CN108949804B - Method for improving resistant starch content of potato tuber roots and application - Google Patents
Method for improving resistant starch content of potato tuber roots and application Download PDFInfo
- Publication number
- CN108949804B CN108949804B CN201710373004.8A CN201710373004A CN108949804B CN 108949804 B CN108949804 B CN 108949804B CN 201710373004 A CN201710373004 A CN 201710373004A CN 108949804 B CN108949804 B CN 108949804B
- Authority
- CN
- China
- Prior art keywords
- starch
- storage
- resistant starch
- resistant
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biotechnology (AREA)
- Wood Science & Technology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Botany (AREA)
- Biomedical Technology (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Immunology (AREA)
- Cell Biology (AREA)
- Plant Pathology (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Mycology (AREA)
Abstract
The invention relates to a method for improving the resistant starch content of potato tuber roots and application thereof. The invention obviously regulates the resistant starch character of the potato plant and other starch-related characters by changing the expression of a resistant starch-related gene in the potato plant, and has good application prospect in genetic improvement of plant quality.
Description
Technical Field
The invention belongs to the fields of biotechnology and botany, and particularly relates to a method for improving the content of resistant starch in potato tuber roots and application of the method.
Background
The potato plants are mainly terrestrial crops having edible root tubers or subterranean stems. The method comprises the following steps of carrying out multi-row asexual propagation on tuberous roots and tubers, such as sweet potatoes (sweet potatoes and sweet potatoes), cassava, potatoes, yams (Chinese yams), and rhizoma podocarpi, wherein only the potato blocks are left for seeds and can be propagated by using lianas. The plants are generally weak in cold resistance, are usually cultivated in frostless seasons, and can inhibit the growth of the potato crops at low temperature to cause the yield reduction of root tubers or tubers, so that the long-time low-temperature period is avoided as much as possible when the potato crops are planted; in addition, loose, fertile and deep soil and a large amount of potash fertilizer are beneficial to improving the yield and the quality of potato crops.
Englyst et al group starch into three categories according to how fast the human body digests it to release glucose: (1) rapidly Digestible Starch (RDS) refers to starch which can be rapidly digested and absorbed in small intestine of human body, and can be completely digested within 20 min; (2) slowly digestible starch (SRS) refers to starch which can be completely digested and absorbed in the small intestine of a human body but has a low speed, and is digested within a period of 20-120 min; (3) resistant Starch (RS) is indigestible and absorbable in the small intestine of the human body and excreted to the large intestine, and is like dietary fiber and can be fermented and utilized by microorganisms in the large intestine. The main factors affecting the digestibility and physiological response of starch are the starch source, the granule structure, the crystalline nature, the ratio of amylose to amylopectin and other components bound to starch such as proteins, lipids etc.
The starch is digested, absorbed and enters blood slowly in vivo compared with other starch, and has functional characteristics similar to dietary fiber. However, the resistant starch itself is still starch, which is chemically different from the fiber. As a novel functional additive, the resistant starch has important effect on human health, can reduce the reaction of blood sugar and insulin, and is suitable for obese patients and diabetic patients. Animal experiments show that the resistant starch also has the effects of reducing serum cholesterol and preventing and treating cardiovascular diseases. In addition, resistant starches also have better processing characteristics than traditional dietary fibers, particularly in terms of overrun, viscosity, gelling power, water retention, and the like. As a novel dietary fiber, the resistant starch has the physiological function similar to that of the traditional dietary fiber, and the capability of producing short-chain fatty acid, especially butyric acid, in the large intestine is far higher than that of the common dietary fiber through microbial fermentation. Moreover, the addition of resistant starch to food products does not affect the flavor, texture and appearance of the food product and, in many applications, can even enhance the flavor of the final product. Therefore, RS is already used as a health-care nutrient component to be applied to common foods such as bread, breakfast cereal, noodles and the like and special foods such as diet foods and the like.
As a starch-rich plant, the potato plant needs to be researched and changed in starch quality to obtain a better variety, such as a variety with high resistant starch content.
Disclosure of Invention
The invention aims to provide a method for improving the content of resistant starch in potato tuber roots and application.
In a first aspect of the invention, there is provided a method of increasing the resistant starch content or altering starch-related traits in the root tubers of potato plants, comprising: down-regulating the expression or activity of resistant starch-related polypeptides in a potato plant;
wherein the resistant starch-related polypeptides are selected from the group consisting of:
(a) 2 amino acid sequence of a polypeptide as set forth in SEQ ID NO;
(b) a polypeptide derived from (a) wherein the amino acid sequence of SEQ ID NO:2 is substituted, deleted or added with one or more (e.g., 1 to 20; preferably 1 to 10; more preferably 1 to 5) amino acid residues, and which has the function of the polypeptide of (a); or
(c) A polypeptide derived from (a) and having more than 85% (preferably more than 90%, more preferably more than 95%, such as more than 98%, more than 99%) homology with the polypeptide sequence defined in (a) and having the function of the polypeptide of (a).
In a preferred embodiment, the potato plant is a plant having a resistant starch-related polypeptide or a homologous protein thereof.
In another preferred embodiment, the potato plants include (but are not limited to): cassava, sweet potato, yam, taro, kudzu root, konjak, jerusalem artichoke and yacon.
In another preferred embodiment, said reducing the expression of resistant starch-related polypeptides in plants comprises: transferring into a plant an interfering molecule that interferes with the expression of the resistant starch-related polypeptide.
In another preferred embodiment, the interfering molecule is a dsRNA, antisense nucleic acid, small interfering RNA, microrna, or a construct capable of expressing or forming said dsRNA, antisense nucleic acid, small interfering RNA, microrna, or a gene encoding a resistant starch-related polypeptide or a transcript thereof as a target for inhibition or silencing.
In another preferred embodiment, the interfering molecule that interferes with the expression of said resistant starch-related polypeptide targets the gene encoding the resistant starch-related polypeptide or a transcript thereof; preferably, 548 th-channel 741 of the coding gene or the transcript thereof is targeted.
In another preferred embodiment, the interfering molecule comprises a structure of formula (I):
Seqforward direction-X-SeqReverse directionA compound of the formula (I),
in the formula (I), the compound is shown in the specification,
Seqforward directionA fragment of the gene coding for the resistant starch-related polypeptide, SeqReverse directionIs and SeqForward directionA complementary polynucleotide;
x is at SeqForward directionAnd SeqReverse directionA spacer sequence therebetween, and the spacer sequence and SeqForward directionAnd SeqReverse directionAre not complementary.
In another preferred embodiment, said SeqForward direction548-th 741 of a coding gene of resistant starch related polypeptide.
In another preferred example, the method further comprises the subsequent steps of: selecting from the plants having down-regulated expression of the resistant starch-related polypeptide a plant having an increased content of resistant starch or an altered starch-related trait as compared to the wild type plant.
In another preferred embodiment, said modified starch-related trait is selected from the group consisting of:
(1) increasing the amylose content of the storage starch;
(2) regulating the chain length distribution of amylopectin in the storage starch; preferably, the following steps are carried out: the proportion of short chains (DP6-9) is increased, and the proportion of medium chains (DP10-18) is decreased; the proportion of medium-long chains (DP19-33) is increased, about 0.19%; a reduced proportion of long chains (DP > 33);
(3) adjusting the starch paste viscosity properties of the storage starch; preferably, the following steps are carried out: reducing peak viscosity, hot tack and cold tack;
(4) adjusting the thermodynamic properties of storage starch; preferably, the following steps are carried out: the storage type starch To, Tp, Tc and delta H are reduced;
(5) adjusting the starch structure of the storage starch; preferably, the following steps are carried out: the crystal structure is changed to B type.
In another aspect of the invention, there is provided the use of a substance which down-regulates the expression of a resistant starch-related polypeptide for increasing the resistant starch content or altering starch-related traits in tuberous roots of a potato plant.
In a preferred embodiment, said modified starch-related trait is selected from the group consisting of:
(1) increasing the amylose content of the storage starch;
(2) regulating the chain length distribution of amylopectin in the storage starch; preferably, the following steps are carried out: the proportion of short chains (DP6-9) is increased, and the proportion of medium chains (DP10-18) is decreased; the proportion of medium-long chains (DP19-33) is increased, about 0.19%; a reduced proportion of long chains (DP > 33);
(3) adjusting the starch paste viscosity properties of the storage starch; preferably, the following steps are carried out: reducing peak viscosity, hot tack and cold tack;
(4) adjusting the thermodynamic properties of storage starch; preferably, the following steps are carried out: the storage type starch To, Tp, Tc and delta H are reduced;
(5) adjusting the starch structure of the storage starch; preferably, the following steps are carried out: the crystal structure is changed to B type.
In another preferred embodiment, the potato plant comprises: cassava, sweet potato, yam, taro, kudzu root, konjak, jerusalem artichoke, yacon and the like.
In another aspect of the present invention, there is provided an interfering molecule which down-regulates the expression of a resistant starch-related polypeptide, thereby increasing the resistant starch content or altering starch-related traits in the tuberous roots of a potato plant, comprising the structure of formula (I):
Seqforward direction-X-SeqReverse directionA compound of the formula (I),
in the formula (I), the compound is shown in the specification,
Seqforward directionA gene fragment encoding a resistant starch-related polypeptide, SeqReverse directionIs and SeqForward directionA complementary polynucleotide;
x is at SeqForward directionAnd SeqReverse directionA spacer sequence therebetween, and the spacer sequence and SeqForward directionAnd SeqReverse directionAre not complementary.
In a preferred embodiment, said SeqForward direction548-th 741 of a coding gene of resistant starch related polypeptide.
In another aspect of the invention, there is provided a vector comprising an interfering molecule as hereinbefore described.
In another aspect of the invention, there is provided a use of a resistant starch-related polypeptide or a gene encoding the same as a molecular marker for identifying resistant starch constitution or starch-related traits in potato plants.
Other aspects of the invention will be apparent to those skilled in the art in view of the disclosure herein.
Drawings
FIG. 1 is a schematic diagram of an RNAi binary expression vector containing a hairpin structure.
FIG. 2 shows the result of Southern Blot identification of transgenic plants.
FIG. 3, SS 2-change of expression level of cassava starch synthesis related gene in RNAi transgenic plant.
FIG. 4 shows Western blot analysis results of protein expression of cassava starch synthesis related genes in transgenic plants. Taking Actin as a protein loading quantity internal reference, and taking wild cassava TMS60444 as a reference; the protein extraction material is mature root tuber material of Tapioca esculenta plant.
Figure 5 resistant starch content in wild type and transgenic cassava tubers. Data shown in the figure are three replicates. Marked t-test differences (p <0.05) and marked t-test differences (p < 0.01).
Figure 6 amylose content of starch in wild-type and transgenic cassava tubers. Data shown in the figure are three replicates. Marked t-test differences (p <0.05) and marked t-test differences (p < 0.01).
FIG. 7, chain length distributions of wild-type and transgenic tapioca root storage-type starches.
A: chain length distribution of wild type tuberous root storage starch;
B-D: the difference of the length distribution of the transgenic plants SSC-2, 6 and 7 root tuber storage starch and the wild type root tuber storage starch is shown respectively. The data above are triplicate experiments.
FIG. 8, results of analyzing the viscosity characteristics of starch using a Rapid viscometer Rapid Visco Analyzer (RVA-4series, Newport Scientific, Australia).
Fig. 9, XRD diffraction patterns of wild-type and transgenic tapioca root-storing starches.
Detailed Description
Through intensive research, the inventor finds that the expression of a resistant starch related gene in a potato plant can be changed, so that the resistant starch character and other starch related characters of the potato plant can be obviously regulated, and the potato plant has a good application prospect in genetic improvement of plant quality.
As used herein, "potato plant" of the present invention, also referred to as "potato crop," refers primarily to a type of terrestrial crop having edible root tubers or subterranean stems. Including but not limited to: root tuber plants of Euphorbiaceae such as Manihot esculenta, root tuber plants of Convolvulaceae such as Ipomoea batatas, tuber plants of Solanaceae such as Solanum tuberosum, root tuber plants of Dioscoreaceae such as Dioscorea opposita, tuber plants of Araceae such as taro and Amorphophallus konjac, root tuber plants of Leguminosae such as Pueraria lobata, tuber plants of Compositae such as Jerusalem artichoke and yacon.
In the present invention, the term "resistant starch-related polypeptide" refers to a polypeptide having the sequence of SEQ ID NO. 2 having the activity of a resistant starch-related polypeptide.
The invention also includes fragments, derivatives and analogues of the resistant starch-related polypeptides. As used herein, the terms "fragment," "derivative," and "analog" refer to a polypeptide that retains substantially the same biological function or activity as the resistant starch-related polypeptide of the present invention. A polypeptide fragment, derivative or analog of the present invention may be (i) a polypeptide having one or more amino acid residues which are conserved or not (preferably conserved amino acid residues) substituted, and such substituted amino acid residues may or may not be encoded by the genetic code, or (ii) a polypeptide having a substituent group in one or more amino acid residues, or (iii) a polypeptide having an additional amino acid sequence fused to the sequence of the polypeptide (e.g., a leader or secretory sequence or a sequence used to purify the polypeptide or a proprotein sequence, or a fusion protein). Such fragments, derivatives and analogs are within the purview of those skilled in the art in view of the definitions herein.
Any biologically active fragment of a resistant starch-related polypeptide may be used in the present invention. As used herein, a biologically active fragment of a resistant starch-related polypeptide is meant to be a polypeptide that still retains all or part of the function of the full-length resistant starch-related polypeptide. Typically, the biologically active fragment retains at least 50% of the activity of the full-length resistant starch-related polypeptide. More preferably, the active fragment is capable of retaining 60%, 70%, 80%, 90%, 95%, 99%, or 100% of the activity of the full-length resistant starch-related polypeptide.
The term "resistant starch-related polypeptide" also includes variants of the sequence of SEQ ID NO. 2 that have the same function as the resistant starch-related polypeptide. These variants include (but are not limited to): deletion, insertion and/or substitution of several (usually 1 to 50, preferably 1 to 30, more preferably 1 to 20, most preferably 1 to 10, still more preferably 1 to 8, 1 to 5) amino acids, and addition or deletion of one or several (usually up to 20, preferably up to 10, more preferably up to 5) amino acids at the C-terminus and/or N-terminus. For example, in the art, substitutions with amino acids of similar or similar properties will not generally alter the function of the protein. Also, for example, addition or deletion of one or several amino acids at the C-terminus and/or N-terminus does not generally alter the function of the protein. The term also includes active fragments and active derivatives of the resistant starch-related polypeptides.
Any protein having high homology (e.g., 70% or more homology to the sequence shown in SEQ ID NO: 2; preferably 80% or more homology; more preferably 90% or more homology, e.g., 95%, 98% or 99% homology) to the resistant starch-related polypeptide and having the same function as the resistant starch-related polypeptide is also included in the present invention.
It is to be understood that while the resistant starch-related polypeptides of the invention are preferably obtained from tapioca, other polypeptides obtained from other plants that are highly homologous (e.g., have more than 80%, more than 90%, more than 95%, or even more than 98% sequence identity) to tapioca resistant starch-related polypeptides are also within the contemplated scope of the invention. Methods and means for aligning sequence identity are also well known in the art, for example BLAST.
The present invention also relates to polynucleotide sequences encoding the resistant starch-related polypeptides of the present invention or conservative variant polypeptides thereof. The polynucleotide may be in the form of DNA or RNA. The form of DNA includes cDNA, genomic DNA or artificially synthesized DNA. The DNA may be single-stranded or double-stranded. The DNA may be the coding strand or the non-coding strand. The sequence of the coding region encoding the mature polypeptide may be identical to the sequence of the coding region shown in SEQ ID NO. 1 or may be a degenerate variant. As used herein, "degenerate variant" refers in the present invention to nucleic acid sequences which encode a protein having SEQ ID NO. 2, but differ from the sequence of the coding region shown in SEQ ID NO. 1.
The polynucleotide encoding the mature polypeptide of SEQ ID NO. 2 comprises: a coding sequence encoding only the mature polypeptide; the coding sequence for the mature polypeptide and various additional coding sequences; the coding sequence (and optionally additional coding sequences) as well as non-coding sequences for the mature polypeptide.
The term "polynucleotide encoding a polypeptide" may be a polynucleotide comprising a sequence encoding the polypeptide, or may be a polynucleotide further comprising additional coding and/or non-coding sequences.
The present invention also relates to polynucleotides which hybridize to the sequences described above and which have at least 50%, preferably at least 70%, and more preferably at least 80% identity between the two sequences.
Based on the new findings of the present inventors, the present invention also provides a method for modifying a potato plant, which method comprises inhibiting the expression or activity of an resistant starch-related polypeptide in said potato plant.
Various methods well known to those skilled in the art can be used to reduce or delete the expression of the resistant starch-related polypeptide, such as delivering an expression unit (e.g., an expression vector or virus, etc.) carrying an antisense gene to a target such that the cell or plant tissue does not express or reduce the expression of the resistant starch-related polypeptide; alternatively, the expression of resistant starch-related polypeptides is reduced by means of gene knock-out.
As an embodiment of the present invention, there is provided a method of reducing the expression of an resistant starch-related polypeptide in a plant, said method comprising:
(1) transferring an interference molecule interfering with the expression of a coding gene of the resistant starch related polypeptide into a plant tissue, organ or seed to obtain the plant tissue, organ or seed transformed with the interference molecule; and
(2) regenerating the plant tissue, organ or seed obtained in step (1) into which the interfering molecule has been transferred into a plant.
As a preferred example, the method comprises the steps of:
(i) providing an agrobacterium carrying a vector interfering with gene expression, said vector being selected from the group consisting of:
(a) a vector comprising a gene or gene fragment (antisense molecule) encoding a counter-acting resistant starch-related polypeptide;
(b) a vector comprising an interfering molecule capable of forming a moiety within a plant that specifically interferes with the expression (or transcription) of a gene encoding a resistant starch-related polypeptide;
(ii) (ii) contacting a tissue or organ of the plant with the Agrobacterium of step (i) thereby transferring the vector into the plant tissue or organ.
Preferably, the method further comprises:
(iii) selecting a plant tissue or organ into which said vector has been transferred; and
(iv) (iv) regenerating the plant tissue or organ of step (iii) into a plant.
Based on the nucleotide sequence of the resistant starch related gene, a polynucleotide can be designed which, when introduced into a plant, forms a molecule that specifically interferes with the expression of the resistant starch related gene. The design takes into account specificity and efficiency of interference. The method for preparing the interfering molecule of the present invention is not particularly limited, and includes, but is not limited to: chemical synthesis, in vitro transcription, and the like. It is understood that the interfering molecules described herein can be prepared in various ways for modulating plant traits by those skilled in the art, knowing the correlation of resistant starch-related genes with plant resistant starch traits. The interfering molecules can be delivered to the plant by transgenic techniques, or can also be delivered to the plant by a variety of techniques known in the art.
As a particularly preferred embodiment of the present invention, there is provided an interfering molecule having an excellent effect of specifically interfering with the expression of a resistant starch-related gene; and the verification proves that the gene has good effect of interfering the expression of the resistant starch related gene. The interference molecule is a molecule containing a nucleotide sequence shown in 548-th and 741-th positions in SEQ ID NO. 1, and forms a hairpin structure.
The invention also provides an interfering molecule comprising the following structure: seqForward directionFor resistant starch-related gene fragments, SeqReverse directionIs and SeqForward directionA complementary polynucleotide; x is at SeqForward directionAnd SeqReverse directionAnd the spacer sequence andSeqforward directionAnd SeqReverse directionAre not complementary.
The interfering molecule, when introduced into a plant, can fold into a stable stem-loop structure, the stem of the stem-loop structure comprising two substantially complementary sequences on either side of the stem. That is, a secondary structure is formed as follows:
wherein, | | is expressed in SeqForward directionAnd SeqReverse directionSubstantially complementary relationship therebetween. The stem-loop structure can be further acted upon, processed or sheared by various substances in the plant body and forms double-stranded rna (dsrna).
Typically, the interfering molecule is located on an expression vector, and thus, expression vectors containing the interfering molecule are also encompassed by the present invention.
As an alternative of the invention, the expression of a resistant starch-related polypeptide in a plant is down-regulated by knocking out the gene encoding the resistant starch-related polypeptide. Preferably, the CRISPR/Cas9 system is adopted for gene editing, so that the resistant starch related gene is knocked out; since a suitable sgRNA target site can provide higher gene editing efficiency, it is important to design and find a suitable target site before gene editing is performed. After designing a specific target site, in vitro cell activity screening is also required to obtain an effective target site for subsequent experiments. Alternatively, the resistant starch related gene can be knocked out by using a traditional homologous recombination method.
The present invention also includes plants obtainable by any of the methods described above, said plants comprising: transgenic plants into which resistant starch-related genes or homologous genes thereof have been transferred; or a plant in which the expression level (including low expression or no expression) of the resistant starch-related polypeptide is reduced.
The methods may be carried out using any suitable conventional means, including reagents, temperature, pressure conditions, and the like.
In addition, the invention also relates to a tracking marker for the progeny of the transformed plant by using the resistant starch related polypeptide or the coding gene thereof as a gene. The invention also relates to a method for identifying the plant character by detecting the expression of the resistant starch related polypeptide in the plant by using the resistant starch related polypeptide or the coding gene thereof as a molecular marker. The plant characteristics related to the resistant starch related gene can also be used as an indicator of true hybrids in the hybrid seed production process.
The method can prepare the potato plants with improved resistant starch content and amylose content, thereby realizing a process for extracting a large amount of resistant starch from the potato plants.
The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. The experimental procedures, for which specific conditions are not noted in the following examples, are generally performed according to conventional conditions such as those described in J. SammBruk et al, molecular cloning protocols, third edition, scientific Press, 2002, or according to the manufacturer's recommendations.
Example 1 cloning and sequence analysis of resistant starch-related genes
The Open Reading Frame (ORF) of the resistant starch related gene obtained by experimental cloning is 2256bp, which is different from the published sequence in GenBank by one nucleotide, the corresponding coded amino acid is completely consistent, the difference of individual nucleotides is due to different sources of cassava varieties of gene cloning, the sequence published in GenBank is from Kasetsearch University 50(KU50), and the gene cloned in the experiment is from TMS 60444.
According to preliminary functional verification, the inventor defines the gene as a resistant starch related gene, the whole length of which is 2256bp and codes for a polypeptide of 751 amino acids (called resistant starch related polypeptide).
Resistant starch related gene sequence (SEQ ID NO: 1):
ATGGCATTTATAGGATCACTTCCTTTTATTATCCAAACCAAAGCAGAAAGTTCTGTCCTTCTCCATGACAAAAACCTACAGCGATCCAGATTCTCCGTTTTCCCATGTAGATCACAAAACTCTTTTAATTTAGCCGTTTCGTTATCTTTGAGTTTTAAGCCTGTAAGAGCTACAGGTAAGGAAGGCGTTAGTGGTGATGGGTCAGAGGATACACTTCAAGCCACCATCGAGAAAAGCAAGAAAGTTCTCGCCTTGCAAAGGGACCTACTTCAGAAGATTGCTGAAAGAAGGAAATTGGTTTCTTCTATACAAAGTAGTGTTGGTGACCACGACACAAACAAAACTTCTCATGAACAGAGGGAAAACTCTTTGCCAAATTCAGATAATACTTCAACTAGTGATGTGAATATGCACCAACAGCAAAATGGCCCAGTTCTTCCGAGTAGCTATGTCCATTCAACTGCAGATGAGGTATCAGAAACTGCATCTTCAGCTATTAATAGAGGTCATGCTAAAGATGATAAGGAACTTGAACAACATGCATCTCCTAGAACAGCCTTTGTTAAGAATTCTACCAAACAGTTTAAAGAGATGGATTCTGAGAAACTACAGACAGATGAGATACCATCTTTTCTTTCAAACACCACAGATATTTCCACTATAAATGAAGAAAATAGTGAACATTCAAATGAATCAACCTCACCTATGGTTGACATTTTTGAAAGTGATTCTATGACTGAAGACATGAAGCCACCTCCTTTGGCTGGGGACAATGTCATGAATGTTATTTTGGTAGCTGCAGAATGTGCTCCATGGTCCAAAACAGGTGGCCTTGGTGATGTCGCTGGATCTTTACCAAAGGCTTTGGCTCGGCGTGGACATCGGGTTATGGTTGTGGCACCGCGATATGGCAACTATGTTGAACCTCAGGATACTGGAGTCCGAAAGAGGTATAAGGTGGATGGTCAGGATTTTGAAGTATCATACTTCCAAGCCTTCATTGATGGGGTTGATTTTGTATTCATTGACAGTCCTATGTTTCGCCACATAGGGAATGATATATATGGAGGAAACAGAATGGATATATTAAAGAGGATGGTATTATTTTGCAAAGCTGCTGTTGAGGTTCCTTGGCATGTCCCATGTGGTGGAGTCTGCTATGGGGATGGAAATTTGGCTTTCATTGCAAATGATTGGCATACAGCATTGTTGCCAGTGTATCTGAAGGCATATTATCGGGATAATGGTTTAATGCAATATACAAGATCTGTTCTTGTAATTCATAACATAGCTCACCAGGGTCGGGGTCCAGTGGATGATTTCTCTTACGTGGGTCTACCAGAACATTACATTGATCTCTTCAAACTGCATGATCCGATTGGTGGTGACCACTTCAATATCTTTGCAGCTGGTCTTAAGGTGGCAGATCGTGTGGTTACTGTTAGTCATGGATACGCCTGGGAGCTTAAAACATCTGAAGGTGGTTGGGGTCTGCACAATATCATAAATGAGAACGACTGGAAATTGCAGGGCATTGTTAATGGGATTGATGCCAAAGAATGGAATCCACAGTTTGATATTCAACTGACATCAGATGGTTATACTAACTATTCCCTGGAAACACTTGATACTGGCAAGCCTCAGTGCAAGGCAGCCTTACAGAAGGAGCTCGGTTTGCCCATCCGTCCAGATGTCCCTGTTATTGGGTTCATTGGAAGGTTGGATTATCAGAAAGGTGTCGATCTCATAGCTGAGGCAATTCCCTGGATGGTGGGTCAGGATGTGCAACTAGTAATGTTGGGTACTGGCAGACAAGACTTGGAAGAGATGCTTAGACAATTTGAAAACCAACATAGAGATAAAGTGAGGGGATGGGTTGGTTTTTCTGTGAAGACAGCTCACAGGATAACTGCTGGTGCAGATATTTTGCTCATGCCATCAAGATTTGAACCATGTGGGCTAAACCAGTTATATGCTATGATGTACGGGACGATTCCTGTAGTACACGCTGTGGGTGGACTAAGGGACACGGTGCAACCTTTCGATCCATTTAATGAGTCGGGGCTTGGGTGGACATTTGATAGCGCTGAATCACATAAACTGATACATGCATTAGGCAATTGCTTGCTCACTTACCGAGAGTACAAGAAGAGCTGGGAAGGACTGCAGAGAAGAGGGATGACTCAAAACCTCAGCTGGGACCATGCTGCTGAGAAATATGAGGAGACTCTTGTTGCAGCCAAGTACCAGTGGTGA
resistant starch-related polypeptide sequence (SEQ ID NO: 2):
MAFIGSLPFIIQTKAESSVLLHDKNLQRSRFSVFPCRSQNSFNLAVSLSLSFKPVRATGKEGVSGDGSEDTLQATIEKSKKVLALQRDLLQKIAERRKLVSSIQSSVGDHDTNKTSHEQRENSLPNSDNTSTSDVNMHQQQNGPVLPSSYVHSTADEVSETASSAINRGHAKDDKELEQHASPRTAFVKNSTKQFKEMDSEKLQTDEIPSFLSNTTDISTINEENSEHSNESTSPMVDIFESDSMTEDMKPPPLAGDNVMNVILVAAECAPWSKTGGLGDVAGSLPKALARRGHRVMVVAPRYGNYVEPQDTGVRKRYKVDGQDFEVSYFQAFIDGVDFVFIDSPMFRHIGNDIYGGNRMDILKRMVLFCKAAVEVPWHVPCGGVCYGDGNLAFIANDWHTALLPVYLKAYYRDNGLMQYTRSVLVIHNIAHQGRGPVDDFSYVGLPEHYIDLFKLHDPIGGDHFNIFAAGLKVADRVVTVSHGYAWELKTSEGGWGLHNIINENDWKLQGIVNGIDAKEWNPQFDIQLTSDGYTNYSLETLDTGKPQCKAALQKELGLPIRPDVPVIGFIGRLDYQKGVDLIAEAIPWMVGQDVQLVMLGTGRQDLEEMLRQFENQHRDKVRGWVGFSVKTAHRITAGADILLMPSRFEPCGLNQLYAMMYGTIPVVHAVGGLRDTVQPFDPFNESGLGWTFDSAESHKLIHALGNCLLTYREYKKSWEGLQRRGMTQNLSWDHAAEKYEETLVAAKYQW
example 2 construction of resistant starch related Gene RNAi vector and obtaining of transgenic cassava
The inventor firstly constructs an RNA interference (RNAi) binary vector for specifically inhibiting the expression of a resistant starch related gene (SS2) by selecting a gene specific fragment (SSS2, 548-741bp) of the resistant starch related gene (Manes.02G046900): pPCaMV35S: SS2 RNAi. A schematic of this binary vector is shown in figure 1, where forward SSS2 forms a hairpin structure with reverse SSS2 and Intron for the formation of RNAi effective molecules within cells.
Transferring the constructed vector into agrobacterium LBA4404, infecting cassava brittle suspension callus by agrobacterium, obtaining a positive plant by the infected callus through regeneration, screening and other processes, and recording SS2RNAi transgenic cassava as SS2RNAi, abbreviated as SSC, in the pPCaMV 35S.
Example 3 molecular characterization of resistant starch-related genes RNAi transgenic cassava
The total pPCaMV35S is obtained by agrobacterium-mediated cassava suspension callus transformation, namely, 20 strains of SSS 2RNAi positive transgenic cassava SSC-2, 6, 7, 10, 13 and the like are obtained, and then single-copy transgenic plants are finally obtained by Southern blot screening, namely six strains of SSC-2, 6, 7, 10, 17 and 18 are obtained, as shown in figure 2.
In order to verify the effect of RNAi interference, the inventor analyzes the expression levels of resistant starch related genes and starch synthesis related genes in single-copy plants by Real-time PCR. In most of pPCaMV35S, the expression level of resistant starch-related genes was specifically down-regulated in SS2RNAi single-copy transgenic cassava as shown in FIG. 3.
Furthermore, the present inventors found that the expression level of the transcription level of the MeSBE2 gene was significantly increased, and that the expression level of the transcription level of other genes was not changed uniformly.
The results show that the expression level of the resistant starch related gene in the transgenic cassava is inhibited, and the transcription level of other genes in the starch synthesis process is influenced to a certain extent.
Although the target gene is strongly inhibited at the expression level, it is further proved whether the target gene is also inhibited at the protein level. The invention designs antigen polypeptide aiming at protein fragment specific to resistant starch related gene and successfully obtains rabbit source polyclonal antibody of the cassava resistant starch related gene. Mature root tubers with consistent development stages of wild cassava and three single-copy transgenic cassava (SSC-2, SSC-6 and SSC-7) with obviously reduced expression of resistant starch related genes are harvested, and after total protein is extracted, the protein amount of the resistant starch related genes is further detected by Western blot. The results are shown in FIG. 4, which shows that: the target band of the resistant starch related gene exists in a wild type, has the size of about 78kD and is consistent with the size of the predicted resistant starch related gene; no target bands of resistant starch related genes exist in the transgenic plants SSC-2, 6 and 7, which shows that the expression level of the target genes is reduced and the protein amount of the target genes is also successfully reduced by means of RNAi.
Furthermore, the inventors found that the protein levels of some other genes involved in starch synthesis were determined to be not significantly altered.
Example 4 modulation of amylose content in tuberous root-storing starch by resistant starch-related genes
Harvesting mature root tubers with consistent development stages of wild cassava and resistant starch related gene transgenic cassava (SSC-2, SSC-6 and SSC-7), and determining the resistant starch content of each sample by referring to a resistant starch detection kit (Megazyme International Ireland Ltd.) after drying.
The results show that the content of resistant starch in the transgenic plant root tuber is increased very significantly compared with the wild-type cassava storage type starch, the content of resistant starch in the wild-type cassava root tuber is about 5.8%, and the content of resistant starch in the SS2-RNAi transgenic plant root tuber is increased to 25-26%, as shown in FIG. 5.
Example 5 Regulation of amylose content in tuberous root-storing starch by resistant starch-related genes
Mature root tubers with consistent development stages of wild cassava and resistant starch related gene transgenic cassava (SSC-2, SSC-6 and SSC-7) are harvested, and the storage starch is extracted according to the national standard GB/T15683-: 2007 measures the amylose content of each sample.
The results show a very significant increase in amylose content in the transgenic plant storage-type starch compared to the wild-type cassava storage-type starch, about 21% for the wild-type cassava storage-type starch and an increase of 27-33% for the SS2-RNAi transgenic plant storage-type starch, as shown in fig. 6.
Example 6 Regulation of amylopectin chain Length distribution in root tuber-storing starch by resistant starch-related Gene
The tuberous root-storing starch was hydrolyzed by isoamylase (isoamylase), and then the glucan component in the hydrolysate was analyzed by HPAEC-PAD.
The analysis results showed that the shortest glucan chain in the wild type tuberous root storage starch was DP6, with two peaks at DP11-12 and DP45 and one shoulder at DP 18-20. Compared with the wild type, the transgenic plant root tuber storage type starch has obviously increased short chain (DP6-9) which can be increased by 2.8% at most; a significant reduction in the mid-chain fraction (DP10-18), about-0.76%; the medium-long chain part (DP19-33) is obviously increased, about 0.19 percent; the long chain fraction (DP >33) was slightly reduced, about-0.15%; as shown in fig. 7.
Example 7 Regulation of the viscosity Properties of root tuber storage starch by resistant starch-related genes
Amylose content is closely related to starch paste viscosity property characteristics, and therefore, the present inventors analyzed starch viscosity characteristics using a Rapid viscometer Rapid Visco Analyzer (RVA-4series, Newport Scientific, Australia).
The inventors found that the RVA profile of SS2-RNAi transgenic cassava root tuber storage starch was significantly altered compared to the wild type, with peak viscosity, hot and cold viscosities significantly lower than the wild type, indicating that the starch is more difficult to gelatinize as amylose is increased in the starch. After reaching the highest peak, the gelatinization curves of the high amylose starches SSC-2, SSC-6 and SSC-7 show a characteristic of continuing to rise, unlike the decrease of the viscosity curve of the wild type due to the breakage of starch grains, as shown in FIG. 8.
Example 8 modulation of thermodynamic Properties of root tuber storage starch by resistant starch-related genes
Differential Scanning Calorimetry (DSC) is a thermodynamic method for determining the endothermic capacity of starch during heating, which is mainly influenced by the amylose content, the crystallinity of starch, the chain length distribution of amylopectin, etc., in SS2-RNAi transgenic plants, the root tuber-storing starches To, Tp, Tc and Δ H are significantly reduced compared To wild-type root tuber-storing starches, wherein Δ H is reduced about two To three times compared To wild-type.
TABLE 1 thermodynamic parameters of starch storage of wild type and transgenic cassava tubers
Note: the data shown in the table are the mean ± sd of 3 experimental replicates. Indicates significant differences between measurements under this condition (p < 0.05); indicates that the difference between the measurements was significant under this condition (p < 0.01).
Example 9 Regulation of root tuber-storing starch Structure by resistant starch-related genes
The XRD diffraction pattern of starch can be classified into A, B, C, V type starch, and is generally considered to be composed of diffraction peaks of crystalline regions and background peaks of amorphous regions. The cassava wild-type starch shows typical diffraction characteristics of type a (obvious diffraction peaks around 2 theta equal to 15.2 degrees, 17.0 degrees and 23.6 degrees, and double peaks at 17.0 degrees). As shown in FIG. 9, the 17 ℃ diffraction peak of the SS2-RNAi cassava root tuber-storing starch was changed into a single peak, and the intensities of the 15 ℃ and 23 ℃ diffraction peaks were significantly decreased and the crystallinity was decreased, as compared with the wild type. Since the 17 DEG diffraction peak is changed into a single peak and belongs to the B-type diffraction structure characteristic, the crystal form structure is considered to be changed from A type to B type when the content of amylose is increased.
All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.
Sequence listing
<110> Shanghai Life science research institute of Chinese academy of sciences
<120> method for improving resistant starch content of potato tuber roots and application
<130> 172364
<160> 2
<170> PatentIn version 3.3
<210> 1
<211> 2256
<212> DNA
<213> cassava
<400> 1
atggcattta taggatcact tccttttatt atccaaacca aagcagaaag ttctgtcctt 60
ctccatgaca aaaacctaca gcgatccaga ttctccgttt tcccatgtag atcacaaaac 120
tcttttaatt tagccgtttc gttatctttg agttttaagc ctgtaagagc tacaggtaag 180
gaaggcgtta gtggtgatgg gtcagaggat acacttcaag ccaccatcga gaaaagcaag 240
aaagttctcg ccttgcaaag ggacctactt cagaagattg ctgaaagaag gaaattggtt 300
tcttctatac aaagtagtgt tggtgaccac gacacaaaca aaacttctca tgaacagagg 360
gaaaactctt tgccaaattc agataatact tcaactagtg atgtgaatat gcaccaacag 420
caaaatggcc cagttcttcc gagtagctat gtccattcaa ctgcagatga ggtatcagaa 480
actgcatctt cagctattaa tagaggtcat gctaaagatg ataaggaact tgaacaacat 540
gcatctccta gaacagcctt tgttaagaat tctaccaaac agtttaaaga gatggattct 600
gagaaactac agacagatga gataccatct tttctttcaa acaccacaga tatttccact 660
ataaatgaag aaaatagtga acattcaaat gaatcaacct cacctatggt tgacattttt 720
gaaagtgatt ctatgactga agacatgaag ccacctcctt tggctgggga caatgtcatg 780
aatgttattt tggtagctgc agaatgtgct ccatggtcca aaacaggtgg ccttggtgat 840
gtcgctggat ctttaccaaa ggctttggct cggcgtggac atcgggttat ggttgtggca 900
ccgcgatatg gcaactatgt tgaacctcag gatactggag tccgaaagag gtataaggtg 960
gatggtcagg attttgaagt atcatacttc caagccttca ttgatggggt tgattttgta 1020
ttcattgaca gtcctatgtt tcgccacata gggaatgata tatatggagg aaacagaatg 1080
gatatattaa agaggatggt attattttgc aaagctgctg ttgaggttcc ttggcatgtc 1140
ccatgtggtg gagtctgcta tggggatgga aatttggctt tcattgcaaa tgattggcat 1200
acagcattgt tgccagtgta tctgaaggca tattatcggg ataatggttt aatgcaatat 1260
acaagatctg ttcttgtaat tcataacata gctcaccagg gtcggggtcc agtggatgat 1320
ttctcttacg tgggtctacc agaacattac attgatctct tcaaactgca tgatccgatt 1380
ggtggtgacc acttcaatat ctttgcagct ggtcttaagg tggcagatcg tgtggttact 1440
gttagtcatg gatacgcctg ggagcttaaa acatctgaag gtggttgggg tctgcacaat 1500
atcataaatg agaacgactg gaaattgcag ggcattgtta atgggattga tgccaaagaa 1560
tggaatccac agtttgatat tcaactgaca tcagatggtt atactaacta ttccctggaa 1620
acacttgata ctggcaagcc tcagtgcaag gcagccttac agaaggagct cggtttgccc 1680
atccgtccag atgtccctgt tattgggttc attggaaggt tggattatca gaaaggtgtc 1740
gatctcatag ctgaggcaat tccctggatg gtgggtcagg atgtgcaact agtaatgttg 1800
ggtactggca gacaagactt ggaagagatg cttagacaat ttgaaaacca acatagagat 1860
aaagtgaggg gatgggttgg tttttctgtg aagacagctc acaggataac tgctggtgca 1920
gatattttgc tcatgccatc aagatttgaa ccatgtgggc taaaccagtt atatgctatg 1980
atgtacggga cgattcctgt agtacacgct gtgggtggac taagggacac ggtgcaacct 2040
ttcgatccat ttaatgagtc ggggcttggg tggacatttg atagcgctga atcacataaa 2100
ctgatacatg cattaggcaa ttgcttgctc acttaccgag agtacaagaa gagctgggaa 2160
ggactgcaga gaagagggat gactcaaaac ctcagctggg accatgctgc tgagaaatat 2220
gaggagactc ttgttgcagc caagtaccag tggtga 2256
<210> 2
<211> 751
<212> PRT
<213> cassava
<400> 2
Met Ala Phe Ile Gly Ser Leu Pro Phe Ile Ile Gln Thr Lys Ala Glu
1 5 10 15
Ser Ser Val Leu Leu His Asp Lys Asn Leu Gln Arg Ser Arg Phe Ser
20 25 30
Val Phe Pro Cys Arg Ser Gln Asn Ser Phe Asn Leu Ala Val Ser Leu
35 40 45
Ser Leu Ser Phe Lys Pro Val Arg Ala Thr Gly Lys Glu Gly Val Ser
50 55 60
Gly Asp Gly Ser Glu Asp Thr Leu Gln Ala Thr Ile Glu Lys Ser Lys
65 70 75 80
Lys Val Leu Ala Leu Gln Arg Asp Leu Leu Gln Lys Ile Ala Glu Arg
85 90 95
Arg Lys Leu Val Ser Ser Ile Gln Ser Ser Val Gly Asp His Asp Thr
100 105 110
Asn Lys Thr Ser His Glu Gln Arg Glu Asn Ser Leu Pro Asn Ser Asp
115 120 125
Asn Thr Ser Thr Ser Asp Val Asn Met His Gln Gln Gln Asn Gly Pro
130 135 140
Val Leu Pro Ser Ser Tyr Val His Ser Thr Ala Asp Glu Val Ser Glu
145 150 155 160
Thr Ala Ser Ser Ala Ile Asn Arg Gly His Ala Lys Asp Asp Lys Glu
165 170 175
Leu Glu Gln His Ala Ser Pro Arg Thr Ala Phe Val Lys Asn Ser Thr
180 185 190
Lys Gln Phe Lys Glu Met Asp Ser Glu Lys Leu Gln Thr Asp Glu Ile
195 200 205
Pro Ser Phe Leu Ser Asn Thr Thr Asp Ile Ser Thr Ile Asn Glu Glu
210 215 220
Asn Ser Glu His Ser Asn Glu Ser Thr Ser Pro Met Val Asp Ile Phe
225 230 235 240
Glu Ser Asp Ser Met Thr Glu Asp Met Lys Pro Pro Pro Leu Ala Gly
245 250 255
Asp Asn Val Met Asn Val Ile Leu Val Ala Ala Glu Cys Ala Pro Trp
260 265 270
Ser Lys Thr Gly Gly Leu Gly Asp Val Ala Gly Ser Leu Pro Lys Ala
275 280 285
Leu Ala Arg Arg Gly His Arg Val Met Val Val Ala Pro Arg Tyr Gly
290 295 300
Asn Tyr Val Glu Pro Gln Asp Thr Gly Val Arg Lys Arg Tyr Lys Val
305 310 315 320
Asp Gly Gln Asp Phe Glu Val Ser Tyr Phe Gln Ala Phe Ile Asp Gly
325 330 335
Val Asp Phe Val Phe Ile Asp Ser Pro Met Phe Arg His Ile Gly Asn
340 345 350
Asp Ile Tyr Gly Gly Asn Arg Met Asp Ile Leu Lys Arg Met Val Leu
355 360 365
Phe Cys Lys Ala Ala Val Glu Val Pro Trp His Val Pro Cys Gly Gly
370 375 380
Val Cys Tyr Gly Asp Gly Asn Leu Ala Phe Ile Ala Asn Asp Trp His
385 390 395 400
Thr Ala Leu Leu Pro Val Tyr Leu Lys Ala Tyr Tyr Arg Asp Asn Gly
405 410 415
Leu Met Gln Tyr Thr Arg Ser Val Leu Val Ile His Asn Ile Ala His
420 425 430
Gln Gly Arg Gly Pro Val Asp Asp Phe Ser Tyr Val Gly Leu Pro Glu
435 440 445
His Tyr Ile Asp Leu Phe Lys Leu His Asp Pro Ile Gly Gly Asp His
450 455 460
Phe Asn Ile Phe Ala Ala Gly Leu Lys Val Ala Asp Arg Val Val Thr
465 470 475 480
Val Ser His Gly Tyr Ala Trp Glu Leu Lys Thr Ser Glu Gly Gly Trp
485 490 495
Gly Leu His Asn Ile Ile Asn Glu Asn Asp Trp Lys Leu Gln Gly Ile
500 505 510
Val Asn Gly Ile Asp Ala Lys Glu Trp Asn Pro Gln Phe Asp Ile Gln
515 520 525
Leu Thr Ser Asp Gly Tyr Thr Asn Tyr Ser Leu Glu Thr Leu Asp Thr
530 535 540
Gly Lys Pro Gln Cys Lys Ala Ala Leu Gln Lys Glu Leu Gly Leu Pro
545 550 555 560
Ile Arg Pro Asp Val Pro Val Ile Gly Phe Ile Gly Arg Leu Asp Tyr
565 570 575
Gln Lys Gly Val Asp Leu Ile Ala Glu Ala Ile Pro Trp Met Val Gly
580 585 590
Gln Asp Val Gln Leu Val Met Leu Gly Thr Gly Arg Gln Asp Leu Glu
595 600 605
Glu Met Leu Arg Gln Phe Glu Asn Gln His Arg Asp Lys Val Arg Gly
610 615 620
Trp Val Gly Phe Ser Val Lys Thr Ala His Arg Ile Thr Ala Gly Ala
625 630 635 640
Asp Ile Leu Leu Met Pro Ser Arg Phe Glu Pro Cys Gly Leu Asn Gln
645 650 655
Leu Tyr Ala Met Met Tyr Gly Thr Ile Pro Val Val His Ala Val Gly
660 665 670
Gly Leu Arg Asp Thr Val Gln Pro Phe Asp Pro Phe Asn Glu Ser Gly
675 680 685
Leu Gly Trp Thr Phe Asp Ser Ala Glu Ser His Lys Leu Ile His Ala
690 695 700
Leu Gly Asn Cys Leu Leu Thr Tyr Arg Glu Tyr Lys Lys Ser Trp Glu
705 710 715 720
Gly Leu Gln Arg Arg Gly Met Thr Gln Asn Leu Ser Trp Asp His Ala
725 730 735
Ala Glu Lys Tyr Glu Glu Thr Leu Val Ala Ala Lys Tyr Gln Trp
740 745 750
Claims (13)
1. A method of increasing resistant starch content or altering starch-related traits in tuberous roots of a potato plant, comprising: down-regulating the expression or activity of a resistant starch-related polypeptide in a potato plant, which is cassava; the resistant starch related polypeptide is a polypeptide with an amino acid sequence shown as SEQ ID NO. 2; said altered starch-related trait is selected from the group consisting of:
(1) increasing the amylose content of the storage starch;
(2) regulating the chain length distribution of amylopectin in the storage starch;
(3) adjusting the starch paste viscosity properties of the storage starch;
(4) adjusting the thermodynamic properties of storage starch;
(5) regulating the starch structure of the storage starch.
2. The method of claim 1, wherein downregulating expression of an resistant starch-related polypeptide in the plant comprises: transferring into a plant an interfering molecule that interferes with the expression of the resistant starch-related polypeptide.
3. The method of claim 2, wherein the interfering molecule is a dsRNA, an antisense nucleic acid, a small interfering RNA, a microrna, or a construct capable of expressing or forming said dsRNA, antisense nucleic acid, small interfering RNA, microrna, that encodes a resistant starch-related polypeptide or a transcript thereof as a target for inhibition or silencing.
4. The method of claim 3, wherein the interfering molecule that interferes with the expression of the resistant starch-related polypeptide is targeted to position 548-741 or a transcript thereof of a gene encoding the resistant starch-related polypeptide.
5. The method of claim 1, wherein the interfering molecule comprises a structure of formula (I):
in the formula (I), the compound is shown in the specification,
Seqforward directionA fragment of the gene coding for the resistant starch-related polypeptide, SeqReverse directionIs and SeqForward directionA complementary polynucleotide;
x is at SeqForward directionAnd SeqReverse directionA spacer sequence therebetween, and the spacer sequence and SeqForward directionAnd SeqReverse directionAre not complementary.
6. The method of claim 5, wherein said SeqForward direction548-th 741 of a coding gene of resistant starch related polypeptide.
7. The method of claim 1, further comprising the subsequent steps of: selecting from the plants having down-regulated expression of the resistant starch-related polypeptide a plant having an increased content of resistant starch or an altered starch-related trait as compared to the wild type plant.
8. The method of claim 1, wherein in (2), the modified storage starch has an amylopectin chain length distribution: the short chain proportion is increased, and the medium chain proportion is decreased; the proportion of medium-long chains is increased; the long chain proportion is reduced; or
(3) The starch paste viscosity property of the modified storage starch is as follows: reducing peak viscosity, hot tack and cold tack; or
(4) The thermodynamic properties of the modified storage starch are as follows: the storage type starch To, Tp, Tc and delta H are reduced; or
(5) Wherein the starch structure of the modified storage starch is: the crystal structure is changed to B type.
9. Use of an interfering molecule which down-regulates the expression of a resistant starch-related polypeptide for increasing the resistant starch content or altering starch-related traits in the tuberous roots of a potato plant; the potato plant is cassava; the resistant starch related polypeptide is a polypeptide with an amino acid sequence shown as SEQ ID NO. 2; said altered starch-related trait is selected from the group consisting of:
(1) increasing the amylose content of the storage starch;
(2) regulating the chain length distribution of amylopectin in the storage starch;
(3) adjusting the starch paste viscosity properties of the storage starch;
(4) adjusting the thermodynamic properties of storage starch;
(5) regulating the starch structure of the storage starch.
10. The use according to claim 9, wherein in (2) the amylopectin chain length distribution in modified storage-type starch is: the short chain proportion is increased, and the medium chain proportion is decreased; the proportion of medium-long chains is increased; the long chain proportion is reduced; or
(3) The adjusting of the starch paste viscosity properties of the storage starch is: reducing peak viscosity, hot tack and cold tack; or
(4) The thermodynamic properties of the modified storage starch are as follows: the storage type starch To, Tp, Tc and delta H are reduced; or
(5) Wherein the starch structure of the modified storage starch is: the crystal structure is changed to B type.
11. An interfering molecule which down-regulates the expression of a resistant starch-related polypeptide, thereby increasing the resistant starch content or altering starch-related traits in tuberous roots of a potato plant, comprising the structure of formula (I):
in the formula (I), the compound is shown in the specification,
Seqforward directionIs a coding gene segment of resistant starch related polypeptide, the resistant starch related polypeptide is a polypeptide with an amino acid sequence shown as SEQ ID NO. 2; what is needed isSeqForward direction548-741 of a coding gene of resistant starch related polypeptide;
Seqreverse directionIs and SeqForward directionA complementary polynucleotide;
x is at SeqForward directionAnd SeqReverse directionA spacer sequence therebetween, and the spacer sequence and SeqForward directionAnd SeqReverse directionAre not complementary;
the potato plant is cassava; said altered starch-related trait is selected from the group consisting of:
(1) increasing the amylose content of the storage starch;
(2) regulating the chain length distribution of amylopectin in the storage starch;
(3) adjusting the starch paste viscosity properties of the storage starch;
(4) adjusting the thermodynamic properties of storage starch;
(5) regulating the starch structure of the storage starch.
12. A vector comprising the interfering molecule of claim 11.
13. Use of a resistant starch-related polypeptide or a gene encoding the same as a molecular marker for identifying resistant starch constitution or starch-related traits in potato plants; the resistant starch related polypeptide is a polypeptide with an amino acid sequence shown as SEQ ID NO. 2; the potato plant is cassava; said starch-related trait is selected from the group consisting of:
(1) increasing the amylose content of the storage starch;
(2) regulating the chain length distribution of amylopectin in the storage starch;
(3) adjusting the starch paste viscosity properties of the storage starch;
(4) adjusting the thermodynamic properties of storage starch;
(5) regulating the starch structure of the storage starch.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710373004.8A CN108949804B (en) | 2017-05-24 | 2017-05-24 | Method for improving resistant starch content of potato tuber roots and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710373004.8A CN108949804B (en) | 2017-05-24 | 2017-05-24 | Method for improving resistant starch content of potato tuber roots and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108949804A CN108949804A (en) | 2018-12-07 |
| CN108949804B true CN108949804B (en) | 2021-12-17 |
Family
ID=64494349
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710373004.8A Active CN108949804B (en) | 2017-05-24 | 2017-05-24 | Method for improving resistant starch content of potato tuber roots and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108949804B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113293170B (en) * | 2021-05-27 | 2022-10-18 | 中国热带农业科学院热带生物技术研究所 | Gene MeTIR1 for regulating and controlling cassava starch content and application thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7317146B2 (en) * | 2003-12-31 | 2008-01-08 | Pioneer Hi-Bred International, Inc. | Production of cereal grain with reduced starch granule size and uses thereof |
-
2017
- 2017-05-24 CN CN201710373004.8A patent/CN108949804B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN108949804A (en) | 2018-12-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102933072B (en) | Fructus Hordei Vulgaris and application thereof | |
| Tanaka et al. | Altered carbohydrate metabolism in the storage roots of sweetpotato plants overexpressing the SRF1 gene, which encodes a Dof zinc finger transcription factor | |
| CN107119071A (en) | A kind of method for reducing plant amylose content and application | |
| EP2333076B1 (en) | Low acrylamide foods | |
| BRPI1002997A2 (en) | transgenic saccharin sorghum with altered lignin composition and process of preparation thereof | |
| JP2011504728A5 (en) | ||
| CN106701814B (en) | Method for adjusting starch content in potato leaves and application | |
| CN110714010A (en) | Method for reducing content of amylose in rice through gene editing and sgRNA special for method | |
| CN102268435A (en) | Plant with reduced protein content in seed, method of constructing the same and method of using the same | |
| CN105349559A (en) | Application of corn ZmWx gene in increase of corn yield and improvement of grain characteristics | |
| AU2010212487A1 (en) | Transgenic sweet sorghum with altered lignin composition and process of preparation thereof | |
| CN108949804B (en) | Method for improving resistant starch content of potato tuber roots and application | |
| CN110184279A (en) | New a promotion branch development gene SrDREB2A and its expression vector and application in stevia rebaudianum | |
| CN102242118B (en) | Method for improving characters of gossypol in cotton, and use thereof | |
| CN101580822B (en) | ADP-glucose pyrophosphorylase mutant, encoding genes thereof and application | |
| JP4711762B2 (en) | Function elucidation of starch synthase type IIIa and new starch production method | |
| BR102018073082A2 (en) | METHOD FOR OBTAINING MAMMONINE SEEDS WITHOUT RICIN / RCA, MAMMONA PLANTS WITHOUT RICIN / RCA, METHOD OF IDENTIFYING MAMMONA PLANTS WITHOUT RICIN / RCA, POLYNUCLEOTIDES, CONSTRUCTIONS, AND USES OF THE SAME | |
| Sun et al. | Overexpression of starch branching enzyme 1 gene improves eating quality in japonica rice | |
| CN111849989B (en) | Method for enhancing salt tolerance of mulberry by utilizing long-chain non-coding RNA transgenic rootstock | |
| US9238818B2 (en) | Methods and genetic constructs for modification of lignin composition of corn cobs | |
| CN109486819B (en) | Cassava U6 promoter gene and application thereof | |
| CN102115759A (en) | Transgenic sweet sorghum with altered lignin composition and process of preparation thereof | |
| CN106701815B (en) | Method for regulating potato storage root character and application | |
| CN117089568A (en) | Application of wheat TaERFL1a gene in improving physicochemical properties and/or digestion properties of wheat starch | |
| CN108728478B (en) | Method for improving yield and starch property by using hydrogen ion pyrophosphorylase |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20200612 Address after: 200032 building 4, No. 300 Fenglin Road, Xuhui District, Shanghai Applicant after: Center for excellence and innovation in molecular plant science, Chinese Academy of Sciences Address before: 200031 Yueyang Road, Shanghai, No. 319, No. Applicant before: SHANGHAI INSTITUTES FOR BIOLOGICAL SCIENCES, CHINESE ACADEMY OF SCIENCES |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant |