is taken, enters performing PCR detection, selection positive colony send Hua Da gene Co., Ltd to be sequenced.5 ' and 3 ' unknown sequences that will be obtained Row obtain its full length cDNA sequence after splicing, according to the special primer of full length cDNA sequence design amplification ORF framesNtRRS3- ORF-F（5’-ATGGCTTATGCTGCTATTACTTCCCTCATG-3’）WithNtRRS3-ORF-R（5’- CTAATGGATATGGACCTCAATAGAAATTG-3’）, the ORF of genes of interest is obtained as template clone with the leaf cDNA of rock cigarette 97 Frame sequence.Reaction condition is 95 DEG C, 5 min →（95 DEG C, 30 s → 68 DEG C, 2 min）5 cycles →（95 DEG C, 30 s → 55 DEG C, 30 s → 72 DEG C, 30 s）30 cycles → 72 DEG C, 10 min；Pcr amplification product concentration For the Ago-Gel of 1.5 % is separated by electrophoresis, the purpose band size according to Bioinformatics Prediction is purposeful to product Recovery and be connected to carrier pDONR207, then transformed competence colibacillus Escherichia coliDH5ɑ, picking monoclonal, enter performing PCR detection, Selection positive colony send Hua Da gene Co., Ltd to be sequenced.

NtRRS33 ' the unknown nucleotide sequences and 5 ' unknown nucleotide sequences of gene and the electrophoretogram of ORF frame sequences are as shown in Figure 1；Its is complete Whole ORF sequences are as shown in SEQ ID No.1.The cDNA sequence total length 3016bp of the gene, contains 902 amino acid residues of coding ORF frames, length be the Poly of 5 ' the end non-translational regions, length is 224 bp 3 ' end non-translational regions and 26 bp of 83bp （A）Tail.Using the CDD on NCBI（Conserved Domain Database）Software carries out conservative domain to NtRRS2 albumen Prediction, the sequence includes CC motifs, NB-ARC and multiple leucine rich motifs（LRR-RI）Conserved domain, meets CC-NBS- The characteristics of disease-resistant gene family of LRR classes.Tobacco is compared by BlastPNtRRS3The albumen of coding and the resistance of other crops Homology between albumen, as a result shows that it is respectively 61%, 60%, 56% with the homology of potato, tomato, black nightshade.With ClustalW softwares, to the CC-NBS-LRR class resistances of the Four Plants such as NtRRS-3 and arabidopsis, potato, barley and wheat Protein amino acid sequence compare result as shown in Fig. 2-1 ~ 2-3, the CC-NBS-LRR domain amino acid sequences ratio of NtRRS3 More conservative, containing P-Loop, Kinase-2a, Kinase-3a and GLPL region, and the amino acid sequence outside conservative region is poor It is different than larger, thus deducibility tobaccoNtRRS3Gene belongs to CC-NBS-LRR genoids family.

【Embodiment 2】NtRRS3Overexpression vector builds and checking with RNAi carrier

Using Gateway technologies, by primer pairNtRRS3-OE-F（5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCA CCATGGCTTATGCTGC-3’）WithNtRRS3-OE-R（5’- GGGGACCACTTTGTACAAGAAAGCTGGGTCCTAATGGAT ATGGACCTC-3’）Amplification is obtained not including termination codonNtRRS3The cDNA coding domain segments of gene, should through BP reactions Purpose fragment is connected in entry vector pDONR207, then the fragment is shifted from entry vector pDONR207 by LR reactions To in over-express vector pEarleyGate 205, p35S is built::NtRRS3- TAP Overexpression vectors（Fig. 3 A）, for heredity The big gold dollar of transformation of tobacco safflower.

Using digestion connection method, by the primer pair of positive insertionNtRRS3-RNAi-Xho I-F（5’- ATTACTCGAGTCTAATTGATATATGGAGGTGTG-3’）、NtRRS3-RNAi-NcoI-R（5’- ATTACCATGGACAGAGGATTGTTAATGTTAGAG-3’）With the primer pair of reverse insertionNtRRS3-RNAi-PacI-F（5’- ACCTTAATTAATCTAATTGATATATGGAGGTGTG-3’）WithNtRRS3-RNAi-BamHI-R（5’- ATTAGGATCCACAGAGGATTGTTAATGTTAGAG-3’）Expanded from the leaf cDNA template of rock cigarette 97 respectively and obtainedNtRRS3 Forward and reverse Insert Fragment of gene, inserts it into the RNAi expression vector pGSA2285 after digestion, buildsNtRRS2-RNAi Expression vector（Fig. 3 B）, for genetic transformation tobacco rock cigarette 97.The carrier for building converts Agrobacterium by frozen-thawed method EHA105 is in case Transgenic Tobacco is used.

【Embodiment 3】The PCR identifications of the genetic transformation and transgene tobacco of tobacco

Plasmid p35S will be respectively provided with::NtRRS3- TAP Overexpression vectors andNtRRS3-The Agrobacterium of RNAi interference carriers is led to Cross in the leaf disk method big gold dollar of transformation of tobacco kind safflower and rock cigarette 97, T0 is mould respectively through Basta and Ka Na for transgene tobacco The screening of element.Leaf bud and root growth are screened with the kanamycins of 100mg/mL and 75mg/L respectively, with 500 in incubation mg/L（Cef）To suppress the growth of Agrobacterium, 25 DEG C ± 2 DEG C of condition of culture temperature, illumination daily 14h daytimes/10h nights.In advance Culture medium：The mg/L 6-BA+0.1 mg/L IAA of 1/2 MS culture mediums+1.5, co-culture culture medium：1/2 MS culture mediums+ 1.5 mg/L 6-BA+0.1 mg/L IAA+1 mg/L AS, induce screening and culturing medium：The mg/L 6-BA+ of MS culture mediums+1.5 The mg/L 6-BA+0.1 mg/L IAA of 0.1 mg/L IAA+500 mgL cef+2.5 mg/L PPt, MS culture medium+1.5+ 500 mg/L cef+25 mg/L Km, screening and culturing medium：The mg/L 6-BA+0.1 mg/L IAA+500 of MS culture mediums+1.5 The mg/L cef+50 mg/L of+1.5 mg/L 6-BA+0.1 mg/L IAA of mg/L cef+4 mg/L PPt, MS culture medium+500 Km, root media：The mg/L of+0.5 mg/L IAA+500 mg/L cef+4 mg/L PPt, MS culture medium of MS culture mediums+0.5 IAA+500 mg/L cef+75 mg/L Km。

Overexpress the PCR detections of transgene tobacco：According to 35S promoter andNtRRS3Gene order design pair of primers draws Thing 35S-F（5’-TGATGTGATATCTCCACTGACGTAAG-3’）WithNtRRS3-R（5’-GACCCGACTTCGACTCCTCG- 3’）, CTAB methods extract transgenosis and non-transgenic tobacco DNA, and as template, unconverted tobacco DNA is the DNA with transfer-gen plant Control, with 35S-F andNtRRS3- R primers enter performing PCR amplification.PCR reaction systems are：The μ l, dNTP 1.5 of 10 × buffer 2.0 The μ l of μ l, 35S-F 0.5,NtRRS3The μ l of-R 0.5, Taq enzyme 0.1 μ l, ddH₂The μ l of O 14.4, the μ l of template DNA 1.0, cumulative volume is 20µl.Response procedures are：94 ℃ 5 min→（94 ℃ 30 s→58℃ 30 s→72 ℃ 60 s）40 cycles→72 ℃ 10min→ hold at 4℃.Result shows that positive plant PCR amplifications obtain a band of 1650bp（Fig. 4 A）, 73 plants of positive plants are obtained from 84 transfer-gen plants.To understand whether positive plant transgenosis is expressed, CTAB methods are extracted The total serum IgE of positive plant, is single-stranded cDNA through PrimeScript reverse transcriptases reverse transcriptions, according toNtRRS3Gene order sets Meter primer NtRRS3-F（5’-TGCAGTGTCTGTCTGGATGGAATC-3’）And NtRRS3-R（5’- ACTGGCTCTCCAGTGCCTAATCT-3’）, RT-PCR analyses are carried out, all bar is expressed in display to 73 for being analyzed plant positive plant Band, positive rate is 87%（Fig. 4 B）.

RNAi interference carriers transfer-gen plant is detected：Design primer NptII-F（5’- AGATGGATTGCACGCAGGTTCTC-3’）And NptII-R（5’-ATCGGGAGCGGCGATACCGTA-3’）, the extraction of CTAB methods , as template, unconverted tobacco DNA is control, with NptII-F for transgenosis and non-transgenic tobacco DNA, the DNA with transfer-gen plant Expanded for primer enters performing PCR with NptII-R.PCR reaction systems are：10 × buffer 2.0 μ l, dNTP 1.5 μ l, NptII-F 0.5 0.5 μ l of μ l, NptII-R, the 14.4 μ l of μ l, ddH2O of Taq enzyme 0.1, the μ l of template DNA 1.0, cumulative volume is 20 μ l.Reaction interval Sequence is：94 ℃ 5 min→（94 ℃ 30 s→55℃ 30 s→72 ℃ 30 s）40 cycles→72 ℃ 10min→ hold at 4℃.Result shows that positive plant PCR amplifications obtain a band of 500bp（Fig. 5 A）, from 79 transgenosis 60 positive plants are obtained in plant；To understand whether positive plant transgenosis suppresses expression, the total of sun plant is extracted RNA, with primer pair NtRRS3-RNAi-Xho I-F（5’-ATTACTCGAGTCTAATTGATATATGGAGGTGTG-3’）With NtRRS3-RNAi-Nco I-R（5’-ATTACCATGGACAGAGGATTGTTAATGTTAGAG-3’）Carry out RT-PCR analyses, institute 60 positive plants of analysis all show band of expression（Fig. 5 B）.60 plants of T0 are obtained for transgenic positive plant by identifying, Positive rate about 79%.

【Embodiment 4】Transfer-gen plant resistance to bacterial wilt is identified

Wild-type tobacco plants, overexpression transgenic tobacco plant and RNAi transgenic tobacco plants to 6 leaf phases fall 2, 3 functional leafs carry out inoculation treatment, and tobacco Ralstonia solanacearum bacterium solution is injected along vein with disposable 1 mL syringes, carry out resistance mirror It is fixed.Every kind for the treatment of combination sets three biology and repeats.The overall disease resistance of inoculation plant is specifically evaluated by disease index.

It is inoculated with transfer-gen plant after 20 dNtRRS3- OE growing ways are still normal, and obvious necrosis occurs in blade inoculation position Spot, but stem does not occur infecting or only slight infection occurs in minority, and there is dead symptom in the big gold dollar of control group safflower, Transfer-gen plantNtRRS3Substantially gold dollar bigger than wild type safflower is strong for the Resistant expression of-OE（Fig. 6 A）.63 plantsNtRRS3Transgenosis In plant identification, there are 16 plants not fall ill completely, the morbidity of other showed differents, its disease index is 37.67（Figure 6B）.

It is inoculated with transgenosis after 30 dNtRRS3There is obvious necrotic plaque and infects stem in-RNAi plant leafs inoculation position , there is the dead phenomenon of plant in portion, and the only blade of control group rock cigarette 97 necrotic plaque occurs and do not infect downwards, and growing way does not go out normally Existing dead symptom, transgenosisNtRRS3The Resistant expression of-RNAi plant is substantially more susceptible than control group rock cigarette 97（Fig. 7 A）.48 StrainNtRRS3In the identification of-RNAi transfer-gen plants, there are 2 plants not fall ill completely, others have different degrees of morbidity, its disease Feelings index is 59.72（Fig. 7 B）.

The foregoing is only presently preferred embodiments of the present invention, all impartial changes done according to scope of the present invention patent with Modification, should all belong to covering scope of the invention.

SEQUENCE LISTING

<110>University Of Agriculture and Forestry In Fujian

<120>NtRRS3 genes and its application in tobacco resistance to bacterial wilt

<130> 22

<160> 22

<170> PatentIn version 3.3

<210> 1

<211> 3016

<212> DNA

<213>NtRRS3 full length cDNA sequences

<400> 1

gaaagagatt ctgccttgtg tatgcacaaa ctctccatat ttttatcaca cactacatac 60

gagagaaaga gagaaactga gacatggctt atgctgctat tacttccctt atgagcacca 120

tacaacaatc aatgcaagtt actggactta acctgcaatc gttctatgaa aagcttgaat 180

ctttgatagc tattacgggg aaaccatgca ataagatagg caatcttggt gcattgacaa 240

gattggaagc tgaagtgata gagctagcat gcagcacaga agatatggtt gactcggaat 300

caagaaatgt tatggttgac ctgaaatcaa gaaatgttat aaacataatt tcacgaacag 360

taacctttgg gaaacttcgt tccctcttga accaagcaat acgagacatt gattccacca 420

cgaagaagtg gataggaaca cagaccagcc tagatctgaa agcacaaaat acgattcttg 480

cctctacatc tgaacgtgct ttggagcccg agaatatgat ggtcggccat gaaaatgaat 540

tcgagatgat gcaggtccaa ctcgctagag gagctagtga actagaagtt gtctcaattg 600

taggtatggg gggcattggc aaaacaactc tagctaacaa aatcttcagt gatccactca 660

ttatgtatca ctttgacatt cgtgcaaaag ttactatttc acaagagtat tgtgcgagaa 720

atggactcct aggccttctg tcttctatca ccggaaagac cgataaacct tatgagcaac 780

aagatgatgg gcaactaaag gaccaacttc aaaagcttct aaaaggtagg agatatttga 840

tagtcattga tgacatatgg aatgaagcag cttgggatga tataaaacta tgcttcccag 900

actgtaacaa taggagtcga atactcttga ccactcgaaa tgtgaaagtg gctgaatatg 960

ctagctcagg taagcctcct tatcaaatgc gccttttgaa ttgcaatgaa agttgggatt 1020

tactgcacaa aagggtcttt ctgaatgaat gtttcccccc tgaatttgaa caacttggga 1080

aacaaattgc attaaactgc agaggattac ctctagcaat tattgtaatt gctggacttc 1140

tctccaaaat cggtaaagca ttggatgagt ggcaaatggt tgttgagaat gtaagttcat 1200

tagtaagcac agatgttgat gtccaatgca tgagggtgct ggcattgagt taccatcact 1260

tgcctcatcg cctaaaatcg tgctttctgt attttgcaat cttcccagag gatgaacaga 1320

tttttgtcga taaacttgtg gagttatggg cggtagaggg atttttcaag gtagaagata 1380

tgaaaaacat agaaaaggtg gggggagaat ttctaaaaga acttatagat agaagtttaa 1440

tttcaatcca aaacttgagt tttgatggag aaatcgagag ttgtggaatg catgatttga 1500

tccgtgaact atgcttgagg gaagcccaca acatgaattt tgtgaatgtt attggagaag 1560

agaatgatcg aaatccttgt gcgcaattga tgcatttttc gaggagtcga agtcgggtca 1620

gtatccaatt gaacaatcca gacgattcta ttgaggcaaa attggctata tatcctgaaa 1680

aagatgcccg ttctattatc tgttttagag ggcattggtt cgtgcaaaag tcgttgcgtt 1740

tcaagctagt aagagtacta gatcttgctt tagtgagatg tagtactttt ccgaggggga 1800

tacttgattt aattcatttg agataccttg ctttgactct ttatcctcac ttggagtcgg 1860

gaaaagagat tccctcaaca acagtcattc ctccactgat atctagccta tgttatctgc 1920

aaacttttaa actttacctt cctttttcca aagacctggt ctttcctttc atattaccat 1980

cggaaatttt ggcgatacca caattgaggc acctcttttt agattggaat tacttgcagt 2040

cttacaagcc tacaaagaaa agtttggttc tgaaaaattt gcagtgtctg tctggatgga 2100

atccttggta ttgtactggc tctgtcttta gactatttcc caacttaaag aagttgcaaa 2160

tacgtggaat cccaaaagac tttattaatc actatgcact ctttgatttt tgcaacttag 2220

atcagctcga ggaattggaa ttttgtgtta cttatccacg ttttggttgc tttctggata 2280

gaactacaca tcaagaaggc cgtttgaggc ttcatactcc ccctttattt aatacagaag 2340

atgcttttgc accttttcgg ctacctcatc caaatgattt tccacaaaac ctaaagaatt 2400

tagcttttag tggcactttt tttcgttgga aggatttgag catttttggt aaattgccta 2460

aactcgagtc ccttaaactt ggatatgatg ctttcctaga caaggagtgg gaagtatttg 2520

atgaagtatt tcctcgcttg aagttcttgc tcctcgaaga tttggagatt aggcactgga 2580

gagccagttg cgataatttt cctttccttg aacgactatt tctcaaaggt tgttggtatt 2640

tggattcaat ccctcaaaat tttgcagata taaccacact tgctctaatt gatataagga 2700

ggtgtgcaaa atctgttgag aattccgcca agcagattca acaggacatg caagataact 2760

atgcaatttc tattgaggtc catatccatt aggctaattg taagaaatgg tcttccttga 2820

tttaattgtt gcttgtacaa gtactatttg tgtgtccaaa tataggagtt tatagtccac 2880

ttaagtttct agtagttgga atataggagc cagacaccat ttctttgctg ctttgcattc 2940

ttttatgtat cttatgttag cctctaacat taacaatcct ctgtaaaaaa aaaaaaaaag 3000

aaaaaaaaaa aaaaaa 3016

<210> 2

<211> 902

<212> PRT

<213>Amino acid sequence

<400> 2

Met Ala Tyr Ala Ala Ile Thr Ser Leu Met Ser Thr Ile Gln Gln Ser

1 5 10 15

Met Gln Val Thr Gly Leu Asn Leu Gln Ser Phe Tyr Glu Lys Leu Glu

20 25 30

Ser Leu Ile Ala Ile Thr Gly Lys Pro Cys Asn Lys Ile Gly Asn Leu

35 40 45

Gly Ala Leu Thr Arg Leu Glu Ala Glu Val Ile Glu Leu Ala Cys Ser

50 55 60

Thr Glu Asp Met Val Asp Ser Glu Ser Arg Asn Val Met Val Asp Leu

65 70 75 80

Lys Ser Arg Asn Val Ile Asn Ile Ile Ser Arg Thr Val Thr Phe Gly

85 90 95

Lys Leu Arg Ser Leu Leu Asn Gln Ala Ile Arg Asp Ile Asp Ser Thr

100 105 110

Thr Lys Lys Trp Ile Gly Thr Gln Thr Ser Leu Asp Leu Lys Ala Gln

115 120 125

Asn Thr Ile Leu Ala Ser Thr Ser Glu Arg Ala Leu Glu Pro Glu Asn

130 135 140

Met Met Val Gly His Glu Asn Glu Phe Glu Met Met Gln Val Gln Leu

145 150 155 160

Ala Arg Gly Ala Ser Glu Leu Glu Val Val Ser Ile Val Gly Met Gly

165 170 175

Gly Ile Gly Lys Thr Thr Leu Ala Asn Lys Ile Phe Ser Asp Pro Leu

180 185 190

Ile Met Tyr His Phe Asp Ile Arg Ala Lys Val Thr Ile Ser Gln Glu

195 200 205

Tyr Cys Ala Arg Asn Gly Leu Leu Gly Leu Leu Ser Ser Ile Thr Gly

210 215 220

Lys Thr Asp Lys Pro Tyr Glu Gln Gln Asp Asp Gly Gln Leu Lys Asp

225 230 235 240

Gln Leu Gln Lys Leu Leu Lys Gly Arg Arg Tyr Leu Ile Val Ile Asp

245 250 255

Asp Ile Trp Asn Glu Ala Ala Trp Asp Asp Ile Lys Leu Cys Phe Pro

260 265 270

Asp Cys Asn Asn Arg Ser Arg Ile Leu Leu Thr Thr Arg Asn Val Lys

275 280 285

Val Ala Glu Tyr Ala Ser Ser Gly Lys Pro Pro Tyr Gln Met Arg Leu

290 295 300

Leu Asn Cys Asn Glu Ser Trp Asp Leu Leu His Lys Arg Val Phe Leu

305 310 315 320

Asn Glu Cys Phe Pro Pro Glu Phe Glu Gln Leu Gly Lys Gln Ile Ala

325 330 335

Leu Asn Cys Arg Gly Leu Pro Leu Ala Ile Ile Val Ile Ala Gly Leu

340 345 350

Leu Ser Lys Ile Gly Lys Ala Leu Asp Glu Trp Gln Met Val Val Glu

355 360 365

Asn Val Ser Ser Leu Val Ser Thr Asp Val Asp Val Gln Cys Met Arg

370 375 380

Val Leu Ala Leu Ser Tyr His His Leu Pro His Arg Leu Lys Ser Cys

385 390 395 400

Phe Leu Tyr Phe Ala Ile Phe Pro Glu Asp Glu Gln Ile Phe Val Asp

405 410 415

Lys Leu Val Glu Leu Trp Ala Val Glu Gly Phe Phe Lys Val Glu Asp

420 425 430

Met Lys Asn Ile Glu Lys Val Gly Gly Glu Phe Leu Lys Glu Leu Ile

435 440 445

Asp Arg Ser Leu Ile Ser Ile Gln Asn Leu Ser Phe Asp Gly Glu Ile

450 455 460

Glu Ser Cys Gly Met His Asp Leu Ile Arg Glu Leu Cys Leu Arg Glu

465 470 475 480

Ala His Asn Met Asn Phe Val Asn Val Ile Gly Glu Glu Asn Asp Arg

485 490 495

Asn Pro Cys Ala Gln Leu Met His Phe Ser Arg Ser Arg Ser Arg Val

500 505 510

Ser Ile Gln Leu Asn Asn Pro Asp Asp Ser Ile Glu Ala Lys Leu Ala

515 520 525

Ile Tyr Pro Glu Lys Asp Ala Arg Ser Ile Ile Cys Phe Arg Gly His

530 535 540

Trp Phe Val Gln Lys Ser Leu Arg Phe Lys Leu Val Arg Val Leu Asp

545 550 555 560

Leu Ala Leu Val Arg Cys Ser Thr Phe Pro Arg Gly Ile Leu Asp Leu

565 570 575

Ile His Leu Arg Tyr Leu Ala Leu Thr Leu Tyr Pro His Leu Glu Ser

580 585 590

Gly Lys Glu Ile Pro Ser Thr Thr Val Ile Pro Pro Leu Ile Ser Ser

595 600 605

Leu Cys Tyr Leu Gln Thr Phe Lys Leu Tyr Leu Pro Phe Ser Lys Asp

610 615 620

Leu Val Phe Pro Phe Ile Leu Pro Ser Glu Ile Leu Ala Ile Pro Gln

625 630 635 640

Leu Arg His Leu Phe Leu Asp Trp Asn Tyr Leu Gln Ser Tyr Lys Pro

645 650 655

Thr Lys Lys Ser Leu Val Leu Lys Asn Leu Gln Cys Leu Ser Gly Trp

660 665 670

Asn Pro Trp Tyr Cys Thr Gly Ser Val Phe Arg Leu Phe Pro Asn Leu

675 680 685

Lys Lys Leu Gln Ile Arg Gly Ile Pro Lys Asp Phe Ile Asn His Tyr

690 695 700

Ala Leu Phe Asp Phe Cys Asn Leu Asp Gln Leu Glu Glu Leu Glu Phe

705 710 715 720

Cys Val Thr Tyr Pro Arg Phe Gly Cys Phe Leu Asp Arg Thr Thr His

725 730 735

Gln Glu Gly Arg Leu Arg Leu His Thr Pro Pro Leu Phe Asn Thr Glu

740 745 750

Asp Ala Phe Ala Pro Phe Arg Leu Pro His Pro Asn Asp Phe Pro Gln

755 760 765

Asn Leu Lys Asn Leu Ala Phe Ser Gly Thr Phe Phe Arg Trp Lys Asp

770 775 780

Leu Ser Ile Phe Gly Lys Leu Pro Lys Leu Glu Ser Leu Lys Leu Gly

785 790 795 800

Tyr Asp Ala Phe Leu Asp Lys Glu Trp Glu Val Phe Asp Glu Val Phe

805 810 815

Pro Arg Leu Lys Phe Leu Leu Leu Glu Asp Leu Glu Ile Arg His Trp

820 825 830

Arg Ala Ser Cys Asp Asn Phe Pro Phe Leu Glu Arg Leu Phe Leu Lys

835 840 845

Gly Cys Trp Tyr Leu Asp Ser Ile Pro Gln Asn Phe Ala Asp Ile Thr

850 855 860

Thr Leu Ala Leu Ile Asp Ile Arg Arg Cys Ala Lys Ser Val Glu Asn

865 870 875 880

Ser Ala Lys Gln Ile Gln Gln Asp Met Gln Asp Asn Tyr Ala Ile Ser

885 890 895

Ile Glu Val His Ile His

900

<210> 3

<211> 25

<212> DNA

<213>Artificial sequence

<400> 3

agattaggca ctggagagcc agttg 25

<210> 4

<211> 25

<212> DNA

<213>Artificial sequence

<400> 4

ctgtgctgca tgctagctct atcac 25

<210> 5

<211> 45

<212> DNA

<213>Artificial sequence

<400> 5

gattctgtgg ataaccgtat taccgcctta cgcgtgtaaa acgac 45

<210> 6

<211> 39

<212> DNA

<213>Artificial sequence

<400> 6

accaggatct cctagggaaa cagctatgac catgttcac 39

<210> 7

<211> 30

<212> DNA

<213>Artificial sequence

<400> 7

atggcttatg ctgctattac ttccctcatg 30

<210> 8

<211> 29

<212> DNA

<213>Artificial sequence

<400> 8

ctaatggata tggacctcaa tagaaattg 29

<210> 9

<211> 48

<212> DNA

<213>Artificial sequence

<400> 9

ggggacaagt ttgtacaaaa aagcaggctt caccatggct tatgctgc 48

<210> 10

<211> 48

<212> DNA

<213>Artificial sequence

<400> 10

ggggaccact ttgtacaaga aagctgggtc ctaatggata tggacctc 48

<210> 11

<211> 33

<212> DNA

<213>Artificial sequence

<400> 11

attactcgag tctaattgat atatggaggt gtg 33

<210> 12

<211> 33

<212> DNA

<213>Artificial sequence

<400> 12

attaccatgg acagaggatt gttaatgtta gag 33

<210> 13

<211> 34

<212> DNA

<213>Artificial sequence

<400> 13

accttaatta atctaattga tatatggagg tgtg 34

<210> 14

<211> 33

<212> DNA

<213>Artificial sequence

<400> 14

attaggatcc acagaggatt gttaatgtta gag 33

<210> 15

<211> 26

<212> DNA

<213>Artificial sequence

<400> 15

tgatgtgata tctccactga cgtaag 26

<210> 16

<211> 20

<212> DNA

<213>Artificial sequence

<400> 16

gacccgactt cgactcctcg 20

<210> 17

<211> 24

<212> DNA

<213>Artificial sequence

<400> 17

tgcagtgtct gtctggatgg aatc 24

<210> 18

<211> 23

<212> DNA

<213>Artificial sequence

<400> 18

actggctctc cagtgcctaa tct 23

<210> 19

<211> 23

<212> DNA

<213>Artificial sequence

<400> 19

agatggattg cacgcaggtt ctc 23

<210> 20

<211> 21

<212> DNA

<213>Artificial sequence

<400> 20

atcgggagcg gcgataccgt a 21

<210> 21

<211> 33

<212> DNA

<213>Artificial sequence

<400> 21

attactcgag tctaattgat atatggaggt gtg 33

<210> 22

<211> 33

<212> DNA

<213>Artificial sequence

<400> 22

attaccatgg acagaggatt gttaatgtta gag 33

Claims (8)

1. tobacco CC-NBS-LRR classes disease-resistant geneNtRRS3, it is characterised in that：Its nucleotides sequence is classified as SEQ ID NO.1 institutes Show.

2. tobacco CC-NBS-LRR class disease-resistant genes described in claim 1NtRRS3Coded albumen, it is characterised in that：Its institute The amino acid sequence of coding is shown in SEQ ID NO.2.

3. tobacco CC-NBS-LRR class disease-resistant genes described in claim 1 are containedNtRRS3Overexpression carrier.

4. the construction method of overexpression carrier according to claim 3, it is characterised in that：Using Gateway technologies, willNtRRS3Gene is incorporated into over-express vector pEarleyGate 205, is driven by enhanced promoter 35S, and carrier is named as p35S:: NtRRS3-TAP。

5. tobacco CC-NBS-LRR class disease-resistant genes described in claim 1 are containedNtRRS3RNAi interference carriers.

6. the construction method of RNAi interference carriers according to claim 5, it is characterised in that：Using digestion connection method, willNtRRS3Forward and reverse Insert Fragment be inserted into RNAi expression vector pGSA2285, be named asNtRRS3-RNAi。

7. tobacco CC-NBS-LRR class disease-resistant genes described in claim 1NtRRS3Or the albumen described in claim 2 is in cigarette Application in careless resistance to bacterial wilt.

8. application according to claim 5, it is characterised in that including：（1）Structure contains the tobacco described in claim 1 CC-NBS-LRR class disease-resistant genesNtRRS3Plant expression vector；（2）During constructed plant expression vector gone into tobacco； （3）Cultivate the transgene tobacco new varieties of screening resistance to bacterial wilt.