CN106701772A - Kit for detecting gynecologic chronic pelvic inflammation and detection method thereof - Google Patents

Kit for detecting gynecologic chronic pelvic inflammation and detection method thereof Download PDF

Info

Publication number
CN106701772A
CN106701772A CN201710158168.9A CN201710158168A CN106701772A CN 106701772 A CN106701772 A CN 106701772A CN 201710158168 A CN201710158168 A CN 201710158168A CN 106701772 A CN106701772 A CN 106701772A
Authority
CN
China
Prior art keywords
siga
aptamer
kit
sigaap
chronic pelvic
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201710158168.9A
Other languages
Chinese (zh)
Inventor
杨岭燕
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Individual
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Priority to CN201710158168.9A priority Critical patent/CN106701772A/en
Publication of CN106701772A publication Critical patent/CN106701772A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6854—Immunoglobulins
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/16—Aptamers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/36—Gynecology or obstetrics
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/70—Mechanisms involved in disease identification
    • G01N2800/7095—Inflammation

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Urology & Nephrology (AREA)
  • Biotechnology (AREA)
  • Hematology (AREA)
  • Genetics & Genomics (AREA)
  • Physics & Mathematics (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Cell Biology (AREA)
  • Pathology (AREA)
  • Wood Science & Technology (AREA)
  • General Physics & Mathematics (AREA)
  • Food Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Analytical Chemistry (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to an aptamer for diagnosis of gynecologic chronic pelvic inflammation and a kit thereof. The aptamer can bind SIgA efficiently and specifically. The aptamer is obtained by applying a new combined chemical technology SELEX, taking the SIgA as a target and screening an RNA aptamer capable of specifically binding the SIgA. The aptamer is specifically bound with the SIgA, so that the SIgA content of vaginal secretion can be quantitatively measured and the chronic pelvic inflammation can be screened quickly, efficiently and preliminarily. The kit is simple to prepare, low in cost and suitable for large-area popularization and used, and has extremely high social value.

Description

A kind of kit and its detection method for detecting women's chronic pelvic inflammation
Technical field
The present invention relates to medical science, more particularly to a kind of aptamer for chronic pelvic inflammatory disease diagnosis in gynaecology And its kit.
Background technology
Chronic pelvic inflammatory disease refers to female internal genital organs and its surrounding connective tissue, the chronic inflammation of pelvic peritoneum.Its is main Clinical manifestation is paramenia, leucorrhea increasing, waist abdomen pain and infertile etc., has such as formed chronic appendages inflammation, then accessible lump. Symptom is visible：1) chronic pelvic pain：Cicatricial adhesion and pelvic congestion that chronic inflammation is formed, often cause lower abdomen falling inflation, pain Pain and lumbosacral region are ached.Often aggravate after tired, sexual intercourse and before and after menstruation.2) infertile and ectopic pregnancy：Fallopian tube adhesion blocks Infertile and ectopic pregnancy can be caused.Infertile incidence is 20%~30% after acute pelvitis of pelvic cavity.3) menoxenia：Endometritis is normal There is irregular menses；Pelvic congestion can cause menorrhagia；Ovarian function can cause menstrual disorder when damaging.4) constitutional symptom：More not Substantially, only low-heat sometimes, it is susceptible tired.Because the course of disease time is more long, some patientss may occur in which neurasthenia symptom, such as spirit The depressed, whole body is uncomfortable, have a sleepless night etc..When patient's resistance difference, acute or subacute breaking-out is tended to have.Sign, if endometrium Inflammation, uterus increase, tenderness；If salpingitis, then contacted in the thick fallopian tubal of increasing of rope strip in uterus one or both sides, and have Mild tenderness.If hydrosalpinx or tubo-ovarian cyst, then Cystic lesions are touched in pelvic cavity one or both sides, activity is more It is limited.If during connective tissue inflammation of pelvic cavity, uterus is in often retroversioflexion, limitation of activity or adhesion are fixed, uterus one or both sides There is sheet to thicken, tenderness, uterosacral ligament often increase it is thick, be hardened, have tenderness.
The inspection of pelvic infecton is broadly divided into following three step：The first step checks clinical symptoms.Second step leukorrhea routine inspection, this Item is checked and mainly check that vagina cleanness degree, bacterial vaginosis BV include mould, trichomonad etc..3rd step ultrasound diagnosis, using B ultrasonic Inspection can recognize that the enclosed mass that is formed together from fallopian tubal, ovary and intestinal tube adhesion or abscess have 85% accuracy.But it is light Degree or in isocratic pelvic infecton be difficult to show feature in Type B ultrasound video.If after carrying out three inspections of the above, not It was found that whether obvious pelvic infecton feature, can also do the auxiliary examination of correlation to make a definite diagnosis with pelvic infecton.Clinically, mainly have Three auxiliary examination below：The Section 1 radioisotope scanning leucocyte that someone is marked using 67 galliums or 111 indiums in recent years Scan to diagnose peritoneal abscess, obtain accuracy rate higher, scanned using 111 indiums, accuracy rate may be up to 85~100%. But clinically still few application, if Section 2 ultrasonic examination conditions permit, should also make ultrasonic examination to understand basin to patient at present Enclosed mass is whether there is in chamber.If any enclosed mass, see whether be abscess.This method is noninjurious examination, and simple and easy to do, reliability may be up to More than 90%.Section 3 computed tomography (CT).But detect above, detection is than relatively time-consuming, and primary dcreening operation is complicated, and efficiency is low Under, therefore with very big room for improvement.
It is known in the art that cervical secretions in, secretory immunoglobulin A (SIgA) content is to chronic pelvic Scorching diagnostic value.Make SIgA by extracting mucus in cervical canal to quantitative determine, the SIgA average contents of pelvic infecton patient can be with 166.8mg/L is reached, and the result of normal women is for about 9.8mg/L, the two significant difference, therefore, by quantitative analysis uterine neck With chronic pelvic inflammatory disease when the content of SIgA tentatively can be used for judging in secretion.
Although can using antibody by enzyme linked immunoassay come the content of SIgA in quantitative analysis cervical secretions, The requirement of the method antagonist is higher, and testing cost is also higher, therefore, for poor and backward area, and it is not suitable for Spread.
SELEX technologies are a kind of new combinatorial chemistry techniques for growing up early 1990s.Can using the technology To screen specificity and the highly affine aptamer of target substance from random single chain oligonucleotide library.Its basic ideas is Iii vitro chemical synthesizes a single stranded oligonucleotide storehouse, mixes with target substance, forms target substance-nucleic acid complexes, and wash-out is uncombined Nucleic acid, the nucleic acid molecules that are combined with target substance of separation, and enter performing PCR as template with this nucleic acid molecules and expand enter back into lower whorl Screening.By the screening and amplification that repeat, some are not combined with target substance or are had low-affinity, middle affinity with target substance Nucleic acid molecules are washed away, and with leather G materials have the nucleic acid molecules of strong affinity from it is very big with hangar points still out, it is and pure Degree increases with the carrying out of SELEX processes, finally occupy storehouse it is most of (>90% or so).From Tuerk and Ellington etc. First with this technology screening to specific adsorption bacteriophage T4DNA polymerases and the specific nucleic acid aptamers of organic dye molecule Afterwards, by the development of more than ten years, SELEX technologies have become a kind of important grinds the means of making internal disorder or usurp and instrument.Therefore, using selex Technology, the specific aptamers for combining SIgA of screening, and then aptamers are prepared into the reagent as specific detection SIgA contents Box has more important meaning.
The content of the invention
Technical scheme is realized by following steps：
It is an object of the invention to provide a kind of nucleic acid aptamer sequence of SIgA.
In the present invention, the aptamer (sequence 1-15) of described SIgA being capable of specific bond SIgA.
It is of the invention further objective is that providing the purposes of the nucleic acid aptamer sequence.According to the sequence in the present invention Row application, can be further used for preparing the kit of specific binding SIgA.
From the random oligo DNA library of external synthesis, (5 '-TGACCTAACGGCATGACTTA----N36---- GGCACCATGGACCAGTTACC-3 '), wherein N36 is 36 random oligonucleotides；Therefrom filter out and SIgA specific bonds Aptamer；The sequence that will be filtered out primer P1：TGACCTAACGGCATGACTTA；Primer P2： GGTAACTGGTCCATGGTGCC, is expanded and is carried out TA and be cloned into pMD19-T carriers (winning photo-biological company purchased from Shanghai), Conversion DH5a bacteriums (are purchased from Beijing Tiangeng biotech firm)；Choose white colony to enter after performing PCR determines positive colony, extract plasmid And sequencing reaction, upper sequencer.
The present invention uses in-vitro screening (SELEX) technology of aptamer, is positive sieve target, screening and SIgA with SIgA The aptamer of specific bond, is obtained the sequence with specific bond SIgA, and aptamers SIgA ap-1 are named as in the present invention ~15.Sequence is as follows：
SIgAap-1:UGACCUAACGGCAUGACUUAUCCAAAUCCUCUCAUCUAUGCUACCAAUCUUACAUUGGCA CCAUGGACCAGUUACC；
SIgAap-2:UGACCUAACGGCAUGACUUACCUUCCACUCCCUUAUGCAUCUUACAUUCCCCCUCAGGCA CCAUGGACCAGUUACC；
SIgAap-3:UGACCUAACGGCAUGACUUAUUUCUACCAACUCCUUGUUCCUUCUUCACACCACUUGGCA CCAUGGACCAGUUACC；
SIgAap-4:UGACCUAACGGCAUGACUUACCCUUAUCCCAAUUUUCUGCUUCAACAUAAACAAUCGGCA CCAUGGACCAGUUACC；
SIgAap-5:UGACCUAACGGCAUGACUUAUACUAAUCAAACUCUUAGCCCACCCUCUAUCUUAUAGGCA CCAUGGACCAGUUACC；
SIgAap-6:UGACCUAACGGCAUGACUUACUCACCAUAACUUUUACGAUCUAAUACCCACACACCGGCA CCAUGGACCAGUUACC；
SIgAap-7:UGACCUAACGGCAUGACUUACCACCUAACUUCUUUAAGCUUAAAUACUUCUUCCAAGGCA CCAUGGACCAGUUACC；
SIgAap-8:UGACCUAACGGCAUGACUUACCUUCCCCAUUAAAUCAGCACCAUUCACCUCAAUCAGGCA CCAUGGACCAGUUACC；
SIgAap-9:UGACCUAACGGCAUGACTTACTCACCCATTCACTCATGACTTCATAATCTTTTCTCGGCA CCATGGACCAGTTACC；
SIgAap-10:TGACCUAACGGCAUGACUUAACCUCAAUUCCAUCCAUAUCUUAAUCUCUAUACAUAGGC ACCAUGGACCAGUUACC；
SIgAap-11:UGACCUAACGGCAUGACUUAACUCCACAUACACCCCAGACACCCCUAAUAUUAUAUGGC ACCAUGGACCAGUUACC；
SIgAap-12:UGACCUAACGGCAUGACUUAUAAUAACUACUUUUACCAGCUUCUAUCAUACCAUAUGGC ACCAUGGACCAGUUACC；
SIgAap-13:UGACCUAACGGCAUGACUUACAAUCUAAAACUCUUCUAUUCUAUACCCUUUAAUUCGGC ACCAUGGACCAGUUACC；
SIgAap-14:UGACCUAACGGCAUGACUUAAUAACAAAUCCUCCCAUCACACCCACUUAUAAAAAUGGC ACCAUGGACCAGUUACC；
SIgAap-15:UGACCUAACGGCAUGACUUAUCCUCUCCCUCCUAUAAUACAAUCCUCAAACUCUACGGC ACCAUGGACCAGUUACC；
Aptamer of the invention can be used for building kit, and the kit can be used for specific separation and quantitative inspection SIgA is surveyed, fast with separating effect, efficiency high is time-consuming, cost-effective effect.With very wide application prospect.
Beneficial effects of the present invention：A kind of aptamer for being capable of differential high efficient combination SIgA is obtained, is adapted to by by this Prepared by son can the quantitative concentration for detecting SIgA as kit, you can rapidly and efficiently for the fast of chronic pelvic inflammatory disease Fast examination.
Specific embodiment
Embodiment 1:Aptamer is screened
From the random oligo DNA library of external synthesis, 5 '-TGACCTAACGGCATGACTTA----N36---- GGCACCATGGACCAGTTACC-3′。
The primer:
F：5 ,-TGACCTAACGGCATGACTTA-3
R：5 ,-GGTAACTGGTCCATGGTGCC-3
It is double-stranded DNA by single-stranded DNA banks amplification, product is purified through 2% agarose gel electrophoresis and gel extraction；To return The double-stranded DNA of receipts is template, and in-vitro transcription goes out single stranded RNA random library, and transcription product is purified through PAGE.80 μ g RNA libraries pass through Nitrocellulose filter counter-selection removes the RNA molecule with film combination, is then incubated 40min, reaction solution with 10ug SIgA protein 37s DEG C Filtered through nitrocellulose filter, wash filter membrane；Then filter membrane is shredded, is placed in elution buffer (6mol/L urea, 0.7mol/L Ammonium acetate, l.6mmol/L EDTA, 0.15%SDS) in boil 5min, be centrifuged, take supernatant, absolute ethyl alcohol precipitation RNA, and again It is dissolved in 20 μ 1DEPC water；It is template RT-PCR amplifying doulbe-chain DNA with RNA, in-vitro transcription goes out RNA libraries and sieved for next round Choosing；Often RT-PCR obtains double-stranded DNA library in wheel screening process, and RNA aptamer is gone out by template in-vitro transcription of the double-stranded DNA Storehouse, screening carries out 16 wheels altogether.Sequencer on the aptamer that last wheel screening is obtained.Measure obtains sequence such as SEQ ID NO：Shown in 1-15.
The acquisition of the SIgA combination aptamers of the specific high-affinity of embodiment 2
RNA aptamer is taken 1.5 μ g respectively, with 37 DEG C of digestion 1h of calf intestinal alkaline phosphatase (CIP), dephosphorization is reclaimed in purifying The RNA of acidifying；[γ -32P] ATP is marked in dephosphorylized RNA molecule end by T4 polynucleotide kinases.10nmol is radiated Property mark RNA aptamer 30min, each group reaction solution warp are incubated with the SIgA protein 37s DEG C of various concentrations (1-200nM) respectively Nitrocellulose filter is filtered, and washs filter membrane, dries filter membrane, and liquid scintillation counter determines the exit dose remained on filter membrane, same sample Parallel doing determines twice.Calculate the dissociation constant of each aptamer and SIgA albumen.Result is as follows：
Title Dissociation constant Kd (nM)
SIgA ap-1 9.7
SIgA ap-2 8.5
SIgA ap-3 7.6
SIgA ap-4 8.8
SIgA ap-5 9.0
SIgA ap-6 10.2
SIgA ap-7 11.3
SIgA ap-8 9.7
SIgA ap-9 9.4
SIgA ap-10 8.6
SIgA ap-11 11.3
SIgA ap-12 9.5
SIgA ap-13 8.8
SIgA ap-14 9.5
SIgA ap-15 10.5
PBS blanks Without binding ability
The analysis of aptamer specificity and stability analysis described in embodiment 3
As can be seen from the above results, 15 aptamers of the invention have very strong binding characteristic, in the prior art Also the aptamer without the binding characteristic can combine SIgA albumen.
The degrading activity of embodiment 4 is analyzed
Human serum albumin is respectively adopted, IgA, IgG, hemoglobin and 15 aptamers carry out specific detection, by knot Close experiment to find, these aptamers are not combined with these albumen, and only keep specificity higher with SIgA protein bindings.
By described aptamer, 0.5ug is taken, be respectively placed in the serum of normal temperature, the aqueous solution, place surrounding.By RT- PCR detects, finds placement its Stability Analysis of Structures of surrounding, is not degraded.
The clinical trial analysis of embodiment 5
15 aptamers are respectively used to the clinical sample of the same woman vagina secretion of detection, chronic pelvic is included Scorching group and healthy control group, wherein chronic pelvic inflammatory disease group are 60, and healthy control group is 10, is made with the vaginal fluid of women It is sample to be checked.
70 groups of woman vagina secretion are added in sterile centrifugation tube, PBS solution concussion dissolving is added.Respectively will coupling Vaginal fluid solution of 15 groups of aptamers with 70 groups for having magnetic bead mixes incubation 20 minutes, then Magneto separate, you can obtain phase The SIgA albumen of the separation answered, finds, in 60 chronic pelvic inflammatory disease groups, 15 groups of aptamers detect high concentration by detecting SIgA albumen, average detected concentration is 158.1mg/L, and is evenly distributed, and the concentration of SIgA albumen is put down in healthy group 10.2mg/L is equally to be evenly distributed, it can be seen that, can quickly be realized using 15 kinds of aptamers of the invention The Detection results of 100% preliminary screening.With high accuracy.
Above-described embodiment is the present invention preferably implementation method, but embodiments of the present invention are not by above-described embodiment Limitation, it is other it is any without departing from Spirit Essence of the invention and the change, modification, replacement made under principle, combine, simplification, Equivalent substitute mode is should be, is included within protection scope of the present invention.
Sequence table
The ＞ Yang Ling swallows of ＜ 110
A kind of kits and its detection method for detecting women's chronic pelvic inflammation of the ＞ of ＜ 120
〈210〉1
〈211〉76
〈212〉RNA
The ＞ artificial sequences of ＜ 213
〈400〉SIgAap-1
UGACCUAACGGCAUGACUUAUCCAAAUCCUCUCAUCUAUGCUACCAAUCUUACAUUGGCACCAUGGACCAGUUACC；
〈210〉2
〈211〉76
〈212〉RNA
The ＞ artificial sequences of ＜ 213
〈400〉SIgAap-2
UGACCUAACGGCAUGACUUACCUUCCACUCCCUUAUGCAUCUUACAUUCCCCCUCAGGCACCAUGGACCAGUUACC；
〈210〉3
〈211〉76
〈212〉RNA
The ＞ artificial sequences of ＜ 213
〈400〉SIgAap-3
UGACCUAACGGCAUGACUUAUUUCUACCAACUCCUUGUUCCUUCUUCACACCACUUGGCACCAUGGACCAGUUACC；
〈210〉4
〈211〉76
〈212〉RNA
The ＞ artificial sequences of ＜ 213
〈400〉SIgAap-4
UGACCUAACGGCAUGACUUACCCUUAUCCCAAUUUUCUGCUUCAACAUAAACAAUCGGCACCAUGGACCAGUUACC；
〈210〉5
〈211〉76
〈212〉RNA
The ＞ artificial sequences of ＜ 213
〈400〉SIgAap-5
UGACCUAACGGCAUGACUUAUACUAAUCAAACUCUUAGCCCACCCUCUAUCUUAUAGGCACCAUGGACCAGUUACC；
〈210〉6
〈211〉76
〈212〉RNA
The ＞ artificial sequences of ＜ 213
〈400〉SIgAap-6
UGACCUAACGGCAUGACUUACUCACCAUAACUUUUACGAUCUAAUACCCACACACCGGCACCAUGGACCAGUUACC；
〈210〉7
〈211〉76
〈212〉RNA
The ＞ artificial sequences of ＜ 213
〈400〉SIgAap-7
UGACCUAACGGCAUGACUUACCACCUAACUUCUUUAAGCUUAAAUACUUCUUCCAAGGCACCAUGGACCAGUUACC；
〈210〉8
〈211〉76
〈212〉RNA
The ＞ artificial sequences of ＜ 213
〈400〉SIgAap-8
UGACCUAACGGCAUGACUUACCUUCCCCAUUAAAUCAGCACCAUUCACCUCAAUCAGGCACCAUGGACCAGUUACC；
〈210〉9
〈211〉76
〈212〉RNA
The ＞ artificial sequences of ＜ 213
〈400〉SIgAap-9
UGACCUAACGGCAUGACTTACTCACCCATTCACTCATGACTTCATAATCTTTTCTCGGCACCATGGACCAGTTACC；
〈210〉10
〈211〉76
〈212〉RNA
The ＞ artificial sequences of ＜ 213
〈400〉SIgAap-10
TGACCUAACGGCAUGACUUAACCUCAAUUCCAUCCAUAUCUUAAUCUCUAUACAUAGGCACCAUGGACCAGUUACC；
〈210〉11
〈211〉76
〈212〉RNA
The ＞ artificial sequences of ＜ 213
〈400〉SIgAap-11
UGACCUAACGGCAUGACUUAACUCCACAUACACCCCAGACACCCCUAAUAUUAUAUGGCACCAUGGACCAGUUACC；
〈210〉12
〈211〉76
〈212〉RNA
The ＞ artificial sequences of ＜ 213
〈400〉SIgAap-12
UGACCUAACGGCAUGACUUAUAAUAACUACUUUUACCAGCUUCUAUCAUACCAUAUGGCACCAUGGACCAGUUACC；
〈210〉13
〈211〉76
〈212〉RNA
The ＞ artificial sequences of ＜ 213
〈400〉SIgAap-13
UGACCUAACGGCAUGACUUACAAUCUAAAACUCUUCUAUUCUAUACCCUUUAAUUCGGCACCAUGGACCAGUUACC；
〈210〉14
〈211〉76
〈212〉RNA
The ＞ artificial sequences of ＜ 213
〈400〉SIgAap-14
UGACCUAACGGCAUGACUUAAUAACAAAUCCUCCCAUCACACCCACUUAUAAAAAUGGCACCAUGGACCAGUUACC；
〈210〉15
〈211〉76
〈212〉RNA
The ＞ artificial sequences of ＜ 213
〈400〉SIgAap-15
UGACCUAACGGCAUGACUUAUCCUCUCCCUCCUAUAAUACAAUCCUCAAACUCUACGGCACCAUGGACCAGUUACC；

Claims (3)

1. a kind of kit for detecting chronic pelvic inflammatory disease, it is characterised in that：Containing the fit of SIgA can be specifically bound.
2. kit as claimed in claim 1, it is characterised in that for the fit sequence is to include SEQ ID No.7 sequences institute Show, or one or several nucleotides carried out on the basis of the sequence replacement, and retain its activity.
3. the application in the fit kit for preparing detection chronic pelvic inflammatory disease of the sequence as shown in SEQ ID No.7.
CN201710158168.9A 2016-05-08 2016-05-08 Kit for detecting gynecologic chronic pelvic inflammation and detection method thereof Pending CN106701772A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201710158168.9A CN106701772A (en) 2016-05-08 2016-05-08 Kit for detecting gynecologic chronic pelvic inflammation and detection method thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN201610301090.7A CN105738633B (en) 2016-05-08 2016-05-08 Kit for detecting gynecological chronic pelvic inflammatory disease and detection method of kit
CN201710158168.9A CN106701772A (en) 2016-05-08 2016-05-08 Kit for detecting gynecologic chronic pelvic inflammation and detection method thereof

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
CN201610301090.7A Division CN105738633B (en) 2016-05-08 2016-05-08 Kit for detecting gynecological chronic pelvic inflammatory disease and detection method of kit

Publications (1)

Publication Number Publication Date
CN106701772A true CN106701772A (en) 2017-05-24

Family

ID=56288869

Family Applications (15)

Application Number Title Priority Date Filing Date
CN201710158166.XA Pending CN106868009A (en) 2016-05-08 2016-05-08 A kind of kit and its detection method for detecting women's chronic pelvic inflammation
CN201710158168.9A Pending CN106701772A (en) 2016-05-08 2016-05-08 Kit for detecting gynecologic chronic pelvic inflammation and detection method thereof
CN201710157670.8A Pending CN106754939A (en) 2016-05-08 2016-05-08 A kind of kit and its detection method for detecting women's chronic pelvic inflammation
CN201710158170.6A Pending CN106701773A (en) 2016-05-08 2016-05-08 Kit for detecting gynecologic chronic pelvic inflammatory disease and detection method thereof
CN201710157669.5A Pending CN106701771A (en) 2016-05-08 2016-05-08 Kit for detecting gynecologic chronic pelvic inflammation and detection method of kit
CN201710157655.3A Pending CN106636109A (en) 2016-05-08 2016-05-08 Kit for detecting chronic pelvic inflammatory disease of gynaecology and detection method thereof
CN201710157917.6A Pending CN106636111A (en) 2016-05-08 2016-05-08 Kit and detection method for detecting gynecological chronic pelvic inflammation
CN201710157666.1A Pending CN106701770A (en) 2016-05-08 2016-05-08 Kit for detecting gynecologic chronic pelvic inflammation and detection method thereof
CN201710158171.0A Pending CN106636113A (en) 2016-05-08 2016-05-08 Kit used for detecting gynecological chronic pelvic inflammation and detection method thereof
CN201710158169.3A Pending CN106636112A (en) 2016-05-08 2016-05-08 Kit for detecting gynecologic chronic pelvic inflammation and detection method of kit
CN201610301090.7A Active CN105738633B (en) 2016-05-08 2016-05-08 Kit for detecting gynecological chronic pelvic inflammatory disease and detection method of kit
CN201710157668.0A Pending CN106636110A (en) 2016-05-08 2016-05-08 Kit for detecting gynecologic chronic pelvic inflammation and detection method thereof
CN201710157654.9A Pending CN106701769A (en) 2016-05-08 2016-05-08 Kit for detecting gynecological chronic pelvic inflammation and detection method of kit
CN201710158172.5A Pending CN106636114A (en) 2016-05-08 2016-05-08 Kit for detection on gynecologic chronic pelvic inflammation and detection method thereof
CN201710158891.7A Pending CN106868010A (en) 2016-05-08 2016-05-08 A kind of kit and its detection method for detecting women's chronic pelvic inflammation

Family Applications Before (1)

Application Number Title Priority Date Filing Date
CN201710158166.XA Pending CN106868009A (en) 2016-05-08 2016-05-08 A kind of kit and its detection method for detecting women's chronic pelvic inflammation

Family Applications After (13)

Application Number Title Priority Date Filing Date
CN201710157670.8A Pending CN106754939A (en) 2016-05-08 2016-05-08 A kind of kit and its detection method for detecting women's chronic pelvic inflammation
CN201710158170.6A Pending CN106701773A (en) 2016-05-08 2016-05-08 Kit for detecting gynecologic chronic pelvic inflammatory disease and detection method thereof
CN201710157669.5A Pending CN106701771A (en) 2016-05-08 2016-05-08 Kit for detecting gynecologic chronic pelvic inflammation and detection method of kit
CN201710157655.3A Pending CN106636109A (en) 2016-05-08 2016-05-08 Kit for detecting chronic pelvic inflammatory disease of gynaecology and detection method thereof
CN201710157917.6A Pending CN106636111A (en) 2016-05-08 2016-05-08 Kit and detection method for detecting gynecological chronic pelvic inflammation
CN201710157666.1A Pending CN106701770A (en) 2016-05-08 2016-05-08 Kit for detecting gynecologic chronic pelvic inflammation and detection method thereof
CN201710158171.0A Pending CN106636113A (en) 2016-05-08 2016-05-08 Kit used for detecting gynecological chronic pelvic inflammation and detection method thereof
CN201710158169.3A Pending CN106636112A (en) 2016-05-08 2016-05-08 Kit for detecting gynecologic chronic pelvic inflammation and detection method of kit
CN201610301090.7A Active CN105738633B (en) 2016-05-08 2016-05-08 Kit for detecting gynecological chronic pelvic inflammatory disease and detection method of kit
CN201710157668.0A Pending CN106636110A (en) 2016-05-08 2016-05-08 Kit for detecting gynecologic chronic pelvic inflammation and detection method thereof
CN201710157654.9A Pending CN106701769A (en) 2016-05-08 2016-05-08 Kit for detecting gynecological chronic pelvic inflammation and detection method of kit
CN201710158172.5A Pending CN106636114A (en) 2016-05-08 2016-05-08 Kit for detection on gynecologic chronic pelvic inflammation and detection method thereof
CN201710158891.7A Pending CN106868010A (en) 2016-05-08 2016-05-08 A kind of kit and its detection method for detecting women's chronic pelvic inflammation

Country Status (1)

Country Link
CN (15) CN106868009A (en)

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018051581A1 (en) 2016-09-15 2018-03-22 Ｎｅｃソリューションイノベータ株式会社 Nucleoside derivative or salt thereof, reagent for synthesizing polynucleotide, method for producing polynucleotide, polynucleotide, and method for producing binding nucleic acid molecule
WO2018051580A1 (en) 2016-09-15 2018-03-22 Ｎｅｃソリューションイノベータ株式会社 Nucleoside derivative or salt thereof, reagent for synthesizing polynucleotide, method for producing polynucleotide, polynucleotide, and method for producing binding nucleic acid molecule
CN109715807B (en) * 2016-09-15 2022-05-17 日本电气方案创新株式会社 Secretory immunoglobulin A (sIgA) -binding nucleic acid molecule, sensor for sIgA analysis, and sIgA analysis method
JP2019149979A (en) * 2018-03-05 2019-09-12 Ｎｅｃソリューションイノベータ株式会社 SECRETORY IMMUNOGLOBULIN A (sIgA)-BINDING NUCLEIC ACID MOLECULE, sIgA DETECTION SENSOR, sIgA DETECTION REAGENT, AND sIgA ANALYSIS METHOD
CN114592080B (en) * 2022-04-01 2023-12-01 领航基因科技（杭州）有限公司 RT-ddPCR reagent for detecting four pathogenic bacteria

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1105270A (en) * 1994-01-14 1995-07-19 中国韬奋基金会 Product containing secretion-type immunoglobulin A and preparing process thereof
CN101545904A (en) * 2009-03-06 2009-09-30 江苏省农业科学院 Anti-mycoplasma hyopneumoniae SIgA indirect ELISA detection method
CN103197057A (en) * 2013-03-28 2013-07-10 天津市宝坻区人民医院 Secreting type IgA endomethal antibody detection kit and use method of secreting type IgA endomethal antibody detection kit
CN103163292A (en) * 2013-03-28 2013-06-19 天津市宝坻区人民医院 Secreting type IgA anticardiolipin antibody detection kit and use method
KR101565652B1 (en) * 2013-10-16 2015-11-04 인천대학교 산학협력단 Biosensor for detecting target material using graphene oxide as electrochemical indicator and method for preparing the same
CN103604932B (en) * 2013-11-27 2015-05-20 辽宁宏福肉类集团有限公司 Detection method for concentration of internal secretion type immune globulin of cattle intestinal mucosa

Also Published As

Publication number Publication date
CN106636109A (en) 2017-05-10
CN106754939A (en) 2017-05-31
CN106636111A (en) 2017-05-10
CN106868010A (en) 2017-06-20
CN106701773A (en) 2017-05-24
CN106636112A (en) 2017-05-10
CN105738633B (en) 2017-05-03
CN106636110A (en) 2017-05-10
CN106868009A (en) 2017-06-20
CN106701770A (en) 2017-05-24
CN106701771A (en) 2017-05-24
CN106701769A (en) 2017-05-24
CN106636113A (en) 2017-05-10
CN106636114A (en) 2017-05-10
CN105738633A (en) 2016-07-06

Similar Documents

Publication Publication Date Title
CN105738633B (en) Kit for detecting gynecological chronic pelvic inflammatory disease and detection method of kit
CN113061610B (en) Aptamer binding to novel coronavirus (SARS-CoV-2) spinous process protein S1 subunit and use thereof
CN105647932A (en) Alpha-fetoprotein nucleic acid aptamer AFP1 and preparation method thereof
Yeganeh Kazemi et al. Maternal monocytes respond to cell-free fetal DNA and initiate key processes of human parturition
Yuvacı et al. Evaluation of the presence of SARS-COV-2 in the vaginal fluid of reproductive-aged women
CN106018828A (en) Reagent kit for detecting intestinal diseases
CN105779459A (en) Aptamer for diagnosing rupture of fetal membrane in gynaecology and obstetrics and kit thereof
CN105334327B (en) Kit and method for detecting ophthalmopathy
CN105223358B (en) A kind of test kit of carcinoma of endometrium specific detection
WO2024123061A1 (en) Composition for diagnosing endometriosis
CN105334328B (en) Kit and method for detecting ophthalmic diseases
Qiao et al. Retracted: Expression of nestin in embryonic tissues and its effects on clinicopathological characteristics of patients with placenta previa
Aggarwal et al. Tubercular pyometra in a young unmarried female-dilemma and pitfalls in diagnosis: a rare case report with review of literature
CN110806482B (en) Marker for judging curative effect of clinical treatment on membranous nephropathy
CN105802972A (en) Aptamer and kit for diagnosing fetus premature delivery in gynaecology and obstetrics department
CN105586345A (en) Alpha fetoprotein nucleic acid aptamer AFP3 and preparation method thereof
CN118460710A (en) Breast cancer tissue specimen molecular typing kit
CN110499365A (en) Application of the AGAP9 in the product of preparation diagnosis osteoarthritis
CN105647933A (en) Alpha-fetoprotein nucleic acid aptamer AFP4 and preparation method thereof
CN105823895A (en) Kit for specific detection of endometrial cancer
CN105823894A (en) Kit for specific detection of endometrial cancer
CN105823879A (en) Kit for specific detection of endometrial cancer
CN106018812A (en) Kit for specific detection of lip cancer

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
WD01 Invention patent application deemed withdrawn after publication

Application publication date: 20170524

WD01 Invention patent application deemed withdrawn after publication