CN106701812A

CN106701812A - Establishment method of type I-IV tandem dengue virus EDIII recombinant proteins and application thereof

Info

Publication number: CN106701812A
Application number: CN201611229819.0A
Authority: CN
Inventors: 孙强明; 邱丽娟; 赵玉娇; 席珏敏; 王晓丹; 陈俊英; 潘玥; 叶超
Original assignee: Institute of Medical Biology of CAMS and PUMC
Current assignee: Institute of Medical Biology of CAMS and PUMC
Priority date: 2016-12-27
Filing date: 2016-12-27
Publication date: 2017-05-24

Abstract

The invention relates to an establishment method of type I-IV tandem dengue virus EDIII recombinant proteins and application thereof. A type-IV dengue virus gene of an interval cascade sequence is optimized by a synthesized yeast expression codon and specially designed by virtue of an interval tandem sequence, the recombinant tandem protein is expressed by using a pichiapink expression system and purified by using a Ni affinity column, antigenicity of the recombinant tandem is detected by virtue of enzyme-linked immunosorbent assay, and finally the candidate type I-IV recombinant sub-unit fusion protein for four serum-type dengue viruses is obtained. The recombinant protein gene is artificially optimized by dengue virus EDIII synthesized yeast expression system, four dengue virus serum-type EDIII genes are simultaneously integrated, a connecting peptide gene sequence is designed artificially, the recombinant fusion protein of the corresponding gene expression has an effect on protecting various dengue viruses and can be used as a candidate vaccine for type I-IV dengue viruses.

Description

A kind of construction method of recombinant proteins of I-IV types series connection dengue virus E D III and its application

Technical field

The invention belongs to viral vaccine research and development manufacturing technology field, and in particular to a kind of I-IV types series connection dengue virus E D III The construction method of recombinant protein and its application.

Background technology

Dengue virus particle contains lipoprotein envelope, including envelope protein (Envelope, E) and memebrane protein (Membrene, M), coating furcella is then formed.Wherein E protein is the primary glycoproteins of peplos, molecular weight about 51~60KD, containing various The correlation function determinant such as B cell and T cell antigen epitope and category are special, type is special.Also there is various biological work(simultaneously Can, such as tuberculosis target cell surface receptors, the fusion of mediation film, induction produces neutralizing antibody, RCA.

E protein includes three domains, had researcher to combine ED I and ED II in the past and uses Bacillus coli expression, and detects Proof has good immunogenicity.But the further investigation with people to albumen, the areas of ED III have compared other two domains Bigger advantage is shown, being mainly manifested in the immunoglobulin spline structure of ED III makes it possess the function of being combined with cell； ED III extends perpendicularly out virus surface and forms projection independently of E protein other structures domain.Such architectural feature makes the domain can Can be the viral main portions combined with acceptor.In addition, ED III is one of virulence determinants of E protein, and it is included can lure The type and hypotype epitope of the specific neutralizing antibody of artificial delivery life.So, the expression of the albumen of ED III can be established for later experiment Fixed good basis, plays particularly important effect.

Dengue virus (Dengue virus, DV) is divided into four kinds of Serotypes (III/DV of DV I/DV, II/DV IV), and part is felt Dengue fever (Dengue fever, DF), dengue hemorrhagic fever (Dengue hemorrhagic occurs after dye person's infection virus Fever, DHF) and the clinical manifestation such as dengue shock syndrome (Dengue shock syndrome, DSS).Research has shown that, causes The reason for one of dengue hemorrhagic fever and dengue shock syndrome is important is probably antibody-dependant enhancing infection effect (Antibody-dependent enhancement, ADE), that is, infect sub- neutralization thed produce after the dengue virus of a certain type and resist Body, through after a period of time, not neutralizing the effect of virus not only when patient infects special-shaped virus again, goes back answering for mediate retroviral Amplification procedure processed, finally aggravates disease.The research of dengue vaccine has had the history of more than 70 years, and ADE problems perplex always Researchers, as an important bottleneck in dengue vaccine research.In view of this key issue, the present invention is by four kinds The dengue virus E D III of serotype is together in series, one subunit of expression series connection recombinant protein, while having four kinds of serotype The immunogenicity of dengue virus can be body while providing the protectiveness of various dengue virus, be the exploitation of dengue virus vaccine Lay the foundation.

The content of the invention

It is an object of the invention to obtain a kind of recombinant proteins of I-IV types series connection dengue virus E D III construction method and its Using can be used as effective dengue virus candidate vaccine.Wherein engineer is expressed using eukaryotic expression system to connect and eucaryon The albumen of ED III of codon optimization is expressed, yield is higher.In addition, compared with prokaryotic expression system, albumen can obtain more perfect Posttranslational modification, makes the fidelitys of ED III of restructuring higher, and immunogenicity improves reservation, is not destroyed.

The present invention is realized by following technical proposal：A kind of structure side of the recombinant proteins of I-IV types series connection dengue virus E D III Method, it is characterised in that by following each step：

(1) I-IV type Dengue virus genes sequences are put in order through SWISS-MODEL predictions, with flexible small peptide gene (SEQ ID No.1) is connected, and tandem gene sequence is obtained by yeast biased codons optimization；

(2) Kozak sequences (SEQ ID No.2) is added to improve egg in 5 ' ends of step (1) gained tandem gene sequence White translation efficiency, enterokinase gene (SEQ ID No.3) and His-Tag sequence (SEQ ID No.4) are added at 3 ' ends, are made Recombinant protein has the purification tag that can be sheared, and introducing termination codon subsequence (SEQ ID No.5) termination albumen in end turns over Translate；Then expanded by PCR, and restriction endonuclease sites EcoRI/SphI is introduced at sequence two ends, double digestion is carried out, by it Plasmid pPink-HC is cloned into, and is transformed into PichiaPink^TMPichi strain in Expression systems；By first Alcohol-induced expression, histidine protein purifying obtains the recombinant proteins (SEQ ID No.9) of I-IV types series connection dengue virus E D III.

The I-IV type Dengue virus genes sequences of the step (1) are：I type dengue virus type strain EF508198.1, II Type dengue virus type strain EU249523.1, III type dengue virus type strain GU721069.1 familial combined hyperlipidemia dengue virus type strains EF436282.1。

Putting in order for the step (1) is the type of-III type of-I type of II type-IV.

The step (2) PCR amplification primer be：

Forward primer X1kozak -5 ' gcgaattcgccaccatgacaggtaaatt 3 ' (SEQ ID No.7)

Reverse primer X2End -5 ' ggcatgcttattagtggtgatggtggtgatg 3 ' (SEQ ID No.8)

The antigen recombinant proteins of ED III of the type dengue virus of gained I-IV strain can be applied to dengue virus quadruple vaccine.

The dengue virus quadruple vaccine is, with aluminum hydroxide adjuvant as adjuvant, by gained I-IV types series connection dengue virus The recombinant proteins of ED III and aluminum hydroxide adjuvant by volume 1:1 coordinates.

Advantage and effect that the present invention possesses：The present invention is based on four kinds of serotype Dengue viral envelope protein structure domains III Gene order carries out the design and structure of the I-IV types series connection recombinant subunit vaccines of ED III.Yeast table is added in the design process Up to codon optimization scheme and the spaced series sequence of particular design, four kinds of serotype dengue virus (DV- of program design III/DV-IV of I/DV-II/DV-) the area's tandem gene of envelope protein domain III is in PichiaPink^TM Expression System Expression system obtains high efficient expression, the restructuring series protein of purifying is obtained through the purifying of Ni affinity columns, through mouse immuning test Prove that the I-IV type recombinant subunit fusion proteins have good immunogenicity and antigenicity.ED III can be drawn in dengue virus Play organism effect immune, and the again small albumen section of side effect.It is the present invention be directed to the expression of the synthetic yeasts of dengue virus E D III The recombinant protein gene of system artificial optimization, wherein four kinds of genes of the ED of dengue virus serotypes III are incorporated simultaneously, and manually Connection peptide gene sequence is devised, there will be protection to many types of dengue virus after the recombination fusion protein of corresponding gene expression is immune Effect, can be used as I-IV type dengue virus candidate vaccines.

Brief description of the drawings

Fig. 1 is the SWISS-MODEL prediction restructuring space structures of ED III；

Fig. 2 is Z-Score when recombinating III sequence prediction structures of ED；

Fig. 3 is PichiaPink^TMExpression strain1MD cultivation results；

Fig. 4 is the embodiment PCR amplification series connection restructuring gene nucleic acid electrophoretograms of ED III, maker in figure：DNA ladder；1： Introduce EcorI, Kozak sequence, enterokinase cleavage site, the genetic fragment of the sequences of recombinant protein ED III of 6*His；2：Introduce The weight of EcorI restriction enzyme sites, Kozak sequences, enterokinase cleavage site, 6*His, terminator codon and SphI restriction enzyme sites The genetic fragment of the sequences of histone ED III；

Fig. 5 is that pPink-HC-ED III, maker in figure are identified in embodiment digestion：DNA ladder；2,3：Positive pPink- The plasmids of HC-ED III, including purpose band 1311bp and pPink-HC plasmid band 7.7kb

Fig. 6 is the successful PichiaPink of embodiment electricity conversion^TMExpression strain1；

Bacterial protein coomassie brilliant blue staining result when Fig. 7 is restructuring III albumen of ED of embodiment induced expression, in figure make：Protein Ladder；1-1/1-2/1-3：Mycoprotein is harvested when No. 1 24h, 48h, 72h of monoclonal；2-1/2-2/2- 3：Mycoprotein is harvested when No. 2 24h, 48h, 72h of monoclonal；3-1/3-2/3-3/3-4：Monoclonal No. 3 24h, 48h, 64h, 72h When harvest mycoprotein；

Fig. 8 is the expression yeast strain western-blot immune-blotting methods of the albumen of embodiment screening high efficient expression ED III As a result, 1-1/1-2/1-3 in figure：Mycoprotein is harvested when No. 1 24h, 48h, 72h of monoclonal；2-1/2-2/2-3：Monoclonal 2 Mycoprotein is harvested when 24h, 48h, 72h；3-1/3-2/3-3/3-4：Thalline is harvested when No. 3 24h, 48h, 64h, 72h of monoclonal Albumen；

Fig. 9 is that embodiment SDS-PAGE detects the protein purification results of ED III, maker in figure：Protein Ladder；1、2、 3：The protein sample harvested during purifying protein different periods；4：Bacterial protein when not purifying.

Specific embodiment

The present invention is described further below by embodiment.

Embodiment 1

The acquisition of (1) the four type dengue virus series connection genes of ED III：

A, inquiry US National Bioinformatics Institute (NCBI), four type Dengue virus genes sequences each of China Report Strain, the wherein corresponding gene orders of ED III (position is 907-1185) are determined by NCBI blast, as shown in the table：

Table 2.1I-IV type dengue virus type strains

B, by SWISS-MODEL on-line predictions, determine the arranged in series of the I-IV type Dengue virus genes sequences of step a Order is II-I-III-IV, ensures that epitope is not blocked after flexible small peptide is connected with this；

C, the putting in order in the flexible short peptide sequence base of addition between any two by step b by four type Dengue virus genes sequences Because (SEQ ID No.1) is connected, then gained gene order is optimized through yeast biased codons, obtain tandem gene Sequence；

D, obtained by step c tandem gene sequence 5 ' end add Kozak sequences gccaccatgg (SEQ ID No.2), with Protein translation efficiency is improved, enterokinase gene gacgaggaggacaag (SEQ ID No.3) and histidine-tagged is added at 3 ' ends Sequence caccaccatcaccaccat (SEQ ID No.4), makes recombinant protein have the purification tag that can be sheared；Finally, at end End introduces termination codon subsequence uaauaa (SEQ ID No.5) and terminates protein translation；Obtain four type dengue virus series connection ED III Gene order, overall length 1311bp is as follows：

5’-gaattcgccaccatgacaggtaaattcaaggtcgttaaagaaatagctgaaactcaacacggtacc attgtcatcagagttcaatatgagggagatggttccccctgtaaaattccctttgagataatggatttggagaaaag acatgttttgggtaggctaatcacggttaacccaattgttactgagaaagattccccagtgaacatcgaggccgaac caccttttggggattcatacatcattattggtgtcgagccaggacagctaaaactgtcctggtttaaaaagggaggt ggttctggtagtggtggtagtgggtctggaggttccgggtcaaccggttcttttaaattggagaaagaggtggctga aacccagcacggaacagttcttgttcagattaagtacgagggaaccgacgcaccctgtaagatacccttttcaacac aggatgaaaagggtgtcactcaaaacggtagattaatcactgcaaatcctatcgtcactgacaaggaaaaaccagtt aacattgaagctgaaccccctttcggagaatcttacattgtgatcggtgccggtgaaaaggcactgaagttatcatg gtttaagaaaggcggtgggagtggctctggaggtagtggatcaggagggtccggttcaactttcgtcttgaagaagg aagtttctgaaacgcaacatggcacaattcttattaaagtcgaatacaaaggcgaggatgctccttgcaaaattcct ttctccactgaggacggacaaggtaaggctcataacggaagacttattaccgccaacccagttgtcaccaagaaaga agagcctgttaacatagaagctgaacctccattcggagagtctaatatcgtaatcggaattggggacaatgcattaa aaataaattggtacaaaaagggctcctccggtggatcaggttctggtggcagtggaagtggtggttccggatcatct ggcaagttttccatagacaaagagatggcagaaacacaacacggaacaactgttgtgaaggtgaaatatgaaggagc tggtgctccatgtaaggttcctattgagatccgagatgtaaataaggagaaagtagtgggtcgtattatctcttcta ctccatttgctgaaaacactaatagtgtcaccaatattgaactggaaccaccctttggcgactcttatattgttatt ggtgtcggcgatagtgccttgactttgcattggttccgaaagggtgacgacgacgacaagcaccaccatcaccacca ttaataagcatgc-3’(SEQ ID No.6)

(2) the pPink-HC expression plasmids containing the genes of ED III are built

A, the gene orders of ED III that step (1) four type dengue virus of gained are connected are reacted by PCR and expanded, PCR reactions Primer sequence is：

Forward primer：X1kozak—5’gcgaattcgccaccatgacaggtaaatt 3’(SEQ ID No.7)

Reverse primer：X2End—5’ggcatgcttattagtggtgatggtggtgatg 3’(SEQ ID No.8)

Reaction condition is as shown in table 2：

Table 2PCR reaction systems (reaction cumulative volume is 20 μ l)

The response procedures of use are as follows：

B, by step (2) a PCR reaction obtained by genetic fragment enter row agarose gel electrophoresis and pass through QIAquick Gel Extraction Kit Wherein DNA is reclaimed, for the double digestion reaction of EcoRI/SphI restriction enzymes, reaction condition such as table 3 below：

Table 3EcoRI/SphI double digestions reaction system (reaction cumulative volume is 50 μ l)

37 DEG C, 3h；

C, 1ug plasmid pPink-HC are taken, carry out the double digestion reaction of EcoRI/SphI restriction enzymes, reaction condition is such as Table 4 below：

Table 4EcoRI/SphI double digestions reaction system (reaction cumulative volume is 50 μ l)

37 DEG C, 3h；

D, (2) b, step c digestion products are entered into row agarose gel electrophoresis respectively and DNA therein is reclaimed, for connecting Reaction, reaction system such as table 5 below：

The plasmid construction coupled reaction system of table 5 (reaction cumulative volume is 10 μ l)

16 DEG C, 3h；

E, product in step (2) d is mixed with 100ulDH5 α competence bacteriums, 30min is placed on ice, at 42 DEG C 60s, on ice 60s, to adding 1ml LB culture mediums, 37 DEG C of 200rpm to cultivate 1h in mixture, take 100ul cultures and coat and contain Have in the LB culture dishes of 50ng/ul, culture dish is positioned over overnight incubation in 37 DEG C of incubators, next day selects Colony Culture, carries Take plasmid and whether digestion identification obtains the pPink-HC plasmids containing ED III, the hereafter simply referred to as plasmids of pPink-HC-ED III, enzyme Cut system such as table 6 below：

The digestion of table 6 identification builds plasmid reaction system (reaction cumulative volume is 50 μ l)

37 DEG C, 3h；

The standby PichiaPink saccharomycete of f, preparation electricity conversion, uses 100mlYPD medium cultures PichiaPink^TM The four kinds of Pichi strains (strain1, strain2, strain3, strain4) included in Expression systems, growth 1.3,1500*g centrifugations being reached to OD600 and removing supernatant, 50ml precooling sterilized waters are resuspended to be washed once, 10ml precooling 1M sorbierite weights It is outstanding to washed once, add 300ul precooling 1M sorbitol solutions resuspended standby (same day uses)；

The standby plasmids of linearisation pPink-HC-ED III of g, preparation electricity conversion, SpeI is used by the plasmids of pPink-HC-ED III Enzyme is linearized, endonuclease reaction system such as table 7 below：

The plasmid linearization reaction system of table 7 (reaction cumulative volume is 50 μ l)

37 DEG C, 3h；

H, by the plasmids of pPink-HC-ED III conversion enter PichiaPink^TMIn Expression bacterial strains, agarose is used Gel reclaims kit reclaims the plasmid of linearisation, and the 5ug plasmid mixing 500ul electricity standby bacterium of conversion are placed in a revolving cup, leads to Crossing electroporation carries out electricity turn, and electricity turns condition for 1500V/250 Ω/5ms, after 1mlYPDS is added in electric revolving cup, 28 DEG C of incubations 1h, power taking thing of changing the line of production is incubated at MD flat boards, and whether the PCR identifications of picking white monoclonal obtain and be transferred to pPink-HC-ED after three days III Pichi strain；

I, picking qualification result are that positive Pichia yeast falls within 10mlBMGY cultures one day, and condition of culture is 28 DEG C, 280rpm；Next day, culture is transferred in 125mlBMGY and is cultivated 2 days, condition of culture is 28 DEG C, 280rpm；

J, 1500 × g 10min harvest thalline, and BMMY is washed twice, resuspended with 125ml culture mediums BMMY, continuous culture 72h, in the methyl alcohol of 24h, 48h 40% to final concentration of 0.5%；Period samples in 24h, 48h, 72h, solidifying by polyacrylamide Gel electrophoresis Coomassie brilliant blue is dyeed, Weatern-Blot detection protein expression situations；

K, by 72h when the bacterial cell disruption that harvests after, be dissolved in the phosphate buffer containing 20mmol imidazoles (ph=7.4), 4 Supernatant is taken after DEG C 4000rpm centrifugation 15min, is purified with Bio-Rad brand His trap FF prepacked columns：Use equalizing and buffering Liquid balances His trap FF prepacked columns, is slowly added to cellular lysate supernatant, the guarantees of the ED III with His is combined with filler, uses Dcq buffer liquid (phosphate buffer of ph 7.4,50mmol imidazoles) is rinsed, and removes the foreign protein of non-specific binding, finally by mesh Albumen eluted with elution buffer (phosphate buffer of ph 7.4,500mmol imidazoles)；The albumen that above-mentioned purifying is obtained Taking 200ul eluents carries out SDS-page electrophoresis, the content and purity of purification Identification albumen；

L, with the PBS of 0.01M as the protein eluate after equilibrium liquid dialysis purification, bag dialysis protein eluate is obtained The recombinant proteins (SEQ ID No.9) of I-IV types series connection dengue virus E D III of purifying.

(3) immunogenicity and detection of antigenicity of the recombinant proteins of gained I-IV types series connection dengue virus E D III

A, the Balb/c using immune 6 week old of recombinant protein of step (2) l steps gained I-IV type series connection dengue virus Es D III Mouse, 50ug every；Adjuvant is connected the recombinant proteins of dengue virus E D III by volume 1 with I-IV types:1 coordinates, assistant used Agent is spaced 10 days and is immunized once, every time for Freund's adjuvant and aluminum hydroxide adjuvant is respectively adopted, and using Freund's adjuvant as control Blood sampling in 7th day is determined after immune, is immunized three times altogether, is put to death within 7th day after third time is immune and is taken blood, dense with 5ug/ml with purifying protein Degree does coating protein, and the serum titer after being immunized for the third time is detected with the method for ELISA, is further verified with virus neutralization tests The immunogenicity of recombinant protein；Result shows that the recombinant proteins of ED III are sun with immune DV II, the immunized mice seroreactions of DV III Property：

The recombinant protein immunogenicities of table 8ED III are detected

Meanwhile, after the recombinant proteins of Balb/c mouse immunes ED III, either Freund's adjuvant group or aluminum hydroxide adjuvant group The specific immune response of mouse can be caused, the mixed restructuring DV EDIII protein groups potency of Freund's adjuvant is 1:9586, hydroxide The mixed restructuring DV EDIII protein groups potency of aluminium adjuvant is 1:4935, Freund's adjuvant group causes substantially higher immune response.Wherein Freund's adjuvant group mice serum is positive with the ELISA reactions of the antibody of ED III, 6*His antibody.

Freund's adjuvant group is a positive control, but because Freund's complete adjuvant is harmful, is not useable on the person, Contrast Freund's complete adjuvant group, the effect of aluminum hydroxide adjuvant group is although slightly worse, but has antibody titer very high, therefore this hair It is bright to use aluminium hydroxide safe to the human body as adjuvant.

B, virus neutralize experimental technique：After serum is put into 56 DEG C of inactivation 30min, 1 is diluted to respectively:2、1:4、1:8、1: 16、1:32、1:64、1:128、1:256 concentration, in addition 50ul/ holes to 96 orifice plates, each dilution factor repeats 5 holes；To 4/5 hole Viral dilution liquid of the 50ul comprising 100TCID50 is added, 45min in 28 DEG C of incubators of 5%CO2 is positioned over, then added to every hole Enter the C636 cells of 100ul 3*105/ml, the hole that virus is not added is serum toxicity control group；96 orifice plates are placed on 5%CO2 Cultivated 7 days in 28 DEG C of incubators, observe lesion situation；, 96 holes completely the same with experiment condition in four kinds of serotype dengue virus Plate is not shared independently, it is to avoid viral cross-contamination effects experimental result.Experimental result carries out statistical by Read-Muench methods Analysis, computing formula is as follows：

Distance proportion=(higher than 50% protective rate -50%)/(higher than 50% protective rate-less than 50% protective rate)

The difference of the logarithm+distance proportion × dilution factor logarithm of protective rate serum dilutions of the LgPD50=higher than 50%

Mice serum and DV I, DV II, DV III, the viruses of DV IV are carried out into virus neutralization tests, display DVI-DVIV types PD50 Respectively 1/34,1/20,1/45,1/18, i.e. test serum be diluted to 1 respectively：34、1：20、1:45 and 1:Can be protected when 18 50% cell is from lesion after four kinds of serotype dengue virus infections.End value is all higher than 1：4, show that test serum can be to Dengue The effect of being effectively protected is played in the infection of virus, it was demonstrated that restructuring four types joint EDIII albumen has good immunogenicity.

Above step includes the gene order structure that the four serotypes of dengue combined subunit recombinates the albumen of ED III Design, expression plasmid must be built, the purifying of the induced expression of albumen, and the immunogenicity and antigenicity of albumen are identified.In gene In sequential structure design, by a series of bioinformatic analysis, it is determined that can completely retain antigenic sequential structure, together Shi Caiyong (II-I-III-IV) arranged in series sequentially, between with flexible small peptide (GGGSGSGGSGSGGSGS) connect, while carrying out The gene order of eucaryon Yeast expression optimization.By Series Molecules biological experiment, successfully construct and contain genes of interest PPink-HC plasmids.With reference to PichiaPink^TMExpression specifications, by condition of culture, the improvement of technology, induce table Tetravalence series connection recombinant protein ED III is reached.Using GE brand His trap FF prepacked columns, successful purification goes out the ED III of high concentration Albumen.Finally, the immunogenicity of the recombinant proteins of ED III is detected using the mice serum of DV II, the virus immunities of DV III, is as a result sun Property.Clear the doing of the protein immunization mouse of ED III blood sampling after purification is neutralized into experiment, virus as a result can be effectively neutralized.

SEQUENCE LISTING

<110>China Medical Sciences Academy Medical Biology Institute

<120>A kind of construction method of recombinant proteins of I-IV types series connection dengue virus E D III and its application

<130> 2016

<160> 11

<170> PatentIn version 3.3

<210> 1

<211> 45

<212> DNA

<213> Pichia pastoris

<400> 1

ggcggaagcg gtagcggcgg aagcggtagc ggcggaagcg gtagc 45

<210> 2

<211> 10

<212> DNA

<213> Pichia pastoris

<400> 2

gccaccatgg 10

<210> 3

<211> 15

<212> DNA

<213> Pichia pastoris

<400> 3

gacgaggagg acaag 15

<210> 4

<211> 18

<212> DNA

<213> Pichia pastoris

<400> 4

caccaccatc accaccat 18

<210> 5

<211> 6

<212> RNA

<213> Pichia pastoris

<400> 5

uaauaa 6

<210> 6

<211> 1311

<212> DNA

<213> Dengue virus

<400> 6

gaattcgcca ccatgacagg taaattcaag gtcgttaaag aaatagctga aactcaacac 60

ggtaccattg tcatcagagt tcaatatgag ggagatggtt ccccctgtaa aattcccttt 120

gagataatgg atttggagaa aagacatgtt ttgggtaggc taatcacggt taacccaatt 180

gttactgaga aagattcccc agtgaacatc gaggccgaac caccttttgg ggattcatac 240

atcattattg gtgtcgagcc aggacagcta aaactgtcct ggtttaaaaa gggaggtggt 300

tctggtagtg gtggtagtgg gtctggaggt tccgggtcaa ccggttcttt taaattggag 360

aaagaggtgg ctgaaaccca gcacggaaca gttcttgttc agattaagta cgagggaacc 420

gacgcaccct gtaagatacc cttttcaaca caggatgaaa agggtgtcac tcaaaacggt 480

agattaatca ctgcaaatcc tatcgtcact gacaaggaaa aaccagttaa cattgaagct 540

gaaccccctt tcggagaatc ttacattgtg atcggtgccg gtgaaaaggc actgaagtta 600

tcatggttta agaaaggcgg tgggagtggc tctggaggta gtggatcagg agggtccggt 660

tcaactttcg tcttgaagaa ggaagtttct gaaacgcaac atggcacaat tcttattaaa 720

gtcgaataca aaggcgagga tgctccttgc aaaattcctt tctccactga ggacggacaa 780

ggtaaggctc ataacggaag acttattacc gccaacccag ttgtcaccaa gaaagaagag 840

cctgttaaca tagaagctga acctccattc ggagagtcta atatcgtaat cggaattggg 900

gacaatgcat taaaaataaa ttggtacaaa aagggctcct ccggtggatc aggttctggt 960

ggcagtggaa gtggtggttc cggatcatct ggcaagtttt ccatagacaa agagatggca 1020

gaaacacaac acggaacaac tgttgtgaag gtgaaatatg aaggagctgg tgctccatgt 1080

aaggttccta ttgagatccg agatgtaaat aaggagaaag tagtgggtcg tattatctct 1140

tctactccat ttgctgaaaa cactaatagt gtcaccaata ttgaactgga accacccttt 1200

ggcgactctt atattgttat tggtgtcggc gatagtgcct tgactttgca ttggttccga 1260

aagggtgacg acgacgacaa gcaccaccat caccaccatt aataagcatg c 1311

<210> 7

<211> 28

<212> DNA

<213> Dengue virus

<400> 7

gcgaattcgc caccatgaca ggtaaatt 28

<210> 8

<211> 31

<212> DNA

<213> Dengue virus

<400> 8

ggcatgctta ttagtggtga tggtggtgat g 31

<210> 9

<211> 429

<212> PRT

<213> Dengue virus

<400> 9

Met Thr Gly Lys Phe Lys Val Val Lys Glu Ile Ala Glu Thr Gln His

1 5 10 15

Gly Thr Ile Val Ile Arg Val Gln Tyr Glu Gly Asp Gly Ser Pro Cys

20 25 30

Lys Ile Pro Phe Glu Ile Met Asp Leu Glu Lys Arg His Val Leu Gly

35 40 45

Arg Leu Ile Thr Val Asn Pro Ile Val Thr Glu Lys Asp Ser Pro Val

50 55 60

Asn Ile Glu Ala Glu Pro Pro Phe Gly Asp Ser Tyr Ile Ile Ile Gly

65 70 75 80

Val Glu Pro Gly Gln Leu Lys Leu Ser Trp Phe Lys Lys Gly Gly Gly

85 90 95

Ser Gly Ser Gly Gly Ser Gly Ser Gly Gly Ser Gly Ser Thr Gly Ser

100 105 110

Phe Lys Leu Glu Lys Glu Val Ala Glu Thr Gln His Gly Thr Val Leu

115 120 125

Val Gln Ile Lys Tyr Glu Gly Thr Asp Ala Pro Cys Lys Ile Pro Phe

130 135 140

Ser Thr Gln Asp Glu Lys Gly Val Thr Gln Asn Gly Arg Leu Ile Thr

145 150 155 160

Ala Asn Pro Ile Val Thr Asp Lys Glu Lys Pro Val Asn Ile Glu Ala

165 170 175

Glu Pro Pro Phe Gly Glu Ser Tyr Ile Val Ile Gly Ala Gly Glu Lys

180 185 190

Ala Leu Lys Leu Ser Trp Phe Lys Lys Gly Gly Gly Ser Gly Ser Gly

195 200 205

Gly Ser Gly Ser Gly Gly Ser Gly Ser Thr Phe Val Leu Lys Lys Glu

210 215 220

Val Ser Glu Thr Gln His Gly Thr Ile Leu Ile Lys Val Glu Tyr Lys

225 230 235 240

Gly Glu Asp Ala Pro Cys Lys Ile Pro Phe Ser Thr Glu Asp Gly Gln

245 250 255

Gly Lys Ala His Asn Gly Arg Leu Ile Thr Ala Asn Pro Val Val Thr

260 265 270

Lys Lys Glu Glu Pro Val Asn Ile Glu Ala Glu Pro Pro Phe Gly Glu

275 280 285

Ser Asn Ile Val Ile Gly Ile Gly Asp Asn Ala Leu Lys Ile Asn Trp

290 295 300

Tyr Lys Lys Gly Ser Ser Gly Gly Ser Gly Ser Gly Gly Ser Gly Ser

305 310 315 320

Gly Gly Ser Gly Ser Ser Gly Lys Phe Ser Ile Asp Lys Glu Met Ala

325 330 335

Glu Thr Gln His Gly Thr Thr Val Val Lys Val Lys Tyr Glu Gly Ala

340 345 350

Gly Ala Pro Cys Lys Val Pro Ile Glu Ile Arg Asp Val Asn Lys Glu

355 360 365

Lys Val Val Gly Arg Ile Ile Ser Ser Thr Pro Phe Ala Glu Asn Thr

370 375 380

Asn Ser Val Thr Asn Ile Glu Leu Glu Pro Pro Phe Gly Asp Ser Tyr

385 390 395 400

Ile Val Ile Gly Val Gly Asp Ser Ala Leu Thr Leu His Trp Phe Arg

405 410 415

Lys Gly Asp Asp Asp Asp Lys His His His His His His

420 425

Claims

1. the construction method of the recombinant proteins of a kind of I-IV types series connection dengue virus E D III, it is characterised in that by following each step：

（1）I-IV type Dengue virus genes sequences are put in order through SWISS-MODEL predictions, with flexible small peptide gene tandem, Tandem gene sequence is obtained by yeast biased codons optimization；

（2）In step（1）5 ' ends of gained tandem gene sequence add Kozak sequences, and enterokinase gene and group are added at 3 ' ends His tag sequence, terminator codon sequence ends protein translation is introduced in end；Then expanded by PCR, and in sequence two End introduces restriction endonuclease sites EcoRI/SphI, carries out double digestion, is cloned into plasmid pPink-HC, and be transformed into Pichi strain in PichiaPink Expression systems；Expressed by methanol induction, histidine protein purifying is obtained Obtain the recombinant proteins of I-IV types series connection dengue virus E D III.

2. the construction method of the recombinant proteins of I-IV types according to claim 1 series connection dengue virus E D III, it is characterised in that： The step（1）I-IV type Dengue virus genes sequences be：I type dengue virus type strain EF508198.1, II type Dengue disease Malicious type strain EU249523.1, III type dengue virus type strain GU721069.1 familial combined hyperlipidemia dengue virus type strains EF436282.1。

3. the construction method of the recombinant proteins of I-IV types according to claim 1 series connection dengue virus E D III, it is characterised in that： The step（1）To put in order be the type of-III type of-I type of II type-IV.

4. the construction method of the recombinant proteins of I-IV types according to claim 1 series connection dengue virus E D III, it is characterised in that： The step（2）PCR amplification primer be：

Forward primer X1 kozak -5 ' gcgaattcgccaccatgacaggtaaatt 3 '

Reverse primer X2 End -5 ' ggcatgcttattagtggtgatggtggtgatg 3 '.

5. the construction method of the recombinant proteins of I-IV types according to claim 1 series connection dengue virus E D III, it is characterised in that： The antigen recombinant proteins of ED III of the type dengue virus of gained I-IV strain are applied to dengue virus quadruple vaccine.

6. the construction method of the recombinant proteins of I-IV types according to claim 5 series connection dengue virus E D III, it is characterised in that： The dengue virus quadruple vaccine is, with aluminum hydroxide adjuvant as adjuvant, gained I-IV types series connection dengue virus E D III is recombinated Albumen and aluminum hydroxide adjuvant by volume 1:1 coordinates.