CN106701815B

CN106701815B - Method for regulating potato storage root character and application

Info

Publication number: CN106701815B
Application number: CN201510481265.2A
Authority: CN
Inventors: 张鹏; 周文智; 何树涛
Original assignee: Shanghai Institutes for Biological Sciences SIBS of CAS
Current assignee: Center for Excellence in Molecular Plant Sciences of CAS
Priority date: 2015-08-03
Filing date: 2015-08-03
Publication date: 2020-04-14
Anticipated expiration: 2035-08-03
Also published as: CN106701815A

Abstract

The invention relates to a method for regulating the character of a tuber storage root and application thereof. The expression of the SRD in the potato plants is changed, so that the development character of the storage roots of the potato plants can be obviously regulated, and the method has a good application prospect in genetic improvement of plant quality.

Description

Method for regulating potato storage root character and application

Technical Field

The invention belongs to the field of biotechnology and plant transgenosis, and particularly relates to a method for regulating potato storage root characters and application thereof.

Background

The potato plants are mainly terrestrial crops having edible root tubers or subterranean stems. The method comprises the following steps of carrying out multi-row asexual propagation on tuberous roots and tubers, such as sweet potatoes (sweet potatoes and sweet potatoes), cassava, potatoes, yams (Chinese yams), and rhizoma podocarpi, wherein only the potato blocks are left for seeds and can be propagated by using lianas. The plants are generally weak in cold resistance, are usually cultivated in frostless seasons, and can inhibit the growth of the potato crops at low temperature to cause the yield reduction of root tubers or tubers, so that the long-time low-temperature period is avoided as much as possible when the potato crops are planted; in addition, loose, fertile and deep soil and a large amount of potash fertilizer are beneficial to improving the yield and the quality of potato crops.

In most potato plants, storage roots are the major organs and can be used as food for humans or as raw material for industrial production. Therefore, it is important to research in the field to study the storage root characteristics of potato plants and find key factors for regulating the storage root characteristics.

Disclosure of Invention

The invention aims to provide a method for regulating the storage root character of potatoes and application thereof.

In a first aspect of the invention, there is provided a method of modulating storage root traits in a potato plant, the method comprising: modulating expression of an SRD polypeptide in a potato plant.

In a preferred embodiment, the potato plant comprises: cassava, sweet potato, yam, taro, kudzu root, konjak, jerusalem artichoke, yacon and the like.

In another preferred embodiment, the SRD polypeptide is selected from the group consisting of:

(a) 2 amino acid sequence of a polypeptide as set forth in SEQ ID NO;

(b) a polypeptide derived from (a) wherein the amino acid sequence of SEQ ID NO:2 is substituted, deleted or added with one or more (e.g., 1 to 20; preferably 1 to 10; more preferably 1 to 5) amino acid residues, and which has the function of the polypeptide of (a); or

(c) A polypeptide derived from (a) having a homology of 70% or more (preferably 80% or more, 85% or more, more preferably 90% or more, such as 95% or more, 98% or more, or 99% or more) with the polypeptide sequence defined in (a) and having the function of the polypeptide of (a).

In another preferred example, the method comprises: reducing expression of an SRD polypeptide in a plant, thereby:

modulating (e.g., the modulating is decreasing) the extent of phosphorylation of starch in storage roots of a potato plant;

regulating (e.g., delaying) the initial development and development progress of storage roots of the potato plant;

modulating (e.g., the modulating is a reduction) the storage root weight, diameter, or number of the potato plant.

In another preferred embodiment, said reducing expression of an SRD polypeptide in a plant comprises: transferring an interfering molecule that interferes with the expression of the SRD polypeptide into a plant (e.g., a cell, tissue, organ, or seed of a plant), thereby down-regulating the expression of the SRD polypeptide in the plant.

In another preferred embodiment, the interfering molecule that interferes with the expression of the SRD polypeptide targets the gene encoding the SRD polypeptide or a transcript thereof; preferably, the 741-1193 position of the coding gene or a transcript thereof is targeted.

In another preferred embodiment, the interfering molecule comprises a structure of formula (I):

Seq_{forward direction}-X-Seq_{Reverse direction}A compound of the formula (I),

in the formula (I), the compound is shown in the specification,

Seq_{forward direction}A fragment of a gene encoding an SRD polypeptide, Seq_{Reverse direction}Is and Seq_{Forward direction}A complementary polynucleotide; preferably, Seq_{Forward direction}741-1193 of a gene encoding an SRD polypeptide;

x is at Seq_{Forward direction}And Seq_{Reverse direction}A spacer sequence therebetween, and the spacer sequence and Seq_{Forward direction}And Seq_{Reverse direction}Are not complementary.

In another preferred embodiment, the structure of formula (I) forms a secondary structure of formula (II) after transfer into a plant:

in the formula (II), Seq_{Forward direction}、Seq_{Reverse direction}And X is as defined above,

i is expressed in Seq_{Forward direction}And Seq_{Reverse direction}Substantially complementary relationship therebetween.

In another preferred example, the method further comprises the subsequent steps of: selecting from the plants after modulating expression of the SRD polypeptide a plant that has acquired an altered trait as compared to the plant prior to modulation.

In another aspect of the invention, there is provided the use of an SRD polypeptide, or a gene encoding or a substance that modulates the expression thereof, for modulating storage root traits in potato plants.

In a preferred embodiment, the substance that modulates the expression of an SRD polypeptide or gene encoding the same is: an agent that interferes with the expression of an SRD polypeptide or a gene encoding the same, for use in:

In another preferred embodiment, the potato plant comprises: cassava, sweet potato, yam, taro, kudzu root, konjak, jerusalem artichoke, yacon and the like.

In another aspect of the invention, there is provided the use of an SRD polypeptide, or a gene encoding the same, as a molecular marker for identifying storage root traits in potato plants; the identification of the storage root characters of the potato plants comprises the following steps:

identifying the phosphorylation degree of starch in the storage root of the potato plant; and/or

Identifying the thickness of the potato plant storage root;

identifying the number of storage roots of the potato plants;

identifying the storage root weight, diameter or number of the potato plants.

Other aspects of the invention will be apparent to those skilled in the art in view of the disclosure herein.

Drawings

FIG. 1 is a schematic diagram of an RNAi binary expression vector containing a hairpin structure.

FIG. 2, Southern blot identification of transgenic plants. Mark: lambda-HindIII Marker, the genome DNA is cut by HindIII enzyme, agarose gel separation, membrane transfer and hygromycin probe hybridization, and the red font is a single-copy plant. The DNA extraction material is greenhouse potted seedling leaves.

FIG. 3, change in expression level of SRD in SRDRNAi transgenic plants.

FIG. 4 Western blot analysis of MeSRD protein expression in transgenic plants. The protein extraction material is mature leaf of greenhouse cassava plant.

Antibody: MeSRD rabbit polyclonal antibody;

internal reference: the Rubisco is taken as a protein loading internal reference;

comparison: wild type cassava TMS60444 is used as a reference;

FIG. 5, analytical map of storage root storage starch phosphorylation level.

A: glucose-6-phosphate standard sample;

b: a glucose-3-phosphate standard sample;

c: the content of glucose-6-phosphate and glucose-3-phosphate in wild cassava root tuber;

d: the contents of glucose-6-phosphate and glucose-3-phosphate in SRDRNAi transgenic cassava root tubers; the cassava root tuber with the starch extracted is taken from the Shanghai five-database field base.

Figure 6, extent of storage starch phosphorylation of wild type and SRDRNAi transgenic cassava storage roots. The ordinate is the weight percentage of glucose-6-phosphoric acid contained in each mg of starch hydrolysate, and the starch extraction material is taken from a mature root tuber of a cassava plant in Shanghai five families. The T-test differences were very significant (p < 0.01).

Figure 7, wild type and SRDRNAi transgenic cassava field pilot growth phenotype.

A: canopy structure (first row) and tuberous root (second, third row) of wild type and SRDRNAi transgenic cassava;

b: the weight of the root tuber of each plant;

c: the number of root tubers of a single plant;

d: root diameter;

e: plant height.

Detailed Description

Through intensive research, the inventor finds that the development character of the storage root of the potato plant can be obviously regulated by changing the expression of the SRD in the potato plant, and the SRD has a good application prospect in genetic improvement of the plant quality.

As used herein, "potato plant" of the present invention, also referred to as "potato crop," refers primarily to a type of terrestrial crop having edible root tubers or subterranean stems. Including but not limited to: root tuber plants of Euphorbiaceae such as Manihot esculenta, root tuber plants of Convolvulaceae such as Ipomoea batatas, tuber plants of Solanaceae such as Solanum tuberosum, root tuber plants of Dioscoreaceae such as Dioscorea opposita, tuber plants of Araceae such as taro and Amorphophallus konjac, root tuber plants of Leguminosae such as Pueraria lobata, tuber plants of Compositae such as Jerusalem artichoke and yacon.

The invention also includes fragments, derivatives and analogs of the SRD polypeptides. As used herein, the terms "fragment," "derivative," and "analog" refer to a polypeptide that retains substantially the same biological function or activity as an SRD polypeptide of the present invention. A polypeptide fragment, derivative or analog of the present invention may be (i) a polypeptide having one or more amino acid residues which are conserved or not (preferably conserved amino acid residues) substituted, and such substituted amino acid residues may or may not be encoded by the genetic code, or (ii) a polypeptide having a substituent group in one or more amino acid residues, or (iii) a polypeptide having an additional amino acid sequence fused to the sequence of the polypeptide (e.g., a leader or secretory sequence or a sequence used to purify the polypeptide or a proprotein sequence, or a fusion protein). Such fragments, derivatives and analogs are within the purview of those skilled in the art in view of the definitions herein.

Any biologically active fragment of an SRD polypeptide can be used in the present invention. As used herein, a biologically active fragment of an SRD polypeptide is meant to be a polypeptide that retains all or part of the function of the full-length SRD polypeptide. Typically, the biologically active fragment retains at least 50% of the activity of the full-length SRD polypeptide. More preferably, the active fragment is capable of retaining 60%, 70%, 80%, 90%, 95%, 99%, or 100% of the activity of the full-length SRD polypeptide.

In the present invention, the term "SRD polypeptide" refers to a polypeptide having the sequence of SEQ ID NO. 2 having the activity of an SRD polypeptide. The term also includes variants of the sequence of SEQ ID NO. 2 that have the same function as the SRD polypeptide. These variants include (but are not limited to): deletion, insertion and/or substitution of several (usually 1 to 50, preferably 1 to 30, more preferably 1 to 20, most preferably 1 to 10, still more preferably 1 to 8, 1 to 5) amino acids, and addition or deletion of one or several (usually up to 20, preferably up to 10, more preferably up to 5) amino acids at the C-terminus and/or N-terminus. For example, in the art, substitutions with amino acids of similar or similar properties will not generally alter the function of the protein. Also, for example, addition or deletion of one or several amino acids at the C-terminus and/or N-terminus does not generally alter the function of the protein. The term also includes active fragments and active derivatives of SRD polypeptides.

Variants of the polypeptides include: homologous sequences, conservative variants, allelic variants, natural mutants, induced mutants, proteins encoded by DNA that hybridizes to SRD polypeptide DNA under conditions of high or low stringency. The invention also provides other polypeptides, such as fusion proteins comprising an SRD polypeptide or fragment thereof.

Any protein having high homology to the SRD polypeptide (e.g., 70% or greater homology to the sequence shown in SEQ ID NO: 2; preferably 80% or greater homology; more preferably 90% or greater homology, e.g., 95%, 98% or 99% homology) and having the same function as the SRD polypeptide is also included in the present invention.

The induced variants may be obtained by various techniques, such as random mutagenesis by radiation or exposure to a mutagenizing agent, site-directed mutagenesis, or other known molecular biological techniques, and analogs also include analogs having residues other than the natural L-amino acid (e.g., the D-amino acid), as well as analogs having non-naturally occurring or synthetic amino acids (e.g., β, gamma-amino acids).

It is to be understood that while the SRD polypeptides of the invention are preferably obtained from cassava, other polypeptides that are highly homologous (e.g., have greater than 70%, such as 80%, 90%, 95%, or even 98% sequence identity) to cassava SRD polypeptides obtained from other plants are also within the contemplation of the invention. Methods and means for aligning sequence identity are also well known in the art, for example BLAST.

The present invention also relates to polynucleotide sequences encoding the SRD polypeptides of the invention or conservative variant polypeptides thereof. The polynucleotide may be in the form of DNA or RNA. The form of DNA includes cDNA, genomic DNA or artificially synthesized DNA. The DNA may be single-stranded or double-stranded. The DNA may be the coding strand or the non-coding strand. The sequence of the coding region encoding the mature polypeptide may be identical to the sequence of the coding region shown in SEQ ID NO. 1 or may be a degenerate variant. As used herein, "degenerate variant" refers in the present invention to nucleic acid sequences which encode a protein having SEQ ID NO. 2, but differ from the sequence of the coding region shown in SEQ ID NO. 1.

The polynucleotide encoding the mature polypeptide of SEQ ID NO. 2 comprises: a coding sequence encoding only the mature polypeptide; the coding sequence for the mature polypeptide and various additional coding sequences; the coding sequence (and optionally additional coding sequences) as well as non-coding sequences for the mature polypeptide.

The term "polynucleotide encoding a polypeptide" may be a polynucleotide comprising a sequence encoding the polypeptide, or may be a polynucleotide further comprising additional coding and/or non-coding sequences.

The present invention also relates to polynucleotides which hybridize to the sequences described above and which have at least 50%, preferably at least 70%, and more preferably at least 80% identity between the two sequences.

The full-length nucleotide sequence of the SRD gene of the invention or a fragment thereof can be obtained by PCR amplification, recombination or artificial synthesis. For PCR amplification, primers can be designed based on the nucleotide sequences disclosed herein, particularly open reading frame sequences, and the sequences can be amplified using commercially available cDNA libraries or cDNA libraries prepared by conventional methods known to those skilled in the art as templates.

The invention also relates to vectors comprising said polynucleotides, and to genetically engineered host cells using said vectors or SRD gene sequences.

Based on the inventors' new findings, the present invention also provides a method for modulating storage root traits in a potato plant, comprising modulating expression of an SRD polypeptide in said potato plant.

More preferably, the method comprises: reducing expression of an SRD polypeptide in the potato plant (including non-expression or low expression of an SRD polypeptide), thereby modulating storage root development in the potato plant, comprising: modulating (e.g., reducing) the extent of starch phosphorylation in storage roots of a potato plant; regulating (e.g., delaying) the initial development and development progress of storage roots of the potato plants; regulating (e.g., reducing) the storage root weight, diameter or number of the potato plant.

Various methods known to those skilled in the art can be used to reduce or delete expression of an SRD polypeptide, such as delivering an expression unit (e.g., an expression vector or virus, etc.) carrying an antisense SRD gene to a target such that cells or plant tissues do not express or reduce expression of the SRD polypeptide.

As an embodiment of the present invention, there is provided a method of reducing expression of an SRD polypeptide in a plant, the method comprising:

(1) transferring the interfering molecules interfering with SRD gene expression into plant tissues, organs or seeds to obtain the plant tissues, organs or seeds transformed with the interfering molecules; and

(2) regenerating the plant tissue, organ or seed obtained in step (1) into which the interfering molecule has been transferred into a plant.

As a preferred example, the method comprises the steps of:

(i) providing an agrobacterium carrying a vector interfering with gene expression, said vector being selected from the group consisting of:

(a) a vector comprising a gene or gene fragment (antisense molecule) encoding a reverse-acting SRD polypeptide;

(b) a vector comprising an interfering molecule capable of forming a moiety that specifically interferes with the expression (or transcription) of a gene encoding an SRD polypeptide in a plant;

(ii) (ii) contacting a tissue or organ of the plant with the Agrobacterium of step (i) thereby transferring the vector into the plant tissue or organ.

Preferably, the method further comprises:

(iii) selecting a plant tissue or organ into which said vector has been transferred; and

(iv) (iv) regenerating the plant tissue or organ of step (iii) into a plant.

Based on the nucleotide sequence of the SRD gene, a polynucleotide can be designed which, when introduced into a plant, forms a molecule that specifically interferes with the expression of the SRD gene. The design takes into account specificity and efficiency of interference. The method for preparing the interfering molecule of the present invention is not particularly limited, and includes, but is not limited to: chemical synthesis, in vitro transcription, and the like. It is understood that, after knowing the association of the SRD gene with a plant trait, one skilled in the art can prepare the interfering molecules in various ways for use in modulating the plant trait. The interfering molecules can be delivered to the plant by transgenic techniques, or can also be delivered to the plant by a variety of techniques known in the art.

As a particularly preferred embodiment of the present invention, there is provided an interfering molecule having an excellent effect of specifically interfering with the expression of an SRD gene; and proved by verification, the gene has good effect of interfering SRD gene expression. The interfering molecule is a molecule containing a nucleotide sequence shown in the 741-1193 site in SEQ ID NO. 1, and forms a hairpin structure.

The invention also provides an interfering molecule comprising the following structure: seq_{Forward direction}Is an SRD gene segment (preferably the nucleotide sequence shown in the 741-1193 position in SEQ ID NO:1), SEQ_{Reverse direction}Is and Seq_{Forward direction}A complementary polynucleotide; x is at Seq_{Forward direction}And Seq_{Reverse direction}A spacer sequence therebetween, and the spacer sequence and Seq_{Forward direction}And Seq_{Reverse direction}Are not complementary.

The interfering molecule, when introduced into a plant, can fold into a stable stem-loop structure, the stem of the stem-loop structure comprising two substantially complementary sequences on either side of the stem. That is, a secondary structure is formed as follows:

wherein the content of the first and second substances,i is expressed in Seq_{Forward direction}And Seq_{Reverse direction}Substantially complementary relationship therebetween. The stem-loop structure can be further acted upon, processed or sheared by various substances in the plant body and forms double-stranded rna (dsrna).

Typically, the interfering molecule is located on an expression vector.

The present invention also includes plants obtainable by any of the methods described above, said plants comprising: transgenic plants into which an SRD gene or a homologous gene thereof has been transferred; or a plant having a reduced expression level (including low expression or no expression) of an SRD polypeptide, and the like.

The methods may be carried out using any suitable conventional means, including reagents, temperature, pressure conditions, and the like.

In addition, the invention also relates to the use of the SRD polypeptide or the gene encoding the SRD polypeptide as a tracking marker for progeny of genetically transformed plants. The invention also relates to the use of the SRD polypeptide or its coding gene as a molecular marker for identifying plant traits by detecting the expression of the SRD polypeptide in plants. The plant characteristics related to the SRD gene can also be used as an indicator mark of a true hybrid in the hybrid seed production process.

The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. The experimental procedures, for which specific conditions are not noted in the following examples, are generally performed according to conventional conditions such as those described in J. SammBruk et al, molecular cloning protocols, third edition, scientific Press, 2002, or according to the manufacturer's recommendations.

Example 1 cloning and sequence analysis of MeSRD

The inventor searches and finds two EST sequences in RIKEN cassava cDNA database (http:// www.brc.riken.jp/inf/en/index. shtml) through Blastp and Blastn, wherein the EST sequences are defined as MeSRD genes of cassava, the full length of the genes is 4230bp, and the EST sequences code for 1410 amino acids.

The MeSRD nucleotide sequence is as follows (SEQ ID NO: 1):

ATGAGTAATAGCATAGGGCATAATTTATTCCAACAGAGTTTGATTCGTCCCGCGAGTTTTAAACATGGAAGCAATCTCAATTCTTCTGGCATTCCTGCAAGCTATTTATTCCAATCTGCCTCTGTGAGTCGAGGACTGCAGATAAGCAGGTCGCCAATATCCTCTAGTTTTTATGGAAAAAATTTGAGGGTGCGGAAATCAAAATTAGCCGTTGTAAATCCTCGTCCAGCTATAACAATTCCACGGGCTATATTGGCGATGGATCCGGCATCCCAGCTCCTAGGAAAATTCAACCTTGATGGAAATGTTGAATTGCAGGTGTTTGTTAGCAGTCACACTTCTGCTTCTACTGTGCAAGTACACATTCAGATAACATGCACTAGTGATTCTTTGCTCCTACACTGGGGTGGGAAACATGATAGAAAGGAAAACTGGGTACTTCCTAGTCGTTATCCAGATGGAACCAAAAATTATAAGAGCAGAGCCCTTAGAAGTCCTTTTGTCAAGTCTGGTTCAAGTTCTTACCTGAAAATAGAGATTGATGATCCTGCAATACAAGCCTTAGAATTTCTTATACTTGATGAAGCGCATAATAAATGGTTTAAAAATAATGGTGACAACTTTCATGTTAAATTACCTGCACGAGAGAAGCTGATAATTCCAAATATCTCAGTTCCTGAAGAGCTTGTACAAGTTCAAGCATATCTGAGGTGGGAAAGAAATGGTAAACAAATGTATACCCCAGAACAAGAAAAGAAAGAA TATGAAGCCGCTCGTATTGAACTATTGGAGGAAGTAGCTAAGGGTACTTCCATTGAGGGCCTCCGAGCAAGGCTGAC AAACAAAAATGAAATTAAGGAGTCATCTGTCTCTAAAACACAAAGCAAGATACACGCTCAAGCTCATAGAAGATGGG AAAAATCTACTACTAGTAATGAAAGGTTTCAGCGCAATCAGAGGGACTTAGCACAGCTTGTTACCAAATCTGCTACT AAAAAATCTGCAGAGGAAGCTGTTTCAGTAGAACCAAAACCAAAAGCATTGAAGGCAGTTGAACTTTTTGCTAAAGA AAAGGAAGAACGGGTTGGGGGTGCTGTTCTGAACAAGAAGATCTTTAAGCTCCAAGATGCGGAACTTCTGGTGCTTG TGACCAAGCCTGCTGATAAGATGAAGGTTTATGTTGCCACTGATTTCAAAGAACCAGTCACTCTTCACTGGGCATTATCTAGGAAGGGTAAAGAGTGGTTGGCGCCACCACCAAGTGTGTTGCCTCCTGGTTCAGTTTCTTTGAACGAGGCTGCTGAAACACAACTTAAAAGCATTTCTTCAACTGAACTTTCTTATCAGGTCCAATACTTTGAAACGGAGATCGAAGAGAATTTTGTAGGGATGCCCTTTGTGCTTTTTTCTAATGAAAAATGGATAAAGAATAAGGGCTCTGACTTTTATGTTGAACTTAGTGGCGGACCTAGGCCAGTCCAAAAGGATGCTGGTGATGGAAGAGGTACAGCAAAAGTTTTATTGGACACAATTGCAGAGCTGGAGAGTGAAGCACAGAAATCCTTCATGCACCGATTTAATATTGCAGCTGATTTGATGGAGGATGCAAAGGATGCTGGTGAGTTGGGTTTTGCAGGGATCTTGGTGTGGATGAGATTTATGGCCACGAGGCAACTTATTTGGAACAAAAACTACAATGTGAAACCACGTGAGATCAGCAAGGCACAGGATAGGCTCACAGACTTGCTCCAGAATACTTATACAAGTCATCCTCAATATCGGGAGCTTTTGCGGATGATTATGTCTACTGTCGGTCGAGGTGGTGAAGGTGATGTGGGGCAGCGAATTCGGGATGAAATTTTAGTTATCCAGAGAAACAATGATTGCAAAGGTGGTATGATGGAGGAATGGCATCAGAAGCTGCATAATAACACAAGCCCTGATGATGTTGTTATCTGCCAGGCATTAATGGATTACATTAAAAGTGACCTTGACATCAGTGTGTACTGGAAAACTTTGAATGAAAATGGAATAACAAAAGAACGACTTTTAAGCTATGATCGTGCAATCCATTCTGAACCAAGCTTCAGGAGAGATCAAAAGGACGGTCTTTTGCGTGATCTCGGCAACTATATGAGAAGTTTGAAGGCAGTTCATTCTGGTGCAGATCTTGAGTCTGCTATTGCAAATTGTATGGGCTATAAAGATGAGGGTCAAGGTTTCATGGTTGGAGTGCAAATAAATCCCATTTCAGGCTTGCCATCTGGATTTCCAGAGTTGCTTCGATTTGTTCTCAAACATGTTGAAGATAGAAATGTAGAAGCACTTCTTGAGGGTTTGCTGGAGGCTCGTCAGGAGCTGAGGCCATTGCTGTTTAAGTCTAATAATCGTCTGAAAGATCTTCTATTTTTGGATATTGCCCTTGATTCTACTGTTAGGACAGCCATTGAGAGAGGATATGAGGAATTAAATGATGCTGGACCAGAGAAAATTATGTATTTCATCACCCTGGTTCTTGAAAATCTTGCGCTTTCATCAGATGATAATGAAGAGTTTGTCTATTGCTTGAAGGGATGGAATTATGCCCTAAGCATGTCCAAAAGTAAAAGCAATCACTGGGCATTATATGCAAAATCAGTCCTTGACAGAACTCGCCTTGCCCTGGCCAGCAAGGCTGAATGGTATCAGCAAGTTTTGCAACCATCAGCAGAGTATCTTGGATCACTGCTTGGAGTGGATCAGTGGGCTGTGAACATATTCACTGAAGAAATAGTTCGTGCTGGATCAGCTGCAGCTGTATCCTTGCTTCTTAATCGACTTGATCCAGTTCTTCGGAAGACTGCTCATCTTGGAAGTTGGCAGGTTATTAGCCCAGTTGAAGCTGCTGGGTATGTTGTTGTTGTGGATGAGTTGCTCACAGTACAGAATTTATCTTACGACCGCCCTACAATTTTAGTGGCAAGAAGAGTAAGTGGAGAAGAAGAAATTCCTGATGGTACAGTTGCTGTGCTGACATCTGACATGCCAGATGTCCTATCCCATGTTTCTGTACGAGCAAGAAATAGCAAGGTTTGCTTTGCCACATGTTTTGATCACAACATTCTGGACAATCTCCGAGCAAATGAAGGGAAATTATTGAATTTGAAACCTACATCAGCAGATATAGTCTATAGCGTGATCGAGGGTGAATTAGCAGATTTAAGTTCAAATAAGCTGAAAGAAGTTGGTCCTTCACCTATAAAGTTGATAAGAAAGCAGTTCAGTGGTAGATATGCCATATCATCGGAGGAGTTCACCGGTGAAATGGTTGGTGCCAAATCACGCAATATCGCGCATCTAAAAGGAAAAGTACCATCCTGGATTGGGATTCCTACATCGGTTGCCTTACCATTTGGAGTTTTTGAGAAGGTTCTTTCAGATGGTTCAAATCAAGAAGTGGCTAAGAAGTTGGAAGTTTTGAAGAAACAGTTGGAAGGAGGAGAGTCTAGTGTCCTCAGGAGAATTCGTGAGACAGTTTTACAGCTGGCAGCACCACCACAGCTGGTGCAAGAGCTGAAGACAAAGATGAAAAGTTCTGGGATGCCTTGGCCTGGCGATGAAGGTGAACAGCGATGGGAGCAAGCATGGATGGCTATAAAGAAGGTCTGGGCTTCAAAATGGAATGAGAGAGCATACTTCAGCACAAGGAAAGTGAAGTTGGACCATGATTACCTCTGCATGGCTGTCCTGGTTCAGGAGATAATAAATGCCGATTATGCATTTGTTATCCACACGACCAATCCATCTTCTGGGGATTCATCAGAGATATATGCTGAGGTAGTGAAGGGACTTGGAGAAACTCTTGTTGGAGCCTATCCCGGCCGTGCTTTGAGTTTTATCTGCAAGAAAAAAGATCTGAATTCTCCTCAGGTGTTGGGTTACCCAAGCAAACCCATTGGCCTTTTTATAAGACGTTCTATAATCTTCAGATCTGACTCCAATGGTGAAGATCTGGAAGGTTATGCTGGTGCTGGTCTTTATGATAGTGTTCCAATGGATGAGGAAGAGAAAGTTGTGCTTGATTACTCATATGATCCATTGATCACCGATGAAAGCTTCCGAAAATCAATTCTCTCTAACATAGCTCGTGCTGGAAGTGCCATTGAAGAGCTCTATGGATCTCCACAAGACATTGAAGGAGTAATAAGGGACGGTAAACTCTATGTGGTTCAGACAAGGCCTCAGATGTAA

the MeSRD amino acid sequence is as follows (SEQ ID NO: 2):

MSNSIGHNLFQQSLIRPASFKHGSNLNSSGIPASYLFQSASVSRGLQISRSPISSSFYGKNLRVRKSKLAVVNPRPAITIPRAILAMDPASQLLGKFNLDGNVELQVFVSSHTSASTVQVHIQITCTSDSLLLHWGGKHDRKENWVLPSRYPDGTKNYKSRALRSPFVKSGSSSYLKIEIDDPAIQALEFLILDEAHNKWFKNNGDNFHVKLPAREKLIIPNISVPEELVQVQAYLRWERNGKQMYTPEQEKKEYEAARIELLEEVAKGTSIEGLRARLTNKNEIKESSVSKTQSKIHAQAHRRWEKSTTSNERFQRNQRDLAQLVTKSATKKSAEEAVSVEPKPKALKAVELFAKEKEERVGGAVLNKKIFKLQDAELLVLVTKPADKMKVYVATDFKEPVTLHWALSRKGKEWLAPPPSVLPPGSVSLNEAAETQLKSISSTELSYQVQYFETEIEENFVGMPFVLFSNEKWIKNKGSDFYVELSGGPRPVQKDAGDGRGTAKVLLDTIAELESEAQKSFMHRFNIAADLMEDAKDAGELGFAGILVWMRFMATRQLIWNKNYNVKPREISKAQDRLTDLLQNTYTSHPQYRELLRMIMSTVGRGGEGDVGQRIRDEILVIQRNNDCKGGMMEEWHQKLHNNTSPDDVVICQALMDYIKSDLDISVYWKTLNENGITKERLLSYDRAIHSEPSFRRDQKDGLLRDLGNYMRSLKAVHSGADLESAIANCMGYKDEGQGFMVGVQINPISGLPSGFPELLRFVLKHVEDRNVEALLEGLLEARQELRPLLFKSNNRLKDLLFLDIALDSTVRTAIERGYEELNDAGPEKIMYFITLVLENLALSSDDNEEFVYCLKGWNYALSMSKSKSNHWALYAKSVLDRTRLALASKAEWYQQVLQPSAEYLGSLLGVDQWAVNIFTEEIVRAGSAAAVSLLLNRLDPVLRKTAHLGSWQVISPVEAAGYVVVVDELLTVQNLSYDRPTILVARRVSGEEEIPDGTVAVLTSDMPDVLSHVSVRARNSKVCFATCFDHNILDNLRANEGKLLNLKPTSADIVYSVIEGELADLSSNKLKEVGPSPIKLIRKQFSGRYAISSEEFTGEMVGAKSRNIAHLKGKVPSWIGIPTSVALPFGVFEKVLSDGSNQEVAKKLEVLKKQLEGGESSVLRRIRETVLQLAAPPQLVQELKTKMKSSGMPWPGDEGEQRWEQAWMAIKKVWASKWNERAYFSTRKVKLDHDYLCMAVLVQEIINADYAFVIHTTNPSSGDSSEIYAEVVKGLGETLVGAYPGRALSFICKKKDLNSPQVLGYPSKPIGLFIRRSIIFRSDSNGEDLEGYAGAGLYDSVPMDEEEKVVLDYSYDPLITDESFRKSILSNIARAGSAIEELYGSPQDIEGVIRDGKLYVVQTRPQM*

example 2 construction of MeSRDRNAi vector and obtaining of transgenic cassava

The present inventors first constructed an RNA interference (RNAi) binary vector specifically inhibiting MeSRD expression by selecting a MeSRD (pdm02348) gene specific fragment (741-1193 bp): pPCaMV35S: SRDRNAi.

Cassava (manihot utilissima) genome is taken as a template, and 5' -AT is takenGGTACCCCCAGAACAAGAAAAGAAAGAA-3 '(SEQ ID NO:3) and 5' -CTATCGATAAATCAGTGGCAACATAAACCT-3' (SEQ ID NO:4) to obtain a gene specific fragment (741-1193bp) of MeSRD (pdm02348), and inserting the forward fragment of the amplified MeSRD (741-1193bp) into the KpnI/ClaI cleavage site of pRNAi-dsAC1 binary vector (see Biotechnology and Bioengineering, Vol.108, No.8, August,2011, 1925-1935); with 5' -ATGGATCCCCCAGAACAAGAAAAGAAAGAA-3 '(SEQ ID NO:5) and 5' -CTCTCGAGAAATCAGTGGCAACATAAACCT-3' (SEQ ID NO:6) as a primer, a gene specific fragment (741-1193bp) of MeSRD (pdm02348) is obtained by amplification, and the amplified reverse repeated fragment of MeSRD (741-1193bp) is inserted into the XhoI/BamHI enzyme cutting site of the pRNAi-dsAC1 binary vector into which the forward fragment is inserted, so as to obtain the RNAi recombinant vector containing the hairpin structure.

The constructed recombinant vector is transferred into agrobacterium LBA4404, cassava brittle suspension callus is infected through agrobacterium, positive plants are obtained from the infected callus through the processes of regeneration, screening and the like, and pPCaMV35S, namely SRDRNAi transgenic cassava is recorded as SRDRNAi, which is abbreviated as G1 i.

Example 3 molecular characterization of MeSRDRNAi transgenic cassava

20 strains of SRDRNAi positive transgenic cassava G1i-1, 5, 12, 16, 17 and the like are obtained in total through agrobacterium-mediated cassava suspension callus transformation, and then single-copy transgenic plants are finally obtained through Southern blot screening, namely eleven strains of G1i-12, 17, 18, 22, 23 and the like are obtained in total.

(1) Identification of Gene expression levels

And (3) culturing wild type and SRDRNAi transgenic cassava under the natural condition of the Shanghai five-library pilot plant field, and culturing to the harvest period. To verify the effect of RNA interference, the present inventors analyzed the expression level of MeSRD in single copy plants by Real-time RT-PCR using 5'-ACCTCTGCATGGCTGTCCTGGTT-3' (SEQ ID NO:7) and 5'-GCACGGCCGGGATAGGCTCC-3' (SEQ ID NO:8) as primers.

The results show that in most of pPCaMV35S, the expression level of MeSRD is obviously reduced in SRDRNAi single-copy transgenic cassava, wherein the reduction of MeSRD is most obvious in G1i-2, 12, 18, 28 and 31, and the expression level of MeSRD is reduced by 90% in G1i-12 transgenic lines compared with wild-type cassava, as shown in FIG. 3.

(2) Protein level expression identification

Although the target gene is strongly inhibited at the expression level, it is further proved whether the target gene is also inhibited at the protein level. The present inventors designed antigenic polypeptides against protein fragments specific for MeSRD and succeeded in obtaining rabbit-derived polyclonal antibodies to cassava MeSRD.

And (3) culturing the wild type and the SRDRNAi transgenic cassava under the natural condition of the Shanghai five-library pilot plant field, and culturing to the harvest period. Three leaves with the same size of wild cassava and MeSRD gene expression obviously reduced (G1i-12, G1i-17 and G1i-28) are harvested, and after total protein is extracted, the protein amount of MeSRD is further detected by Western blot. Rubisco is taken as a protein loading internal reference, and wild cassava TMS60444 is taken as a control (WT); the protein extraction material is mature leaf of greenhouse cassava plant.

The results show that there is a target band of MeSRD in the wild type, with a size of about 140kD, consistent with the predicted MeSRD size; the transgenic plants G1i-12, 17 and 18 do not have target bands of MeSRD, which shows that the inventor successfully reduces the protein amount of the target gene by means of RNAi, and the expression level of the target gene is reduced, as shown in FIG. 4.

The above results indicate that the MeSRDRNAi transgenic cassava with the MeSRD expression effectively interfered is successfully obtained.

Example 4 Effect of MeSRD on storage starch phosphorylation in storage root

And (3) culturing the wild type and the SRDRNAi transgenic cassava under the natural condition of the Shanghai five-library pilot plant field, and culturing to the harvest period. Extracting starch from wild type and SRDRNAi transgenic cassava mature storage root, and analyzing the content of glucose-6-phosphate in hydrolysate by HPAEC-PAD after acidolysis.

The results show that storage starch has a high degree of phosphorylation, about 56ng/mg starch, in storage roots of wild-type cassava; in SRDRNAi transgenic plants, the phosphorylation degree of starch is also obviously reduced, and is about 2-5ng/mg starch; as shown in fig. 6.

Moreover, the HPAEC-PAD pattern showed that significant elution peaks of G-6-P and G-3-P could be observed in the wild-type cassava storage root starch hydrolysate, while the elution peak of G-6-P was significantly reduced and no elution peak of G-3-P was detected in the storage root storage starch hydrolysate of transgenic plants, as shown in FIG. 5.

Example 5 Regulation of the development of cassava storage roots and yield formation by MeSRD

In the field, growth, development and yield traits of wild-type cassava and SRDRNAi transgenic cassava were observed.

Harvesting seed stems of SRDRNAi transgenic cassava from a third-generation seed bank in mid-April, ridging in a test field in the fifth summer, wherein the ridge height is 50cm, the ridge distance is 100cm, the seed stems are planted on ridges in a cuttage mode, then mulching films are laid, watering is averagely performed every week in the first three months, soil is kept moist, watering is performed for about 20 days after three months, soil is kept not dry, and compound fertilizers are applied for one time in the fifth month until harvesting.

As shown in fig. 7A, it is found that in the field environment, wild cassava grows well, a large number of green leaves are still left during harvesting, the leaves do not separate obviously, while SRDRNAi transgenic cassava grows weakly, and most of the leaves at the lower part of the stem turn yellow and fall off. After 6 months of planting, most of the wild cassava storage roots develop mature and have fewer fibrous roots, while the transgenic cassava storage roots are thinner and still have a large number of fibrous roots, namely the transgenic cassava storage roots develop slowly.

As shown in FIGS. 7B-D, the transgenic cassava had significantly reduced storage root weight, diameter, and number, and yield formation was inhibited, relative to wild type.

As shown in fig. 7E, there was a significant reduction in plant height of the transgenic cassava relative to the wild type.

The above results suggest that the expression of MeSRD is down-regulated, inhibiting the degradation of temporary starch in the leaves, and further the carbon distribution of the photosynthesis products from the leaves to the underground part is hindered, so that the cassava storage roots develop late due to lack of growth raw materials.

All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.

Claims

1. A method of delaying the initial development and progression of development of storage roots and/or reducing the weight, diameter or number of storage roots in a potato plant comprising: reducing expression of an SRD polypeptide in a potato plant.

2. The method of claim 1, wherein the potato plant comprises: cassava, sweet potato, yam, taro, kudzu root, konjak, jerusalem artichoke and yacon.

3. The method of claim 1, wherein said SRD polypeptide is a polypeptide having an amino acid sequence as set forth in SEQ ID No. 2.

4. The method of claim 1, wherein said reducing expression of an SRD polypeptide in a plant comprises: transferring an interfering molecule that interferes with the expression of the SRD polypeptide into the plant, thereby down-regulating the expression of the SRD polypeptide in the plant.

5. The method of claim 4, wherein the interfering molecule that interferes with the expression of the SRD polypeptide targets position 741-1193 or a transcript thereof of a gene encoding the SRD polypeptide.

6. The method of claim 4, wherein the interfering molecule comprises a structure of formula (I):

Seq_{forward direction}-X-Seq_{Reverse direction}A compound of the formula (I),

in the formula (I), the compound is shown in the specification,

Seq_{forward direction}A fragment of a gene encoding an SRD polypeptide, Seq_{Reverse direction}Is and Seq_{Forward direction}A complementary polynucleotide;

7. The method of claim 6, wherein Seq_{Forward direction}Is the 741-1193 position of the gene encoding the SRD polypeptide.

8. The method of claim 1, further comprising the subsequent steps of: selecting from the plants after modulating expression of the SRD polypeptide a plant that has acquired an altered trait as compared to the plant prior to modulation.

9. Use of a substance which modulates the expression of an SRD polypeptide or gene encoding it, for reducing the extent of starch phosphorylation in storage roots of a potato plant, delaying the initial development and progress of storage roots and/or reducing storage root weight, diameter or number; the substance that regulates the expression of an SRD polypeptide or a gene encoding the SRD polypeptide is an interfering molecule that interferes with the expression of the SRD polypeptide.

10. The use according to claim 9, wherein the substance which interferes with the expression of the SRD polypeptide or gene encoding it comprises a structure according to formula (I):

Seq_{forward direction}-X-Seq_{Reverse direction}A compound of the formula (I),

in the formula (I), the compound is shown in the specification,

11. The use according to claim 10 wherein the interfering molecule which interferes with the expression of the SRD polypeptide is targeted to position 741-1193 or a transcript thereof of a gene encoding the SRD polypeptide.

12. Use according to claim 9 or 10, wherein the potato plant comprises: cassava, sweet potato, yam, taro, kudzu root, konjak, jerusalem artichoke and yacon.

13. Use of an SRD polypeptide or a gene encoding the same as a molecular marker for identifying storage root traits in potato plants; the identification of the storage root characters of the potato plants comprises the following steps:

identifying the thickness of the potato plant storage root;

identifying the number of storage roots of the potato plants; and/or

Identifying the storage root weight, diameter or number of the potato plants.