CN107365365B

CN107365365B - Recombinant expression adenovirus cilia protein peptide, adenovirus subunit vaccine and preparation method thereof

Info

Publication number: CN107365365B
Application number: CN201710764909.8A
Authority: CN
Inventors: 田新贵; 周荣; 廖嘉仪; 李潇; 周志超
Original assignee: First Affiliated Hospital of Guangzhou Medical University
Current assignee: First Affiliated Hospital of Guangzhou Medical University
Priority date: 2017-08-30
Filing date: 2017-08-30
Publication date: 2021-01-01
Anticipated expiration: 2037-08-30
Also published as: CN107365365A

Abstract

The invention discloses a recombinant expression adenovirus cilia protein peptide, an adenovirus subunit vaccine and a preparation method thereof, wherein the recombinant expression adenovirus cilia protein peptide has an amino acid sequence shown as SEQ ID No. 2, and the vaccine comprises the adenovirus cilia protein peptide. The adenovirus cilia protein peptide has high expression level, can induce high-titer neutralizing antibodies to an immune mouse, has strong immunogenicity, can be used as an adenovirus subunit vaccine candidate, and has convenient production and purification and low cost; can induce cross-neutralization antibody, can be used as multivalent adenovirus vaccine candidate; can be used as a multivalent adenovirus subunit vaccine candidate when being matched with other types of knob; can be used for preparing immune antigen and detection antigen of broad-spectrum neutralizing active monoclonal antibody or humanized monoclonal antibody.

Description

Recombinant expression adenovirus cilia protein peptide, adenovirus subunit vaccine and preparation method thereof

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to recombinant expressed adenovirus cilia protein peptide, an adenovirus subunit vaccine, a multivalent adenovirus subunit vaccine and a preparation method thereof.

Background

Human Adenovirus (HAdV) can infect various mucosal tissues, such as gastrointestinal tract, respiratory tract, genitourinary tract, keratoconjunctiva of eyes and the like, and causes self-limiting mucosal infection such as acute respiratory tract infection (ARI), acute gastroenteritis, nephritis, keratoconjunctivitis of eyes, cystitis and the like, and even serious lethal infection. Adenovirus is popular and spread rapidly, and in recent years, the adenovirus has outbreak and prevalence in a plurality of countries and regions, thereby seriously threatening the public health and safety of society. People of all ages can be infected by adenovirus, wherein the susceptible people are infants and patients with impaired immune function (such as bone marrow transplantation and human immunodeficiency virus infection), and can cause serious and even fatal infection; adenoviruses are important pathogens of febrile respiratory diseases in the military. The outbreak infection of the HAdV frequently occurs in closed or crowded places such as kindergartens, new barracks and the like, the death rate of severe pneumonia caused by the infection is high in large-scale epidemic, and even the death rate of untreated severe HAdV pneumonia or disseminated diseases can exceed 50 percent. The pneumonia caused by adenovirus is particularly serious, not only can cause heart failure and respiratory failure, but also can cause extrapulmonary diseases, such as encephalitis, liver damage, myocarditis or myocardial damage and the like, even leads to death, and the prognosis is generally poor.

Human adenoviruses have been discovered to date with 7 groups of over 50 serotypes, over 69 genotypes. Adenovirus is one of the main pathogens of pathogenic and toxic pneumonia, and adenovirus of B group, C group and E group can cause respiratory tract infection, wherein adenovirus of 3 type, 7 type, 14 type, 55 type and E group 4 type of human adenovirus B are important pathogens causing acute respiratory tract infection (ARI) and infantile lethal pneumonia, and the adenovirus has strong infectivity, often causes outbreak epidemic, and is reported at home and abroad. The main types of the domestic epidemic strains are 3 types and 7 types, and the highly pathogenic strain HAdV-B55 has a plurality of outbreaks in army and masses in a plurality of provinces in China in recent years, and has become one of the main pathogens causing pneumonia in China.

Among the adenoviruses responsible for acute respiratory tract infection ARI in infants and adults, human adenovirus group B, type 3, 7, 14 and 55, are the most important of several types. Among them, type 3 adenovirus mainly causes severe infection in infants and young children, and generally does not cause severe infection in adults. The symptoms of pneumonia are usually more severe with group B human adenovirus type 7 (HAdV-B7) and human adenovirus type 55 (HAdV-B55) compared to other types of adenovirus infection. Severe infection and outbreak prevalence of HAdV-B7 have been reported in China since the 60's. In recent years, respiratory tract infection and severe pneumonia outbreak epidemic caused by newly appeared HAdV-B55 adenovirus are more and more reported, and outbreak epidemic has been more and more existed in army and colleges with intensive crowds in the whole country, and the outbreak epidemic becomes an important epidemic strain, which causes more attention. Acute respiratory tract infection of infants and adults caused by human adenovirus type 14 (HAdV-B14) is reported in outbreak cases at home and abroad, severe pneumonia is often caused, and particularly, the prevalence of the highly pathogenic HAdV-14p1 strain appearing in recent years seriously threatens public health. HAdV-B55 is a recombinant adenovirus whose genome includes cilia gene mainly from adenovirus type 14, and only the hexon hypervariable region is from adenovirus type 11, and this recombinant mutation renders it non-neutralizable by HAdV-B14 antiserum. Recombination is the main mode of adenovirus evolution, novel adenovirus with changed biological characteristics can be generated by recombination, and new strains with stronger pathogenicity or stronger infectivity appear, so that the human health can be seriously threatened.

The wide range of adenovirus pathogenic and the severity of harm make the prevention and treatment of adenovirus very important, and no specific effective therapeutic drug for adenovirus exists in the world at present, the treatment mainly adopts symptomatic treatment, and the inoculation of adenovirus subunit vaccine is one of the most effective methods for preventing adenovirus infection. Therefore, there is a need to develop a multivalent adenovirus subunit vaccine that can prevent common adenovirus type infections and is suitable for the general population, especially infants.

Only the enteric non-attenuated live vaccines of type 4 and type 7 are currently in use in the U.S. military. The conventional multivalent vaccine preparation method is to separate different types of clinical strains, respectively culture and purify the strains, and prepare the multivalent vaccine after matching in proper proportion, but the multivalent adenovirus subunit vaccine prepared by the method has the defects, firstly, recombination is easy to occur among different types of adenovirus gene groups, and a novel adenovirus with stronger toxicity can be generated; secondly, the replication and propagation efficiency of different types of adenoviruses is different, which leads to the difficulty of compatibility when developing multivalent vaccines. At present, the international human adenovirus subunit vaccines only comprise human adenovirus subunit vaccines 4 and 7, the two vaccines are live oral enteric-coated vaccines and are only used in training camps of new soldiers in American military, and the application of the vaccine obviously reduces the incidence rate of febrile respiratory tract infection of American military. However, the vaccine can only prevent the 4-type and 7-type adenovirus infection of the human, has no preventive effect on other widely prevalent types such as 3-type, 14-type and 55-type, is not suitable for common people or children, and needs to be explored for developing a novel adenovirus subunit vaccine.

Human adenovirus is a non-enveloped icosahedral symmetric structure, and the main capsid proteins comprise hexon and penton, and the penton comprises penton base (penton base) and cilium protein (fiber), which can induce specific neutralizing antibody response in vivo. Ciliated protein is the most prominent receptor binding protein, and its head domain (knob) binds to the virus-specific receptor on the surface of the host cell to complete the adsorption of the virus. The recombinant hexon polypeptide does not or only induces a weak neutralizing antibody response in immunized mice due to its inability to form the correct 3-mer conformation. There are reports in the literature that human adenovirus knob of type 5, type 2, etc. can self-assemble into soluble trimer structure, and can induce neutralizing antibody response after immunizing mice. Coli expression systems are earlier and more widely used in the field of biomedicine than eukaryotic expression systems, and are well-known expression systems with high efficiency, low cost, and good safety. Coli-derived vaccines are high in yield and low in cost and are particularly suitable for the development of new vaccines for all over the world, especially in most developing countries. It would therefore be of further value if an adenoviral subunit vaccine could be efficiently expressed in E.coli.

At present, recombinant protein vaccines expressed by escherichia coli, such as hepatitis C vaccines, are clinically applied, the cost is low, the preparation is convenient, and the knob polypeptides can be expressed in escherichia coli in the prior literature reports, including C group 5 type, 2 type, B group 3 type and other groups. Only type 5 and type 2 have been reported to have a neutralizing effect, and there have been reports demonstrating that cilia protein is a neutralizing antigen, but there has been no report of use as an adenovirus subunit vaccine. Cross-neutralization between different types of Knob of group B adenoviruses has not been reported.

Disclosure of Invention

Based on the above, in order to overcome the defects of the prior art, the invention provides a recombinant expressed adenovirus cilia protein peptide, an adenovirus subunit vaccine, a multivalent adenovirus subunit vaccine and a preparation method thereof.

In order to realize the purpose of the invention, the invention adopts the following technical scheme:

the recombinant expressed adenovirus cilia protein peptide has an amino acid sequence shown as SEQ ID No. 2.

In some embodiments, the recombinantly expressed adenoviral cilia protein peptide is encoded by the base sequence shown in SEQ ID No: 1.

The invention also provides a preparation method of the recombinant expression adenovirus cilia protein peptide, which comprises the following steps:

(1) carrying out PCR amplification by taking a human 11 type adenovirus genome as a template and SEQ ID Nos. 15-16 as a primer pair to obtain a11 type knob gene, carrying out double enzyme digestion on a PCR fragment by BamHI and HindIII, and then connecting the PCR fragment to a prokaryotic expression vector PQE 30;

(2) transforming the chemical competence of the escherichia coli Top10, selecting a single colony for gene sequencing, selecting a colony which is consistent with a theoretical sequence and has no mutation, preserving the strain and extracting a plasmid;

(3) transforming the expression plasmid with correct identification into expression bacteria BL21 competence, selecting a single colony, inoculating the single colony to an LB culture medium containing Amp, shaking, adding IPTG for induction, and centrifugally collecting thalli;

(4) resuspending the bacteria with PBS buffer solution, lysing the bacteria with lysozyme or ultrasonic wave, taking the supernatant after high-speed centrifugation, purifying with a nickel column, washing and eluting with gradient imidazole, and removing imidazole from the eluent to obtain the recombinant expressed adenovirus cilia protein peptide.

The invention also provides an adenovirus subunit vaccine which comprises the recombinant expression adenovirus cilia protein peptide.

In some of these embodiments, the vaccine further comprises an aluminum phosphate gel adjuvant, and the recombinantly expressed adenoviral ciliated protein peptide is in the same volume ratio as the aluminum phosphate gel adjuvant.

The invention also provides a multivalent adenovirus subunit vaccine which comprises the recombinant expression adenovirus cilia protein peptide.

The invention also provides a multivalent adenovirus subunit vaccine which comprises the recombinant expression adenovirus cilia protein peptide and the recombinant expression adenovirus cilia protein peptide of the amino acid sequence shown in SEQ ID No. 4.

In some of these embodiments, the multivalent adenovirus subunit vaccine further comprises an aluminum phosphate gel adjuvant, and the recombinantly expressed adenovirus cilia protein peptide is in the same volume ratio as the aluminum phosphate gel adjuvant.

The invention also provides a multivalent adenovirus subunit vaccine which comprises the recombinant expression adenovirus cilia protein peptide, the recombinant expression adenovirus cilia protein peptide of the amino acid sequence shown in SEQ ID No. 4 and the recombinant expression adenovirus cilia protein peptide of the amino acid sequence shown in SEQ ID No. 6.

The invention also provides a monoclonal antibody, which is prepared by adopting the recombinant expression adenovirus cilia protein peptide as an immunogen or a detection antigen.

Compared with the prior art, the invention has the following beneficial effects:

1. the 11-type knob gene is connected to PQE30 after double enzyme digestion, then BL21(DE3) is transformed to express, bacteria are collected, lysozyme is used for cracking, and a nickel column is used for purification; the purified knob polypeptide is shown as a homotrimer structure, has high expression quantity, can induce a high-titer neutralizing antibody by an immune mouse, has strong immunogenicity, can be used as an adenovirus subunit vaccine candidate, and has convenient production and purification and low cost;

2. the human adenovirus type 11knob of the invention can induce strong antibodies aiming at the cross neutralization of human adenovirus types 7, 11, 14 and 55, and can be used as multivalent adenovirus subunit vaccine candidates; the mixture of 11-type adenovirus and other types of knob can also be used as a multivalent adenovirus subunit vaccine candidate;

3. the recombinant knob polypeptide can be used for preparing immune antigens and detection antigens of broad-spectrum neutralizing active monoclonal antibodies or humanized monoclonal antibodies.

Drawings

The following drawings are included to illustrate specific embodiments of the invention and are not intended to limit the scope of the invention as defined in the claims.

FIG. 1 is a Coomassie blue stained SDS-PAGE of purified products of adenovirus cilia protein knob in example 1 of the present invention, wherein-1 is an unboiled sample and-2 is a boiled sample;

FIG. 2 shows the results of the experiments of cell micro-neutralization of the serum of mice immunized with recombinant knob protein against adenovirus of each type in example 2;

FIG. 3 shows the result of ELISA detection of serum (10000-fold dilution) of mice immunized with recombinant knob protein in example 2 of the present invention.

Detailed Description

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. As used herein, the term "and/or" includes any and all combinations of one or more of the associated listed items.

To facilitate an understanding of the invention, the invention will now be described more fully with reference to the accompanying drawings. Preferred embodiments of the present invention are shown in the drawings. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete.

The reagents and starting materials used in the following examples were all commercially available unless otherwise specified.

In the examples of the present specification, Ad3 is HAdv3-gz01 virus strain, genome-wide Genbank number: DQ 099432. The Ad7 virus strain (Ad7-GZ08) described in the examples of the present specification has the complete genome sequence GenBank number: GQ 478341.1; ad14 virus strain (Ad14-GZ01) genome-wide sequence GenBank accession No.: JQ 824845.1; ad55 virus strain (Ad55-Shanxi-Y16) hexon gene sequence GenBank number: KF 911353.1; ad4 virus strain (Ad4-GZ01) genome-wide sequence GenBank accession No.: KF 006344.1; replication-defective Ad5 virus strain (adesy) was derived from pAdEasy-1, with GenBank No.: AY 370909.2; the whole genome sequence GenBank number of Ad11 virus strain (Slobitski strain): AF 532578.1. The knob gene in the examples of the present specification is identical to those of these strains, and the amino acid sequence is free from mutation; these strains were also used in neutralization experiments and the like in the present examples.

Example 1 expression of recombinant human adenovirus knob polypeptide

1. Carrying out Escherichia coli preference codon optimization on adenovirus knob genes of human types 3, 7, 14, 4 and 5 to adapt to Escherichia coli expression, respectively synthesizing genes, and cloning into a prokaryotic expression vector PQE30(Qiagen company);

2. PCR was carried out using human adenovirus type 11 and type 55 genomes as templates and primer pairs A11Kn-RH/A11Kn-UB and A55Kn-RH/A55Kn-UB, respectively, to amplify PCR fragments of type 11 and type 55knob genes, BamHI and HindIII, which were then ligated to the above prokaryotic expression vector PQE30 (Qiagen), transform Escherichia coli Top10 chemically competent cells, and select single colonies for gene sequencing. Taking bacterial colonies which are consistent with the theoretical sequence and have no mutation, preserving the seeds and extracting plasmids;

A11Kn-RH:aattAAGCTTTTAgtcgtcttctctgatgtagta(SEQ ID No：15)

A11Kn-UB:catggatccaacaacatttgcattgatgacaa(SEQ ID No：16)

A55Kn-RH:AGCTAATTAAGCttagtcgtcttctctgatgtagta(SEQ ID No：17)

A55Kn-UB:ACCATCACGGATCCaacaacatttgcattgatgac(SEQ ID No：18)；

3. the correctly identified expression plasmid transformed expression bacteria BL21(DE3) are competent, a single colony is selected and inoculated with 5ml of LB (Amp with 100 ug/ml) culture medium and shaken at 37 ℃ overnight, all the colonies are inoculated with 200ml of LB (Amp with 100 ug/ml) culture medium and shaken at 37 ℃ for 3-4hr, 0.5mM IPTG is added for induction at 37 ℃ for 4-5 hours or at low temperature (18 ℃) overnight, and the bacteria are collected by centrifugation. Resuspending the cells in PBS buffer (1mM EDTA, 10% glycerol, 1% Triton X100, 10mM imidazole), lysing the cells with lysozyme (2mg enzyme/g cells) or sonication (3s/3s, 60 times), centrifuging at 12000g at high speed, collecting the supernatant, purifying with a nickel column, washing and eluting with gradient imidazole of 10mM, 20mM, 200Mm, 400mM, centrifuging the eluate with a 10kDa ultrafiltration tube to replace PBS buffer (1mM EDTA, 10% glycerol) to remove imidazole, and freezing the purified protein at-20 ℃.

The purified protein exhibits a homotrimeric structure. Inducing recombinant proteins of Ad3, Ad4, Ad5, Ad7 and Ad14Knob for 5 hours at 37 ℃ by using 0.5mM IPTG, expressing and purifying; inducing the recombinant proteins Ad11Knob and Ad55Knob to be 0.5mM IPTG at 18 ℃ overnight, expressing and purifying; the Ad4, Ad5, Ad7 and Ad14knob proteins have high expression level, are soluble and are tripolymers; ad3knob protein is soluble, but the amount of trimer is less; the Ad11 and Ad55knob proteins were expressed soluble, as trimers, but in relatively low amounts (see figure 1).

The recombinant human adenovirus knob polypeptide has the following basic group composition and amino acid composition respectively:

1. ad 11-Knob: the base sequence is shown as SEQ ID No. 1, and the amino acid sequence is shown as SEQ ID No. 2;

2. ad 3-Knob: the base sequence is shown as SEQ ID No. 3, and the amino acid sequence is shown as SEQ ID No. 4;

3. ad 4-Knob: the base sequence is shown as SEQ ID No. 5, and the amino acid sequence is shown as SEQ ID No. 6;

4. ad 7-Knob: the base sequence is shown as SEQ ID No. 7, and the amino acid sequence is shown as SEQ ID No. 8;

5. ad 14-Knob: the base sequence is shown as SEQ ID No. 9, and the amino acid sequence is shown as SEQ ID No. 10;

6. ad 55-Knob: the base sequence is shown as SEQ ID No. 11, and the amino acid sequence is shown as SEQ ID No. 12;

7. ad 5-Knob: the base sequence is shown as SEQ ID No. 13, and the amino acid sequence is shown as SEQ ID No. 14.

EXAMPLE 2 immunogenicity testing of recombinant proteins

To analyze the immunogenicity of the recombinant proteins of example 1, mice were immunized four times after emulsification with the recombinant proteins plus aluminum phosphate adjuvant (ADJU-PHOS, Brenntag Biosector), each mouse was immunized 40ug protein each time, and serum was collected 7 days after the last immunization for ELISA detection and cell microneutralization.

The results are shown in FIGS. 2 and 3, and indicate that each type of recombinant knob immunized mice can induce high-titer antibody responses, and the neutralizing antibody titer of each type of adenovirus is about 500-4000 (FIG. 2), and the titer can reach 10 by ELISA detection using recombinant protein antigen⁶-10⁷(FIG. 3).

Example 3 analysis of the Cross-neutralization of mouse anti-adenovirus fiber-coat protein head (knob) sera against different types of adenovirus

The anti-cilia protein head serum of example 2 after four immunizations was collected for cross-neutralization assay, and the results are shown in table 1.

TABLE 1 Cross-neutralization of different adenovirus types by the mouse anti-adenovirus fiber-coat protein head serum

No neutralization detected

Table 1 the results found: some types have cross-neutralization function on various types of adenoviruses in the same group, and the cross-neutralization function is very strong. The Ad11 type Knob antiserum can neutralize human adenovirus types 11, 7, 14 and 55. Therefore, the Ad11 type Knob can be used as a multivalent adenovirus vaccine candidate for preventing human adenovirus types 11, 7, 14 and 55.

Example 4 immunization of mice with equal mixtures of recombinant knobs of different types

According to the results of the type-to-type cross reaction, different combination modes are adopted to prepare multivalent adenovirus candidate vaccines, one is that the type-3 and type-11 adenovirus recombinant knob are mixed in vitro with the same mass and then added with aluminum phosphate adjuvant to immunize mice, and each mouse is immunized with 50ug (25 ug each) of total protein each time; the other is adenovirus 3 type, adenovirus 4 type and adenovirus 11 recombinant knob which is mixed in vitro with same mass and then added with aluminum phosphate adjuvant to immunize mice, wherein each mouse is immunized with 60ug (20 ug each) of total protein each time; intramuscular injection, collecting antiserum after twice immunization, performing in vitro cell micro-neutralization experiment, and detecting the neutralizing titer of the antiserum to various types of adenoviruses.

The results show that the mice immunized after mixing the 3 type and 11 type knobs can induce neutralizing antibodies against the 3 type, 7 type, 11 type, 14 type and 55 type adenoviruses, the neutralizing titer is 1000-2000, the mice can be used as a 5-valent adenovirus subunit vaccine, and the neutralizing titer difference between the types is not significant (Table 2).

TABLE 2 neutralization of various adenovirus types by antiserum from immunized mice after mixing human adenovirus type 3 and 11knob

Mice immunized with mixed 3-, 4-and 11-type knobs can induce neutralizing antibodies against 3-, 4-, 7-, 11-, 14-and 55-type adenoviruses, the neutralizing titer is 1000-and 4000-valent, and the neutralizing titer can be used as a 6-valent adenovirus candidate vaccine, and the neutralizing titer difference among the types is not significant (Table 3).

TABLE 3 neutralization of various adenovirus types by antiserum from immunized mice after mixing human adenovirus types 3, 4 and 11knob

The technical features of the embodiments described above may be arbitrarily combined, and for the sake of brevity, all possible combinations of the technical features in the embodiments described above are not described, but should be considered as being within the scope of the present specification as long as there is no contradiction between the combinations of the technical features.

The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.

Sequence listing

<110> Guangzhou medical university affiliated first hospital

<120> recombinant expression adenovirus cilia protein peptide, adenovirus subunit vaccine and preparation method thereof

<160> 18

<170> SIPOSequenceListing 1.0

<210> 1

<211> 609

<212> DNA

<213> Artificial sequence (2 Ambystoma latex x Ambystoma jeffersonia)

<400> 1

aacaacattt gcattgatga caatattaac accttatgga caggagtcaa ccccaccgaa 60

gccaactgtc aaatcatgaa ctccagtgaa tctaatgatt gcaaattaat tctaacacta 120

gttaaaactg gagcactagt cactgcattt gtttatgtta taggagtatc taacaatttt 180

aatatgctaa ctacacacag aaatataaat tttactgcag agctgttttt cgattctact 240

ggtaatttac taactagact ctcatccctc aaaactccac ttaatcataa atcaggacaa 300

aacatggcta ctggtgccat tactaatgct aaaggtttca tgcccagcac gactgcctat 360

cctttcaatg ataattctag agaaaaagaa aactacattt acggaacttg ttactacaca 420

gctagtgatc gcactgcttt tcccattgac atatctgtca tgcttaaccg aagagcaata 480

aatgacgaga catcatattg tattcgtata acttggtcct ggaacacagg agatgcccca 540

gaggtgcaaa cctctgctac aaccctagtc acctccccat ttacctttta ctacatcaga 600

gaagacgac 609

<210> 2

<211> 203

<212> PRT

<213> Artificial sequence (2 Ambystoma latex x Ambystoma jeffersonia)

<400> 2

Asn Asn Ile Cys Ile Asp Asp Asn Ile Asn Thr Leu Trp Thr Gly Val

1 5 10 15

Asn Pro Thr Glu Ala Asn Cys Gln Ile Met Asn Ser Ser Glu Ser Asn

20 25 30

Asp Cys Lys Leu Ile Leu Thr Leu Val Lys Thr Gly Ala Leu Val Thr

35 40 45

Ala Phe Val Tyr Val Ile Gly Val Ser Asn Asn Phe Asn Met Leu Thr

50 55 60

Thr His Arg Asn Ile Asn Phe Thr Ala Glu Leu Phe Phe Asp Ser Thr

65 70 75 80

Gly Asn Leu Leu Thr Arg Leu Ser Ser Leu Lys Thr Pro Leu Asn His

85 90 95

Lys Ser Gly Gln Asn Met Ala Thr Gly Ala Ile Thr Asn Ala Lys Gly

100 105 110

Phe Met Pro Ser Thr Thr Ala Tyr Pro Phe Asn Asp Asn Ser Arg Glu

115 120 125

Lys Glu Asn Tyr Ile Tyr Gly Thr Cys Tyr Tyr Thr Ala Ser Asp Arg

130 135 140

Thr Ala Phe Pro Ile Asp Ile Ser Val Met Leu Asn Arg Arg Ala Ile

145 150 155 160

Asn Asp Glu Thr Ser Tyr Cys Ile Arg Ile Thr Trp Ser Trp Asn Thr

165 170 175

Gly Asp Ala Pro Glu Val Gln Thr Ser Ala Thr Thr Leu Val Thr Ser

180 185 190

Pro Phe Thr Phe Tyr Tyr Ile Arg Glu Asp Asp

195 200

<210> 3

<211> 588

<212> DNA

<213> Artificial sequence (2 Ambystoma latex x Ambystoma jeffersonia)

<400> 3

aatagcattg cactgaaaaa taacaccctg tggaccggtc cgaaaccgga agccaattgt 60

attattgaat atggcaaaga aaatccggat agtaaactga ccttaattct ggttaaaaat 120

ggcggcattg ttaatggcta tgtgaccctg atgggcgcct cagattatgt taataccctg 180

tttaaaaaca aaaatgtgag cattaatgtg gaactgtatt ttgatgcaac cggtcatatt 240

ctgccggatc tgtcaagtct gaaaaccgat ctgcagctga aatacaaaca gaccacccat 300

tttagcgcac gcggctttat gccgtctacc accgcctatc cgtttgtgct gccgaatgca 360

ggcaccgata acgaaaatta tatttttggt cagtgttatt acaaggcaag cgatggcgca 420

ctgtttccgc tggaagtgac cgtgaccctg aataagcgtc tgccggatag tcgtaccagc 480

tatgtgatta cctttctgtg gagcctgaat gcaggcttag ccccggaaac cacccaggcc 540

accttaatta cctctccgtt tacctttagc tatattaccg aagatgat 588

<210> 4

<211> 196

<212> PRT

<213> Artificial sequence (2 Ambystoma latex x Ambystoma jeffersonia)

<400> 4

Asn Ser Ile Ala Leu Lys Asn Asn Thr Leu Trp Thr Gly Pro Lys Pro

1 5 10 15

Glu Ala Asn Cys Ile Ile Glu Tyr Gly Lys Glu Asn Pro Asp Ser Lys

20 25 30

Leu Thr Leu Ile Leu Val Lys Asn Gly Gly Ile Val Asn Gly Tyr Val

35 40 45

Thr Leu Met Gly Ala Ser Asp Tyr Val Asn Thr Leu Phe Lys Asn Lys

50 55 60

Asn Val Ser Ile Asn Val Glu Leu Tyr Phe Asp Ala Thr Gly His Ile

65 70 75 80

Leu Pro Asp Leu Ser Ser Leu Lys Thr Asp Leu Gln Leu Lys Tyr Lys

85 90 95

Gln Thr Thr His Phe Ser Ala Arg Gly Phe Met Pro Ser Thr Thr Ala

100 105 110

Tyr Pro Phe Val Leu Pro Asn Ala Gly Thr Asp Asn Glu Asn Tyr Ile

115 120 125

Phe Gly Gln Cys Tyr Tyr Lys Ala Ser Asp Gly Ala Leu Phe Pro Leu

130 135 140

Glu Val Thr Val Thr Leu Asn Lys Arg Leu Pro Asp Ser Arg Thr Ser

145 150 155 160

Tyr Val Ile Thr Phe Leu Trp Ser Leu Asn Ala Gly Leu Ala Pro Glu

165 170 175

Thr Thr Gln Ala Thr Leu Ile Thr Ser Pro Phe Thr Phe Ser Tyr Ile

180 185 190

Thr Glu Asp Asp

195

<210> 5

<211> 576

<212> DNA

<213> Artificial sequence (2 Ambystoma latex x Ambystoma jeffersonia)

<400> 5

ggcgcaatta tggccggtaa caaagattat gataaactga ccctgtggac caccccagat 60

ccgtctccga attgtcagat tctggcagaa aatgatgcca aactgaccct gtgtctgacc 120

aaatgtgata gtcagatttt agccaccgtg agcgtgctgg ttgttcgcag cggtaatctg 180

aatccgatta ccggcaccgt gagtagtgca caggtgtttc tgcgctttga tgcaaatggc 240

gtgttactga ccgaacatag caccctgaaa aaatattggg gctatcgtca gggcgatagc 300

attgatggta ctccgtatac caatgccgtt ggctttatgc ctaactcaac cgcctatccg 360

aaaacccagt cttcaaccac caaaaacaac attgtgggcc aggtgtatat gaatggtgac 420

gtgtctaaac cgatgctgtt aaccattacc ttaaacggca cagatgatac cacctcagcc 480

tatagtattt cctttagcta tacctggacc aatggctctt atattggtgc aacctttggc 540

gccaattctt atacctttag ttatattgca caggaa 576

<210> 6

<211> 192

<212> PRT

<213> Artificial sequence (2 Ambystoma latex x Ambystoma jeffersonia)

<400> 6

Gly Ala Ile Met Ala Gly Asn Lys Asp Tyr Asp Lys Leu Thr Leu Trp

1 5 10 15

Thr Thr Pro Asp Pro Ser Pro Asn Cys Gln Ile Leu Ala Glu Asn Asp

20 25 30

Ala Lys Leu Thr Leu Cys Leu Thr Lys Cys Asp Ser Gln Ile Leu Ala

35 40 45

Thr Val Ser Val Leu Val Val Arg Ser Gly Asn Leu Asn Pro Ile Thr

50 55 60

Gly Thr Val Ser Ser Ala Gln Val Phe Leu Arg Phe Asp Ala Asn Gly

65 70 75 80

Val Leu Leu Thr Glu His Ser Thr Leu Lys Lys Tyr Trp Gly Tyr Arg

85 90 95

Gln Gly Asp Ser Ile Asp Gly Thr Pro Tyr Thr Asn Ala Val Gly Phe

100 105 110

Met Pro Asn Ser Thr Ala Tyr Pro Lys Thr Gln Ser Ser Thr Thr Lys

115 120 125

Asn Asn Ile Val Gly Gln Val Tyr Met Asn Gly Asp Val Ser Lys Pro

130 135 140

Met Leu Leu Thr Ile Thr Leu Asn Gly Thr Asp Asp Thr Thr Ser Ala

145 150 155 160

Tyr Ser Ile Ser Phe Ser Tyr Thr Trp Thr Asn Gly Ser Tyr Ile Gly

165 170 175

Ala Thr Phe Gly Ala Asn Ser Tyr Thr Phe Ser Tyr Ile Ala Gln Glu

180 185 190

<210> 7

<211> 609

<212> DNA

<213> Artificial sequence (2 Ambystoma latex x Ambystoma jeffersonia)

<400> 7

aacaatattt gtattgatga taatattaat accctgtgga ccggcgtgaa tccgacccgt 60

gccaattgtc agattatggc ctctagcgaa agcaatgatt gtaaactgat tctgacctta 120

gttaaaaccg gcgccttagt gaccgcattt gtgtatgtga ttggtgtgtc taatgatttt 180

aatatgctga ccacccataa aaatattaat tttaccgcag aactgttctt tgatagcacc 240

ggcaatctgt taacctcatt atcttctctg aaaaccccgc tgaatcataa atctggtcag 300

aatatggcaa ccggtgcact gaccaatgcc aaaggcttta tgccgagtac caccgcctat 360

ccgtttaatg tcaactctcg cgaaaaagaa aattatatct acggcacctg ttattatacc 420

gcaagcgatc ataccgcatt tccgattgat attagcgtga tgctgaatca gcgcgcctta 480

aacaacgaaa ccagctattg tattcgtgtt acctggagtt ggaataccgg cgttgccccg 540

gaagtgcaga cctcagccac caccctggtt accagtccgt ttacctttta ttatattcgc 600

gaagatgat 609

<210> 8

<211> 203

<212> PRT

<213> Artificial sequence (2 Ambystoma latex x Ambystoma jeffersonia)

<400> 8

Asn Asn Ile Cys Ile Asp Asp Asn Ile Asn Thr Leu Trp Thr Gly Val

1 5 10 15

Asn Pro Thr Arg Ala Asn Cys Gln Ile Met Ala Ser Ser Glu Ser Asn

20 25 30

Asp Cys Lys Leu Ile Leu Thr Leu Val Lys Thr Gly Ala Leu Val Thr

35 40 45

Ala Phe Val Tyr Val Ile Gly Val Ser Asn Asp Phe Asn Met Leu Thr

50 55 60

Thr His Lys Asn Ile Asn Phe Thr Ala Glu Leu Phe Phe Asp Ser Thr

65 70 75 80

Gly Asn Leu Leu Thr Ser Leu Ser Ser Leu Lys Thr Pro Leu Asn His

85 90 95

Lys Ser Gly Gln Asn Met Ala Thr Gly Ala Leu Thr Asn Ala Lys Gly

100 105 110

Phe Met Pro Ser Thr Thr Ala Tyr Pro Phe Asn Val Asn Ser Arg Glu

115 120 125

Lys Glu Asn Tyr Ile Tyr Gly Thr Cys Tyr Tyr Thr Ala Ser Asp His

130 135 140

Thr Ala Phe Pro Ile Asp Ile Ser Val Met Leu Asn Gln Arg Ala Leu

145 150 155 160

Asn Asn Glu Thr Ser Tyr Cys Ile Arg Val Thr Trp Ser Trp Asn Thr

165 170 175

Gly Val Ala Pro Glu Val Gln Thr Ser Ala Thr Thr Leu Val Thr Ser

180 185 190

Pro Phe Thr Phe Tyr Tyr Ile Arg Glu Asp Asp

195 200

<210> 9

<211> 603

<212> DNA

<213> Artificial sequence (2 Ambystoma latex x Ambystoma jeffersonia)

<400> 9

aataacattt gtattgatga taatattaat accctgtgga ccggtgtgaa tccgaccgaa 60

gccaattgtc agatgatgga tagtagcgaa agcaatgatt gtaaactgat tctgacctta 120

gttaaaaccg gcgcactggt gaccgccttt gtgtatgtga ttggcgtttc aaataacttt 180

aatatgttaa ccacctatcg taatattaat tttaccgcag aactgttctt cgatagcgca 240

ggcaatctgc tgacctctct gtctagtctg aaaaccccgc tgaatcataa aagtggtcag 300

aatatggcaa ccggtgccat taccaatgcc aagagcttta tgccgagcac caccgcctat 360

ccgtttaaca acaattcacg cgaaaattat atatacggca cctgtcatta taccgcctca 420

gatcataccg cctttccgat tgatattagt gttatgctga atcagcgtgc cattcgtgca 480

gataccagct attgtattcg cattacctgg agttggaata ccggcgatgc cccggaaggc 540

cagacctctg caaccaccct ggtgaccagt ccgtttacct tttattatat tcgcgaagat 600

gat 603

<210> 10

<211> 201

<212> PRT

<213> Artificial sequence (2 Ambystoma latex x Ambystoma jeffersonia)

<400> 10

Asn Asn Ile Cys Ile Asp Asp Asn Ile Asn Thr Leu Trp Thr Gly Val

1 5 10 15

Asn Pro Thr Glu Ala Asn Cys Gln Met Met Asp Ser Ser Glu Ser Asn

20 25 30

Asp Cys Lys Leu Ile Leu Thr Leu Val Lys Thr Gly Ala Leu Val Thr

35 40 45

Ala Phe Val Tyr Val Ile Gly Val Ser Asn Asn Phe Asn Met Leu Thr

50 55 60

Thr Tyr Arg Asn Ile Asn Phe Thr Ala Glu Leu Phe Phe Asp Ser Ala

65 70 75 80

Gly Asn Leu Leu Thr Ser Leu Ser Ser Leu Lys Thr Pro Leu Asn His

85 90 95

Lys Ser Gly Gln Asn Met Ala Thr Gly Ala Ile Thr Asn Ala Lys Ser

100 105 110

Phe Met Pro Ser Thr Thr Ala Tyr Pro Phe Asn Asn Asn Ser Arg Glu

115 120 125

Asn Tyr Ile Tyr Gly Thr Cys His Tyr Thr Ala Ser Asp His Thr Ala

130 135 140

Phe Pro Ile Asp Ile Ser Val Met Leu Asn Gln Arg Ala Ile Arg Ala

145 150 155 160

Asp Thr Ser Tyr Cys Ile Arg Ile Thr Trp Ser Trp Asn Thr Gly Asp

165 170 175

Ala Pro Glu Gly Gln Thr Ser Ala Thr Thr Leu Val Thr Ser Pro Phe

180 185 190

Thr Phe Tyr Tyr Ile Arg Glu Asp Asp

195 200

<210> 11

<211> 609

<212> DNA

<213> Artificial sequence (2 Ambystoma latex x Ambystoma jeffersonia)

<400> 11

aacaacattt gcattgatga caatattaac accctgtgga caggaattaa ccccaccgaa 60

gccaactgtc aaatgatgga ctccagtgaa tctaatgatt gcaaattaat tctaacacta 120

gttaaaactg gagccctagt cactgcattt gtttatgtta taggagtatc taacaatttt 180

aatatgctaa ctacatacag aaatataaat tttactgcgg agctgttttt tgattctgcg 240

ggtaatttac taactagcct gtcatcccta aaaactccac ttaatcataa atcaggacaa 300

aacatggcta ctggtgccat tactaatgct aaaagtttca tgcccagcac aactgcttat 360

cctttcaata ataattctag agaaaaagaa aactacattt acggaacctg tcactacaca 420

gctagtgatc acactgcttt tcccattgac atatctgtca tgcttaacca aagagcaata 480

agagctgata catcatattg tattcgtata acttggtcct ggaacacagg agatgcccca 540

gaggggcaaa cctctgctac aaccctagtt acctccccat ttacctttta ctacatcaga 600

gaagacgac 609

<210> 12

<211> 203

<212> PRT

<213> Artificial sequence (2 Ambystoma latex x Ambystoma jeffersonia)

<400> 12

Asn Asn Ile Cys Ile Asp Asp Asn Ile Asn Thr Leu Trp Thr Gly Ile

1 5 10 15

Asn Pro Thr Glu Ala Asn Cys Gln Met Met Asp Ser Ser Glu Ser Asn

20 25 30

Asp Cys Lys Leu Ile Leu Thr Leu Val Lys Thr Gly Ala Leu Val Thr

35 40 45

Ala Phe Val Tyr Val Ile Gly Val Ser Asn Asn Phe Asn Met Leu Thr

50 55 60

Thr Tyr Arg Asn Ile Asn Phe Thr Ala Glu Leu Phe Phe Asp Ser Ala

65 70 75 80

Gly Asn Leu Leu Thr Ser Leu Ser Ser Leu Lys Thr Pro Leu Asn His

85 90 95

Lys Ser Gly Gln Asn Met Ala Thr Gly Ala Ile Thr Asn Ala Lys Ser

100 105 110

Phe Met Pro Ser Thr Thr Ala Tyr Pro Phe Asn Asn Asn Ser Arg Glu

115 120 125

Lys Glu Asn Tyr Ile Tyr Gly Thr Cys His Tyr Thr Ala Ser Asp His

130 135 140

Thr Ala Phe Pro Ile Asp Ile Ser Val Met Leu Asn Gln Arg Ala Ile

145 150 155 160

Arg Ala Asp Thr Ser Tyr Cys Ile Arg Ile Thr Trp Ser Trp Asn Thr

165 170 175

Gly Asp Ala Pro Glu Gly Gln Thr Ser Ala Thr Thr Leu Val Thr Ser

180 185 190

Pro Phe Thr Phe Tyr Tyr Ile Arg Glu Asp Asp

195 200

<210> 13

<211> 585

<212> DNA

<213> Artificial sequence (2 Ambystoma latex x Ambystoma jeffersonia)

<400> 13

ggcgccatta ccgtgggcaa caaaaacaat gataaactga ccctgtggac caccccggcc 60

ccgagtccga attgtcgctt aaatgcagaa aaagatgcca aactgacctt agtgctgacc 120

aaatgtggta gtcagattct ggccaccgtg agcgtgttag cagtgaaagg ctcactggcc 180

ccgattagcg gcaccgttca gagcgcacat ctgattattc gctttgatga aaatggcgtg 240

ctgttaaaca atagctttct cgatccggaa tattggaatt ttcgtaacgg agacctaacc 300

gaaggcaccg catataccaa tgcagttggc tttatgccga atctgtcagc ctatccgaaa 360

tcacatggga aaaccgccaa aagtaatatt gtgtctcagg tgtatctgaa tggcgataaa 420

accaaaccgg tgaccttaac cattaccctg aatggcaccc aggaaaccgg cgataccacc 480

ccgtctgcct atagtatgtc attttcttgg gattggagcg gtcataatta tattaacgag 540

atttttgcaa cctctagcta tacctttagt tatattgcac aggaa 585

<210> 14

<211> 195

<212> PRT

<213> Artificial sequence (2 Ambystoma latex x Ambystoma jeffersonia)

<400> 14

Gly Ala Ile Thr Val Gly Asn Lys Asn Asn Asp Lys Leu Thr Leu Trp

1 5 10 15

Thr Thr Pro Ala Pro Ser Pro Asn Cys Arg Leu Asn Ala Glu Lys Asp

20 25 30

Ala Lys Leu Thr Leu Val Leu Thr Lys Cys Gly Ser Gln Ile Leu Ala

35 40 45

Thr Val Ser Val Leu Ala Val Lys Gly Ser Leu Ala Pro Ile Ser Gly

50 55 60

Thr Val Gln Ser Ala His Leu Ile Ile Arg Phe Asp Glu Asn Gly Val

65 70 75 80

Leu Leu Asn Asn Ser Phe Leu Asp Pro Glu Tyr Trp Asn Phe Arg Asn

85 90 95

Gly Asp Leu Thr Glu Gly Thr Ala Tyr Thr Asn Ala Val Gly Phe Met

100 105 110

Pro Asn Leu Ser Ala Tyr Pro Lys Ser His Gly Lys Thr Ala Lys Ser

115 120 125

Asn Ile Val Ser Gln Val Tyr Leu Asn Gly Asp Lys Thr Lys Pro Val

130 135 140

Thr Leu Thr Ile Thr Leu Asn Gly Thr Gln Glu Thr Gly Asp Thr Thr

145 150 155 160

Pro Ser Ala Tyr Ser Met Ser Phe Ser Trp Asp Trp Ser Gly His Asn

165 170 175

Tyr Ile Asn Glu Ile Phe Ala Thr Ser Ser Tyr Thr Phe Ser Tyr Ile

180 185 190

Ala Gln Glu

195

<210> 15

<211> 34

<212> DNA

<213> Artificial sequence (2 Ambystoma latex x Ambystoma jeffersonia)

<400> 15

aattaagctt ttagtcgtct tctctgatgt agta 34

<210> 16

<211> 32

<212> DNA

<213> Artificial sequence (2 Ambystoma latex x Ambystoma jeffersonia)

<400> 16

catggatcca acaacatttg cattgatgac aa 32

<210> 17

<211> 36

<212> DNA

<213> Artificial sequence (2 Ambystoma latex x Ambystoma jeffersonia)

<400> 17

agctaattaa gcttagtcgt cttctctgat gtagta 36

<210> 18

<211> 35

<212> DNA

<213> Artificial sequence (2 Ambystoma latex x Ambystoma jeffersonia)

<400> 18

accatcacgg atccaacaac atttgcattg atgac 35

Claims

1. An adenoviral subunit vaccine, wherein said vaccine comprises recombinantly expressed adenoviral ciliated protein peptides; the recombinant expressed adenovirus cilia protein peptide is an amino acid sequence shown in SEQ ID No. 2.

2. The adenoviral subunit vaccine of claim 1, wherein the method of preparing the recombinantly expressed adenoviral ciliin peptide comprises the steps of:

3. The adenoviral subunit vaccine of claim 1, further comprising an aluminum phosphate gel adjuvant, wherein the recombinantly expressed adenoviral ciliated protein peptide is in the same volume ratio as the aluminum phosphate gel adjuvant.

4. A multivalent adenovirus subunit vaccine is characterized in that the vaccine comprises recombinant expressed adenovirus cilia protein peptide, wherein the recombinant expressed adenovirus cilia protein peptide is an amino acid sequence shown in SEQ ID No. 2 or is encoded by a base sequence shown in SEQ ID No. 1.

5. The multivalent adenovirus subunit vaccine of claim 4, wherein the vaccine is for use as a vaccine

The recombinant adenovirus cilia protein peptide also comprises an aluminum phosphate gel adjuvant, and the recombinant adenovirus cilia protein peptide and the aluminum phosphate gel adjuvant are matched in the same volume ratio.

6. A nucleic acid encoding the recombinantly-expressed adenoviral cilia protein peptide of claim 1, wherein the base sequence of the nucleic acid is as set forth in SEQ ID No: 1.

7. A multivalent adenovirus subunit vaccine is characterized in that the vaccine comprises adenovirus cilia protein peptide expressed by an amino acid sequence shown as SEQ ID No. 2 or encoded by a base sequence shown as SEQ ID No. 1 and adenovirus cilia protein peptide expressed by recombination of the amino acid sequence shown as SEQ ID No. 4.

8. A multivalent adenovirus subunit vaccine is characterized in that the vaccine comprises adenovirus cilia protein peptide expressed by an amino acid sequence shown as SEQ ID No. 2 or encoded by a base sequence shown as SEQ ID No. 1, adenovirus cilia protein peptide expressed by recombination of the amino acid sequence shown as SEQ ID No. 4, and adenovirus cilia protein peptide expressed by recombination of the amino acid sequence shown as SEQ ID No. 6.