CN106701921A - Primer for real-time fluorescence PCR (Polymerase Chain Reaction) specific detection on polygala tenuifolia and detection method - Google Patents
Primer for real-time fluorescence PCR (Polymerase Chain Reaction) specific detection on polygala tenuifolia and detection method Download PDFInfo
- Publication number
- CN106701921A CN106701921A CN201611089659.4A CN201611089659A CN106701921A CN 106701921 A CN106701921 A CN 106701921A CN 201611089659 A CN201611089659 A CN 201611089659A CN 106701921 A CN106701921 A CN 106701921A
- Authority
- CN
- China
- Prior art keywords
- primer
- polygala
- detection
- real
- time fluorescence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Genetics & Genomics (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a primer for real-time fluorescence PCR (Polymerase Chain Reaction) specific detection on polygala tenuifolia. The DNA (Deoxyribonucleic Acid) sequence of the prime is as shown in SEQ ID NO.1 and SEQ ID NO.2. A detection system consists of 12.5[mu] L of 2X SYBR-Premix Ex Taq, 0.25[mu] L of a 10[mu] mol/L upstream primer, 0.25[mu] L of a 10[mu] mol/L downstream primer, 1[mu] L of a DNA (Deoxyribonucleic Acid) template of 50ng of a sample to be detected, and 11[mu] L of double-distilled water. The reaction parameters are that denaturation is performed for 30 seconds at 95 DEG C, amplification is performed for 5 seconds at 95 DEG C and for 30 seconds at 60 DEG C and the circulation times are 30, and the sample is polygala tenuifolia if a specific amplification curve is generated within 30 circulations.
Description
Technical field
The invention belongs to biological technical field, the real-time fluorescence PCR that more particularly to a species specificity is good, sensitivity is high is special
Property detection polygala primer and detection method.
Background technology
The main contents of Chinese traditional medicine identification are the identification of Chinese medicine and its primitive, also including medicine materical crude slice, extract and Chinese patent drug
Traditional Chinese medicine ingredients identify that the precise Identification of Chinese medicine is the basic link of Chinese medicine cause operation and development.In the past for the detection of Chinese medicine
It is to be classified and identified according to form and features under microscope, qualification cycle is long, poor in timeliness.With various advanced instruments with
And the development of molecular biology, new discrimination method also releases one after another, such as spectral unmixing, chromatographic identification, real-time fluorescence PCR and
DNA molecular marker discriminating and protein detection etc..
Real-time PCR detection is to be combined the PCR amplifications and detection in normal PCR detection pattern（I.e. same
Pcr amplification reaction is combined together with detection of fluorescent dyes in closed container）, i.e., amplification is detected after each PCR cycle
Product, after pcr amplification reaction terminates, can obtain the pcr amplification product change curve of each sample.It is anti-by analyzing these
Curve is answered, it can be deduced that the qualitative and quantitative analysis result of determinand, not only the high sensitivity with regular-PCR, also with Gao Te
The opposite sex and high precision.However, it is particularly important for its pcr amplification primer thing of real-time PCR detection and specific detection method, no
Testing result obtained by same primer and detection method is completely different.
So far, also not on the primer of specific good, sensitivity real-time fluorescence PCR specific detection polygala high
And the relevant report of detection method.
The content of the invention：
The present invention is to solve the above-mentioned technical problem existing for prior art, there is provided a species specificity is good, sensitivity is high
The primer and detection method of real-time fluorescence PCR specific detection polygala.
Technical solution of the invention is：A kind of primer of real-time fluorescence PCR specific detection polygala, it is characterised in that
The DNA sequence dna of the primer is as follows：
Sense primer：5’- AATGCGATACTTGGTGTGAATTG -3’；
Anti-sense primer：5’- CAAGAGATGAGGCGAAGGC -3’.
A kind of detection method of the primer of above-mentioned real-time fluorescence PCR specific detection polygala, it is characterised in that：
Reaction system is：
The SYBR of 2X concentration® Premix Ex Taq 12.5 μL
Concentration is 10 μm of μ L of the sense primer of ol/L 0.25
Concentration is 10 μm of μ L of the anti-sense primer of ol/L 0.25
Concentration<The μ L of DNA profiling 1 of the measuring samples of 50ng
The μ L of distilled water 11；
Response parameter is：
Denaturation, 95 DEG C, 30s；Amplification, 95 DEG C, 5s, 60 DEG C, 30s；Cycle-index 30；
30 following generation specific amplification curves of circulation are polygala.
PCR primer of the present invention is reasonable in design, for real-time PCR detection, can detect from the micro of polygala
DNA, completely makes a distinction polygala with the ITS2 genes of other Chinese medicines, and the specific good, sensitivity of detection is high, and method is quick,
It is easy to operate.
Brief description of the drawings
Fig. 1 is the primer PCR amplification electrophoresis detection result figure of the embodiment of the present invention.
Fig. 2 is embodiment of the present invention real-time fluorescence PCR specific detection result figure.
Fig. 3 is the solubility curve testing result figure of embodiment of the present invention real-time fluorescence PCR.
Fig. 4 is the result figure of embodiment of the present invention real-time fluorescence PCR specific detection polygala and other Chinese herbal medicines.
Fig. 5 is embodiment of the present invention sensitivity analysis result figure.
Specific embodiment
The design of one, real-time fluorescence PCR specific detection polygala primer sequences
1. the close species ITS2 sequence analyses of polygala
Log in NCBI（http://www.ncbi.nlm.nih.gov/）, withPolygala tenuifoliaAndITS2It is key
Word is scanned in nr databases, after the sequence of Search Results is downloaded into deposit, carries out Blast N programs in nr databases
The search of similitude sequence is carried out, and all similitude sequences are downloaded into deposit.
2. the design of polygala species specificity detection primer
The sequence of download is carried out similarity analysis and the sequentiality analysis of sequence, specificity is designed at the difference of sequence and is drawn
Thing：
Sense primer：5’- AATGCGATACTTGGTGTGAATTG -3’；
Anti-sense primer：5’- CAAGAGATGAGGCGAAGGC -3’；
The clone of two, polygala ITS2 sequences and sequence verification
1. polygala species specificity detection primer synthesis
In Shanghai, Sheng Gong bioengineering Co., Ltd synthesizes polygala species specificity detection primer 1 pair, and its DNA sequence dna is：
Sense primer：5’- AATGCGATACTTGGTGTGAATTG -3’；
Anti-sense primer：5’- CAAGAGATGAGGCGAAGGC -3’；
2. the extraction of polygala DNA
Using DNA extraction kit（It is purchased from precious biotech firm）Extract polygala（Anguo City medicine source Chinese medicine Co., Ltd commodity, produce
Ground Sichuan）Template DNA, the concentration with micro-spectrophotometer Detection and Extraction polygala template DNA is 100ng or so；
Agarose gel electrophoresis is detected：It is solidifying with 2% agarose after expanding polygala template DNA with the specific primer PCR for synthesizing
Gel electrophoresis are detected, as a result as shown in Figure 1.In Fig. 1：M.DL2000marker；1 ~ 5. primer amplification；6. water control.
After showing to be detected through agarose gel electrophoresis, the specific electrophoretic band of 143 bp is produced respectively, electrophoretic effects are most
Good, PCR amplification efficiencies are high.
The gel extraction of fragment：Purpose band is reclaimed and purified using the DNA fragmentation QIAquick Gel Extraction Kit of precious biotech firm,
Operating process is carried out by the subsidiary specification of kit.
Reclaim connection, clone and the sequencing of fragment：Reclaim fragment to be connected with cloning vector pMD-19T, convert, through bacterium solution
PCR detects that positive strain serves marine growth Engineering Co., Ltd and carries out sequencing, and sequencing result uses the Blast N of NCBI
Program passes through sequence alignment.Comparison result determines that the sequence of cloned purpose fragment is polygala ITS2 sequences.
The method of three, real-time fluorescence PCR specific detection polygalas
25 μ L reaction systems are：
The SYBR of 2X concentration® Premix Ex Taq 12.5 μL
Concentration is 10 μm of sense primers of ol/L（SEQ ID NO.1） 0.25 μL
Concentration is 10 μm of anti-sense primers of ol/L（SEQ ID NO.2） 0.25 μL
Concentration<The μ L of DNA profiling 1 of the measuring samples of 50ng
The μ L of distilled water 11
Response parameter is：
Denaturation, 95 DEG C, 30s；Amplification, 95 DEG C, 5s, 60 DEG C, 30s；Cycle-index 30；
30 following generation specific amplification curves of circulation are polygala.
The embodiment of the present invention is compareed with water, the specific amplification curve detection result of blank is as shown in Figure 2.In Fig. 2：
1. polygala, 2. water control, 3. blank.
The embodiment of the present invention is compareed with water, the solubility curve testing result of blank it is as shown in Figure 3.In Fig. 3：1. remote
Will, 2. water control, 3. blank.
Result demonstrates primer designed by the present invention enters performing PCR amplification has validity and specificity.
The specific detection of four, embodiment of the present invention detection methods：
The template DNA of each testing sample shown in following table is extracted using DNA extraction kit, is detected respectively with micro-spectrophotometer
The concentration of the template DNA for being extracted is 50 ng, and outside removing template DNA, other are according to real-time fluorescence PCR described in the embodiment of the present invention
Other Chinese medicines such as the method real-time fluorescence PCR specific detection cape jasmine of specific detection polygala, as a result as shown in Figure 4.In Fig. 4
In figure：1st, 2,3 ZY1, ZY2, ZY3 are represented respectively, 4 represent the amplification curve of ZY4-ZY30, and 5 are and water control, and 6 is blank pair
According to.
| Sample number into spectrum | Sample ID | Source/the place of production |
| ZY1 | Polygala | Anguo City medicine source Chinese medicine Co., Ltd Sichuan |
| ZY2 | Polygala | Anguo City medicine source Chinese medicine Co., Ltd Gansu |
| ZY3 | Radix Glycyrrhizae | Import |
| ZY4 | Cape jasmine | Haozhou city of Haozhou city great Northwest Anhui Province of medicine company Co., Ltd |
| ZY5 | Felwort | Anguo City medicine source Chinese medicine Co., Ltd Jilin |
| ZY6 | The wind-weed | Anguo City medicine source Chinese medicine Co., Ltd Hebei |
| ZY7 | The root of large-flowered skullcap | Anguo City medicine source Chinese medicine Co., Ltd Hebei |
| ZY8 | The coptis | Anguo City medicine source Chinese medicine Co., Ltd Sichuan |
| ZY9 | Saline cistanche | Xuzhou prepared slices of Chinese crude drugs factory of medicine limited company |
| ZY10 | Saline cistanche | Shijiazhuang City sincerity Chinese medicine Co., Ltd |
| ZY11 | Cistanche tubulosa | Shandong Jia Tai prepared slices of Chinese crude drugs Co., Ltd |
| ZY12 | Saline cistanche | Haozhou city Yong Gang medicine materical crude slice Co., Ltd., Factory |
| ZY13 | Thizoma curculiginis | Anguo City medicine source Chinese medicine Co., Ltd Guangxi |
| ZY14 | Cynomorium songaricum | The Anguo City medicine source Chinese medicine Co., Ltd Inner Mongol |
| ZY15 | The fruit of Chinese wolfberry | Ningxia Zhongning County matrimony vine development corporation, Ltd. |
| ZY16 | Semen Cuscutae | The Anguo City medicine source Chinese medicine Co., Ltd Inner Mongol |
| ZY17 | Glutinous rehmannia | Anguo City medicine source Chinese medicine Co., Ltd Henan |
| ZY18 | Golden cypress | Anguo City |
| ZY19 | Golden cypress | Bei Yao processing of crude drugs Co., Ltd of Jilin Province |
| ZY20 | CORTEX PHELLODENDRI AMURENE | Heilungkiang |
| ZY21 | Valerian | Haozhou city Yong Gang medicine materical crude slice Co., Ltd., Factory |
| ZY22 | Honeysuckle | Anguo City medicine source Chinese medicine Co., Ltd Guangxi |
| ZY23 | Loquat | The Anguo City medicine source Chinese medicine Co., Ltd Inner Mongol |
| ZY24 | Balloonflower root | Ningxia Zhongning County matrimony vine development corporation, Ltd. |
| ZY25 | Dendrobium candidum | The right ecommerce Co., Ltd in Hangzhou Yunnan |
| ZY26 | The stem of noble dendrobium | Guangzhou |
| ZY27 | Cassia occidentalis | Medicine materical crude slice Co., Ltd of Beijing Tongrentang Anhui |
| ZY28 | Root of Chinese trichosanthes | Anguo City medicine source Chinese medicine Co., Ltd Henan |
| ZY29 | The tuber of dwarf lilyturf | Anguo City medicine source Chinese medicine Co., Ltd Sichuan |
| ZY30 | Lily | Anguo City medicine source Chinese medicine Co., Ltd Gansu |
Result shows：The 30 following specific amplification curves of circulation for producing are polygala, and other samples are followed at 30
Occur amplification curve after ring or without amplification curve, illustrate that the composition that detection method of the invention can be accurately to polygala enters
Row identification, with good specificity.
The sensitivity technique of five, embodiment of the present invention detection methods
Polygala sample is extracted using DNA extraction kit（Anguo City medicine source Chinese medicine Co., Ltd Sichuan）Template DNA, use
Micro-spectrophotometer detects extracted template DNA gradient dilution respectively, is prepared into 25 ng/ μ L, 5ng/ μ L, 1 ng/ μ L
, 0.2 ng/ μ L, 5 concentration gradient samples of 0.04ng/ μ L, carried out in real time according to above-mentioned reaction system and response parameter respectively
Fluorescent PCR is expanded, to determine the detection sensitivity of this standard method, as a result as shown in Figure 5.In Fig. 5：1st, 25 ng/ μ L amplifications knot
Really；2nd, 5ng/ μ L amplifications；3rd, 1ng/ μ L amplifications；4th, 0.2ng/ μ L amplifications；5th, 0.04 ng/ μ L amplifications；
6th, blank.
Result shows：Produced specific amplification curve is polygala, can be with spy as DNA concentration >=0.04ng/ μ L
The detection sensitivity of different amplification, the i.e. standard method is 0.04ng/ μ L.Illustrate that embodiment of the present invention detection method can be accurate
Composition to polygala is identified, with good sensitivity.
Sequence table
<110>Liaoning Normal University
<120>The primer and detection method of real-time fluorescence PCR specific detection polygala
<130> 2016
<160> 2
<170> PatentIn version 3.3
<210> 1
<211> 24
<212> DNA
<213>Sense primer
<400> 1
aatgcgatac ttggtgtgaa ttg 23
<210> 2
<211> 19
<212> DNA
<213>Anti-sense primer
<400> 2
caagagatga ggcgaaggc 19
Claims (2)
1. a kind of primer of real-time fluorescence PCR specific detection polygala, it is characterised in that：The DNA sequence dna of the primer is as follows：
Sense primer：5’- AATGCGATACTTGGTGTGAATTG -3’；
Anti-sense primer：5’- CAAGAGATGAGGCGAAGGC -3’.
2. a kind of detection method of the primer of real-time fluorescence PCR specific detection polygala described in use claim 1, its feature exists
In：
Reaction system is：
The SYBR of 2X concentration® Premix Ex Taq 12.5 μL
Concentration is 10 μm of μ L of the sense primer of ol/L 0.25
Concentration is 10 μm of μ L of the anti-sense primer of ol/L 0.25
Concentration<The μ L of DNA profiling 1 of the measuring samples of 50ng
The μ L of distilled water 11；
Response parameter is：
Denaturation, 95 DEG C, 30s；Amplification, 95 DEG C, 5s, 60 DEG C, 30s；Cycle-index 30；
30 following generation specific amplification curves of circulation are polygala.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611089659.4A CN106701921A (en) | 2016-12-01 | 2016-12-01 | Primer for real-time fluorescence PCR (Polymerase Chain Reaction) specific detection on polygala tenuifolia and detection method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611089659.4A CN106701921A (en) | 2016-12-01 | 2016-12-01 | Primer for real-time fluorescence PCR (Polymerase Chain Reaction) specific detection on polygala tenuifolia and detection method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106701921A true CN106701921A (en) | 2017-05-24 |
Family
ID=58934438
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201611089659.4A Pending CN106701921A (en) | 2016-12-01 | 2016-12-01 | Primer for real-time fluorescence PCR (Polymerase Chain Reaction) specific detection on polygala tenuifolia and detection method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106701921A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107254528A (en) * | 2017-06-26 | 2017-10-17 | 山西大学 | Detect sibiricose A in polygala5With sibiricose A6The method of content |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104818337A (en) * | 2015-05-13 | 2015-08-05 | 山西大学 | Method for identifying Fenyuan No.2 Yuanzhi by using specific primers |
-
2016
- 2016-12-01 CN CN201611089659.4A patent/CN106701921A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104818337A (en) * | 2015-05-13 | 2015-08-05 | 山西大学 | Method for identifying Fenyuan No.2 Yuanzhi by using specific primers |
Non-Patent Citations (4)
| Title |
|---|
| SHILIN CHEN，ET AL: "Validation of the ITS2 Region as a Novel DNA Barcode for Identifying Medicinal Plant Species", 《PLOS ONE》 * |
| 樊杰等: "远志及其近缘种的ITS序列分析及鉴定", 《山西中医学院学报》 * |
| 樊杰等: "远志属7种药用植物ITS1和ITS2序列分析", 《中草药》 * |
| 马孝熙等: "远志药材及其混伪品的DNA条形码鉴定", 《世界科学技术-中医药现代化 中药研究》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107254528A (en) * | 2017-06-26 | 2017-10-17 | 山西大学 | Detect sibiricose A in polygala5With sibiricose A6The method of content |
| CN107254528B (en) * | 2017-06-26 | 2020-06-12 | 山西大学 | Detection of sibicose A in Polygala tenuifolia5With sibicose A6Method of content |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104073553B (en) | Hubei PCR tuber of dwarf lilyturf identification kit and authentication method | |
| CN107557369A (en) | Thin shell mountain pecan Peach cultivars Nacono characteristic sequence, labeled primer and authentication method | |
| CN107557434A (en) | Thin shell mountain pecan Peach cultivars Van Deman characteristic sequence, labeled primer and authentication method | |
| CN108977571A (en) | Identify the fluorescence PCR detection reagent kit and application of four kinds of Araeceae medicinal plants | |
| CN104073550B (en) | A kind of SCAR molecular marker differentiating Fructus Momordicae sex | |
| CN102952896B (en) | Universal loop-mediated isothermal amplification kit for detecting influenza A virus and application of universal loop-mediated isothermal amplification kit | |
| CN105969872A (en) | Dendrobium officinale EST-SSR primer set, development method and application of primer set in species genetic diversity | |
| CN105002272A (en) | Method for identifying varieties of RAPD (random amplified polymorphic DNA) marked panax japonicus and kindred plants thereof | |
| CN107630102B (en) | PCR identification kit and identification method for radix paeoniae alba | |
| CN106701921A (en) | Primer for real-time fluorescence PCR (Polymerase Chain Reaction) specific detection on polygala tenuifolia and detection method | |
| CN106086211A (en) | LAMP primer group, test kit and the detection method of detection Flos Nelumbinis corruption pathogenic bacteria | |
| CN107164525B (en) | A kind of DNA for differentiating 6 kinds of Pterocarpus timber combines bar code and its discrimination method and application | |
| CN106636373A (en) | Real-time fluorescent PCR cistanche specificity detection primer and detection method | |
| CN105483284A (en) | RT-qPCR kit capable of detecting three citrus viruses synchronously | |
| Jiang et al. | Conventional octaplex PCR for the simultaneous identification of eight mainstream closely related Dendrobium species | |
| CN107828858A (en) | A kind of method that exploitation beggar-ticks plant SSR primers are sequenced based on transcript profile | |
| WO2023231532A1 (en) | Snp site combination for identifying variety of lonicera japonica thunb., primer combination, and method for identifying variety of lonicera japonica thunb. | |
| CN104774948A (en) | PCR (Polymerase chain reaction) identification kit and identification method for largehead atractylode in Hebei | |
| CN104404173B (en) | A kind of NASBA method for detecting tomato spotted wilf virus | |
| CN105907873A (en) | Method and PCR specificity identifying primers for identifying rhizoma bletillae and adulterants of rhizoma bletillae | |
| Xiong et al. | Identification of Andrographis Herba and its common products using mini-barcode | |
| CN106755347A (en) | The primer and detection method of real-time fluorescence PCR specific detection Radix Glycyrrhizae | |
| CN105112410B (en) | For genetic test primer, probe and the method for Aguilaria malaccensis Lamk identification | |
| CN109486978A (en) | Buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk SNP marker and its application | |
| CN110097976B (en) | Biological component analysis method of traditional Chinese medicine compound preparation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20170524 |