CN106636109A - Kit for detecting chronic pelvic inflammatory disease of gynaecology and detection method thereof - Google Patents
Kit for detecting chronic pelvic inflammatory disease of gynaecology and detection method thereof Download PDFInfo
- Publication number
- CN106636109A CN106636109A CN201710157655.3A CN201710157655A CN106636109A CN 106636109 A CN106636109 A CN 106636109A CN 201710157655 A CN201710157655 A CN 201710157655A CN 106636109 A CN106636109 A CN 106636109A
- Authority
- CN
- China
- Prior art keywords
- siga
- aptamer
- kit
- inflammatory disease
- sigaap
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6854—Immunoglobulins
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/16—Aptamers
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/36—Gynecology or obstetrics
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/70—Mechanisms involved in disease identification
- G01N2800/7095—Inflammation
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Urology & Nephrology (AREA)
- Biotechnology (AREA)
- Hematology (AREA)
- Genetics & Genomics (AREA)
- Physics & Mathematics (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Zoology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Cell Biology (AREA)
- Pathology (AREA)
- Wood Science & Technology (AREA)
- General Physics & Mathematics (AREA)
- Food Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- Analytical Chemistry (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to an aptamer for diagnosing a chronic pelvic inflammatory disease of gynaecology and a kit thereof. The aptamer can be efficiently and specifically combined with SIgA. The aptamer is acquired by using a new combination chemical technology SELEX, wherein the SIgA is used as a target, and the RNA aptamer can be specifically combined with the SIgA is screened from a random library. The aptamer is specifically combined with the SIgA, so that content of the SIgA in vaginal secretion is quantitatively measured, and thus the chronic pelvic inflammatory disease can be rapidly and efficiently preliminarily screened. The kit is simple to produce, low in cost, and applicable to extensive popularization to use, and has extremely high social value.
Description
Technical field
The present invention relates to medical science, more particularly to a kind of aptamer for chronic pelvic inflammatory disease diagnosis in gynaecology
And its kit.
Background technology
Chronic pelvic inflammatory disease refers to female internal genital organs and its surrounding connective tissue, the chronic inflammation of pelvic peritoneum.Its is main
Clinical manifestation is paramenia, leucorrhea increasing, waist abdomen pain and infertile etc., such as forms chronic appendages inflammation, then accessible lump.
Symptom is visible:1) chronic pelvic pain:Cicatricial adhesion and pelvic congestion that chronic inflammation is formed, often cause lower abdomen falling inflation, pain
Pain and lumbosacral region are ached.Often aggravate after tired, sexual intercourse and before and after menstruation.2) infertile and ectopic pregnancy:Fallopian tube adhesion blocks
Infertile and ectopic pregnancy can be caused.Infertile incidence is 20%~30% after acute pelvitis of pelvic cavity.3) menoxenia:Endometritis is normal
There is irregular menses;Pelvic congestion can cause menorrhagia;Ovarian function can cause menstrual disorder when damaging.4) constitutional symptom:More not
Substantially, only low-heat sometimes, it is susceptible tired.Because the course of disease time is longer, some patientss may occur in which neurasthenia symptom, such as spirit
The depressed, whole body is uncomfortable, have a sleepless night etc..When patient's resistance difference, acute or subacute outbreak is tended to have.Sign, if endometrium
Inflammation, uterus increase, tenderness;If salpingitis, then the thick fallopian tubal of increasing in rope strip is contacted in uterus one or both sides, and had
Mild tenderness.If hydrosalpinx or tubo-ovarian cyst, then Cystic lesions are touched in pelvic cavity one or both sides, activity is more
It is limited.If during connective tissue inflammation of pelvic cavity, uterus is in often retroversioflexion, limitation of activity or adhesion are fixed, uterus one or both sides
Have sheet to thicken, tenderness, uterosacral ligament often increase it is thick, be hardened, have tenderness.
The inspection of pelvic infecton is broadly divided into following three step:The first step checks clinical symptoms.Second step leukorrhea routine inspection, this
Item is checked and mainly check that vagina cleanness degree, bacterial vaginosis BV include mould, trichomonad etc..3rd step ultrasound diagnosis, using B ultrasonic
Inspection can recognize that the enclosed mass formed together from fallopian tubal, ovary and intestinal tube adhesion or abscess have 85% accuracy.But it is light
Degree or in isocratic pelvic infecton be difficult to show feature in Type B ultrasound video.If after carrying out three inspections of the above, not
It was found that obvious pelvic infecton feature, can also do the auxiliary examination of correlation whether to make a definite diagnosis with pelvic infecton.Clinically, mainly have
Three auxiliary examination below:The Section 1 radioisotope scanning leucocyte that in recent years someone is marked using 67 galliums or 111 indiums
Scan to diagnose peritoneal abscess, obtain higher accuracy rate, scan using 111 indiums, accuracy rate may be up to 85~100%.
But clinically still apply less at present, if Section 2 ultrasonic examination conditions permit, should also make ultrasonic examination to understand basin to patient
Enclosed mass is whether there is in chamber.If any enclosed mass, see whether be abscess.This method is noninjurious examination, and simple and easy to do, reliability may be up to
More than 90%.Section 3 computed tomography (CT).But detect above, detect that than relatively time-consuming, primary dcreening operation is complicated, and efficiency is low
Under, therefore with very big room for improvement.
It is known in the art that cervical secretions in, secretory immunoglobulin A (SIgA) content is to chronic pelvic
Scorching diagnostic value.Make SIgA quantitative determinations by extracting mucus in cervical canal, the SIgA average contents of pelvic infecton patient can be with
166.8mg/L is reached, and the result of normal women is for about 9.8mg/L, the two significant difference, therefore, by quantitative analysis uterine neck
With chronic pelvic inflammatory disease when the content of SIgA tentatively can be used for judging in secretion.
Although can using antibody by enzyme linked immunoassay come the content of SIgA in quantitative analysis cervical secretions,
The requirement of the method antagonist is higher, and testing cost is also higher, therefore, for poor and backward area, and it is not suitable for
Spread.
SELEX technologies are a kind of new combinatorial chemistry techniques for growing up early 1990s.Can using the technology
To screen specificity and the highly affine aptamer of target substance from random single chain oligonucleotide library.Its basic ideas is
Iii vitro chemical synthesizes a single stranded oligonucleotide storehouse, mixes with target substance, forms target substance-nucleic acid complexes, and wash-out is uncombined
Nucleic acid, separate the nucleic acid molecules that combined with target substance, and enter performing PCR as template with this nucleic acid molecules and expand, enter back into lower whorl
Screening.By the screening that repeats and amplification, some are not combined with target substance or are had low-affinity, middle affinity with target substance
Nucleic acid molecules are washed away, and with leather G materials have the nucleic acid molecules of strong affinity from it is very big with hangar points still out, it is and pure
Degree increase with the carrying out of SELEX processes, finally occupy storehouse great majority (>90% or so).From Tuerk and Ellington etc.
First with this technology screening to specific adsorption bacteriophage T4DNA polymerases and the specific nucleic acid aptamers of organic dye molecule
Afterwards, through the development of more than ten years, SELEX technologies have become a kind of important grinds the means of making internal disorder or usurp and instrument.Therefore, using selex
Technology, the specific aptamers with reference to SIgA of screening, and then aptamers are prepared the reagent for becoming specific detection SIgA content
Box has more important meaning.
The content of the invention
Technical scheme is realized by following steps:
It is an object of the invention to provide a kind of nucleic acid aptamer sequence of SIgA.
In the present invention, the aptamer (sequence 1-15) of described SIgA being capable of specific bond SIgA.
The present invention's further objective is that the purposes for providing the nucleic acid aptamer sequence.According to the sequence in the present invention
Row application, can be further used for preparing the kit of specific binding SIgA.
From the random oligo DNA library of external synthesis, (5 '-TGACCTAACGGCATGACTTA----N36----
GGCACCATGGACCAGTTACC-3 '), wherein N36 is 36 random oligonucleotides;Therefrom filter out and SIgA specific bonds
Aptamer;By the sequence for filtering out primer P1:TGACCTAACGGCATGACTTA;Primer P2:
GGTAACTGGTCCATGGTGCC, is expanded and is carried out TA and be cloned into pMD19-T carriers (purchased from the rich photo-biological company in Shanghai),
Conversion DH5a bacteriums (are purchased from Beijing Tiangeng biotech firm);Choose white colony and enter performing PCR and determine after positive colony, extract plasmid
And sequencing reaction, upper sequencer.
The present invention, with SIgA as target is just sieved, is screened and SIgA using in-vitro screening (SELEX) technology of aptamer
The aptamer of specific bond, is obtained the sequence with specific bond SIgA, and in the present invention aptamers SIgA ap-1 is named as
~15.Sequence is as follows:
SIgAap-1:UGACCUAACGGCAUGACUUAUCCAAAUCCUCUCAUCUAUGCUACCAAUCUUACAUUGGCA
CCAUGGACCAGUUACC;
SIgAap-2:UGACCUAACGGCAUGACUUACCUUCCACUCCCUUAUGCAUCUUACAUUCCCCCUCAGGCA
CCAUGGACCAGUUACC;
SIgAap-3:UGACCUAACGGCAUGACUUAUUUCUACCAACUCCUUGUUCCUUCUUCACACCACUUGGCA
CCAUGGACCAGUUACC;
SIgAap-4:UGACCUAACGGCAUGACUUACCCUUAUCCCAAUUUUCUGCUUCAACAUAAACAAUCGGCA
CCAUGGACCAGUUACC;
SIgAap-5:UGACCUAACGGCAUGACUUAUACUAAUCAAACUCUUAGCCCACCCUCUAUCUUAUAGGCA
CCAUGGACCAGUUACC;
SIgAap-6:UGACCUAACGGCAUGACUUACUCACCAUAACUUUUACGAUCUAAUACCCACACACCGGCA
CCAUGGACCAGUUACC;
SIgAap-7:UGACCUAACGGCAUGACUUACCACCUAACUUCUUUAAGCUUAAAUACUUCUUCCAAGGCA
CCAUGGACCAGUUACC;
SIgAap-8:UGACCUAACGGCAUGACUUACCUUCCCCAUUAAAUCAGCACCAUUCACCUCAAUCAGGCA
CCAUGGACCAGUUACC;
SIgAap-9:UGACCUAACGGCAUGACTTACTCACCCATTCACTCATGACTTCATAATCTTTTCTCGGCA
CCATGGACCAGTTACC;
SIgAap-10:TGACCUAACGGCAUGACUUAACCUCAAUUCCAUCCAUAUCUUAAUCUCUAUACAUAGGC
ACCAUGGACCAGUUACC;
SIgAap-11:UGACCUAACGGCAUGACUUAACUCCACAUACACCCCAGACACCCCUAAUAUUAUAUGGC
ACCAUGGACCAGUUACC;
SIgAap-12:UGACCUAACGGCAUGACUUAUAAUAACUACUUUUACCAGCUUCUAUCAUACCAUAUGGC
ACCAUGGACCAGUUACC;
SIgAap-13:UGACCUAACGGCAUGACUUACAAUCUAAAACUCUUCUAUUCUAUACCCUUUAAUUCGGC
ACCAUGGACCAGUUACC;
SIgAap-14:UGACCUAACGGCAUGACUUAAUAACAAAUCCUCCCAUCACACCCACUUAUAAAAAUGGC
ACCAUGGACCAGUUACC;
SIgAap-15:UGACCUAACGGCAUGACUUAUCCUCUCCCUCCUAUAAUACAAUCCUCAAACUCUACGGC
ACCAUGGACCAGUUACC;
The aptamer of the present invention can be used for building kit, and the kit can be used for the separation of specificity and quantitative inspection
SIgA is surveyed, fast with separating effect, efficiency high is time-consuming, cost-effective effect.With very wide application prospect.
Beneficial effects of the present invention:Obtain it is a kind of can differential high efficient combine SIgA aptamer, by the way that this is adapted to
Son prepares the concentration for detecting SIgA for becoming quantitative by kit, you can rapidly and efficiently for the fast of chronic pelvic inflammatory disease
Fast examination.
Specific embodiment
Embodiment 1:Aptamer is screened
From the random oligo DNA library of external synthesis, 5 '
-TGACCTAACGGCATGACTTA----N36----GGCACCATGGACCAGTTACC-3′。
The primer:
F:5 ,-TGACCTAACGGCATGACTTA-3
R:5 ,-GGTAACTGGTCCATGGTGCC-3
It is double-stranded DNA by single-stranded DNA banks amplification, the agarose gel electrophoresis of product Jing 2% simultaneously cuts glue reclaim purifying;To return
The double-stranded DNA of receipts is template, and in-vitro transcription goes out single stranded RNA random library, transcription product Jing PAGE purifying.80 μ g RNA library Jing
Nitrocellulose filter is counter to be weeded out except the RNA molecule with film combination, is then incubated 40min, reactant liquor with 10ug SIgA protein 37s DEG C
Jing nitrocellulose filters are filtered, and wash filter membrane;Then filter membrane is shredded, is placed in elution buffer (6mol/L urea, 0.7mol/L
Ammonium acetate, l.6mmol/L EDTA, 0.15%SDS) in boil 5min, be centrifuged, take supernatant, absolute ethyl alcohol precipitation RNA, and again
In being dissolved in 20 μ 1DEPC water;With RNA as template RT-PCR amplifying doulbe-chain DNA, in-vitro transcription goes out RNA libraries for next round sieve
Choosing;Often take turns RT-PCR in screening process and obtain double-stranded DNA library, by template in-vitro transcription of the double-stranded DNA RNA aptamer is gone out
Storehouse, screening carries out altogether 16 wheels.Sequencer on the aptamer that last wheel screening is obtained.Measure obtains sequence such as SEQ ID
NO:Shown in 1-15.
The SIgA of the specific high-affinity of embodiment 2 combines the acquisition of aptamer
RNA aptamer is taken respectively 1.5 μ g, with 37 DEG C of digestion 1h of calf intestinal alkaline phosphatase (CIP), purifying reclaims dephosphorization
The RNA of acidifying;[γ -32P] ATP is marked in dephosphorylized RNA molecule end by T4 polynucleotide kinases.10nmol is radiated
Property mark RNA aptamer be incubated 30min, each group reactant liquor Jing with the SIgA protein 37s DEG C of variable concentrations (1-200nM) respectively
Nitrocellulose filter is filtered, and washs filter membrane, is dried filter membrane, and liquid scintillation counter determines the exit dose remained on filter membrane, same sample
Parallel doing determines twice.Calculate the dissociation constant of each aptamer and SIgA albumen.As a result it is as follows:
Title | Dissociation constant Kd (nM) |
SIgA ap-1 | 9.7 |
SIgA ap-2 | 8.5 |
SIgA ap-3 | 7.6 |
SIgA ap-4 | 8.8 |
SIgA ap-5 | 9.0 |
SIgA ap-6 | 10.2 |
SIgA ap-7 | 11.3 |
SIgA ap-8 | 9.7 |
SIgA ap-9 | 9.4 |
SIgA ap-10 | 8.6 |
SIgA ap-11 | 11.3 |
SIgA ap-12 | 9.5 |
SIgA ap-13 | 8.8 |
SIgA ap-14 | 9.5 |
SIgA ap-15 | 10.5 |
PBS blanks | Without binding ability |
The analysis of aptamer specificity and stability analysis described in embodiment 3
As can be seen from the above results, 15 aptamers of the invention have very strong binding characteristic, in prior art
Also the aptamer without the binding characteristic can be with reference to SIgA albumen.
The degrading activity of embodiment 4 is analyzed
It is respectively adopted human serum albumin, IgA, IgG, hemoglobin and 15 aptamers carry out specific detection, Jing Guojie
Close test to find, these aptamers only keep higher specificity not in combination with these albumen with SIgA protein combinations.
By described aptamer, 0.5ug is taken, in being respectively placed in the serum of normal temperature, the aqueous solution, place surrounding.By RT-
PCR detects, finds placement its Stability Analysis of Structures of surrounding, is not degraded.
The clinical trial analysis of embodiment 5
The clinical sample of the woman vagina secretion that 15 aptamers are respectively used to detect same, includes chronic pelvic
Scorching group and healthy control group, wherein chronic pelvic inflammatory disease group are 60, and healthy control group is 10, is made with the vaginal fluid of women
For sample to be checked.
70 groups of woman vagina secretion are added in sterile centrifugation tube, PBS solution concussion dissolving is added.To be coupled respectively
There is vaginal fluid solution of the 15 groups of aptamers of magnetic bead with 70 groups to mix incubation 20 minutes, then Magneto separate, you can to obtain phase
The detached SIgA albumen answered, finds, in 60 chronic pelvic inflammatory disease groups, 15 groups of aptamers detect high concentration by detecting
SIgA albumen, average detected concentration is 158.1mg/L, and is evenly distributed, and the concentration of SIgA albumen is put down in healthy group
It is 10.2mg/L to be equally evenly distributed, it can be seen that, 15 kinds of aptamers of the present invention can be adopted quickly to realize
The Detection results of 100% preliminary screening.With high accuracy.
Above-described embodiment is the present invention preferably embodiment, but embodiments of the present invention not by above-described embodiment
Limit, other any Spirit Essences without departing from the present invention and the change, modification, replacement made under principle, combine, simplification,
Equivalent substitute mode is should be, is included within protection scope of the present invention.
Sequence table
The > Yang Ling swallows of < 110
A kind of kits and its detection method for detecting women's chronic pelvic inflammation of the > of < 120
〈210〉1
〈211〉76
〈212〉RNA
The > artificial sequences of < 213
〈400〉SIgAap-1
UGACCUAACGGCAUGACUUAUCCAAAUCCUCUCAUCUAUGCUACCAAUCUUACAUUGGCACCAUGGACCAGUUACC;
〈210〉2
〈211〉76
〈212〉RNA
The > artificial sequences of < 213
〈400〉SIgAap-2
UGACCUAACGGCAUGACUUACCUUCCACUCCCUUAUGCAUCUUACAUUCCCCCUCAGGCACCAUGGACCAGUUACC;
〈210〉3
〈211〉76
〈212〉RNA
The > artificial sequences of < 213
〈400〉SIgAap-3
UGACCUAACGGCAUGACUUAUUUCUACCAACUCCUUGUUCCUUCUUCACACCACUUGGCACCAUGGACCAGUUACC;
〈210〉4
〈211〉76
〈212〉RNA
The > artificial sequences of < 213
〈400〉SIgAap-4
UGACCUAACGGCAUGACUUACCCUUAUCCCAAUUUUCUGCUUCAACAUAAACAAUCGGCACCAUGGACCAGUUACC;
〈210〉5
〈211〉76
〈212〉RNA
The > artificial sequences of < 213
〈400〉SIgAap-5
UGACCUAACGGCAUGACUUAUACUAAUCAAACUCUUAGCCCACCCUCUAUCUUAUAGGCACCAUGGACCAGUUACC;
〈210〉6
〈211〉76
〈212〉RNA
The > artificial sequences of < 213
〈400〉SIgAap-6
UGACCUAACGGCAUGACUUACUCACCAUAACUUUUACGAUCUAAUACCCACACACCGGCACCAUGGACCAGUUACC;
〈210〉7
〈211〉76
〈212〉RNA
The > artificial sequences of < 213
〈400〉SIgAap-7
UGACCUAACGGCAUGACUUACCACCUAACUUCUUUAAGCUUAAAUACUUCUUCCAAGGCACCAUGGACCAGUUACC;
〈210〉8
〈211〉76
〈212〉RNA
The > artificial sequences of < 213
〈400〉SIgAap-8
UGACCUAACGGCAUGACUUACCUUCCCCAUUAAAUCAGCACCAUUCACCUCAAUCAGGCACCAUGGACCAGUUACC;
〈210〉9
〈211〉76
〈212〉RNA
The > artificial sequences of < 213
〈400〉SIgAap-9
UGACCUAACGGCAUGACTTACTCACCCATTCACTCATGACTTCATAATCTTTTCTCGGCACCATGGACCAGTTACC;
〈210〉10
〈211〉76
〈212〉RNA
The > artificial sequences of < 213
〈400〉SIgAap-10
TGACCUAACGGCAUGACUUAACCUCAAUUCCAUCCAUAUCUUAAUCUCUAUACAUAGGCACCAUGGACCAGUUACC;
〈210〉11
〈211〉76
〈212〉RNA
The > artificial sequences of < 213
〈400〉SIgAap-11
UGACCUAACGGCAUGACUUAACUCCACAUACACCCCAGACACCCCUAAUAUUAUAUGGCACCAUGGACCAGUUACC;
〈210〉12
〈211〉76
〈212〉RNA
The > artificial sequences of < 213
〈400〉SIgAap-12
UGACCUAACGGCAUGACUUAUAAUAACUACUUUUACCAGCUUCUAUCAUACCAUAUGGCACCAUGGACCAGUUACC;
〈210〉13
〈211〉76
〈212〉RNA
The > artificial sequences of < 213
〈400〉SIgAap-13
UGACCUAACGGCAUGACUUACAAUCUAAAACUCUUCUAUUCUAUACCCUUUAAUUCGGCACCAUGGACCAGUUACC;
〈210〉14
〈211〉76
〈212〉RNA
The > artificial sequences of < 213
〈400〉SIgAap-14
UGACCUAACGGCAUGACUUAAUAACAAAUCCUCCCAUCACACCCACUUAUAAAAAUGGCACCAUGGACCAGUUACC;
〈210〉15
〈211〉76
〈212〉RNA
The > artificial sequences of < 213
〈400〉SIgAap-15
UGACCUAACGGCAUGACUUAUCCUCUCCCUCCUAUAAUACAAUCCUCAAACUCUACGGCACCAUGGACCAGUUACC;
Claims (3)
1. a kind of kit for detecting chronic pelvic inflammatory disease, it is characterised in that:Containing the fit of SIgA can be specifically bound.
2. kit as claimed in claim 1, it is characterised in that for the fit sequence be to include SEQ ID No.5 sequences institute
Show, or the replacement of the one or several nucleotides carried out on the basis of the sequence, and retain its activity.
3. the application in the fit kit for preparing detection chronic pelvic inflammatory disease of the sequence as shown in SEQ ID No.5.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201710157655.3A CN106636109A (en) | 2016-05-08 | 2016-05-08 | Kit for detecting chronic pelvic inflammatory disease of gynaecology and detection method thereof |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201610301090.7A CN105738633B (en) | 2016-05-08 | 2016-05-08 | Kit for detecting gynecological chronic pelvic inflammatory disease and detection method of kit |
CN201710157655.3A CN106636109A (en) | 2016-05-08 | 2016-05-08 | Kit for detecting chronic pelvic inflammatory disease of gynaecology and detection method thereof |
Related Parent Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201610301090.7A Division CN105738633B (en) | 2016-05-08 | 2016-05-08 | Kit for detecting gynecological chronic pelvic inflammatory disease and detection method of kit |
Publications (1)
Publication Number | Publication Date |
---|---|
CN106636109A true CN106636109A (en) | 2017-05-10 |
Family
ID=56288869
Family Applications (15)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201710158166.XA Pending CN106868009A (en) | 2016-05-08 | 2016-05-08 | A kind of kit and its detection method for detecting women's chronic pelvic inflammation |
CN201710158168.9A Pending CN106701772A (en) | 2016-05-08 | 2016-05-08 | Kit for detecting gynecologic chronic pelvic inflammation and detection method thereof |
CN201710158891.7A Pending CN106868010A (en) | 2016-05-08 | 2016-05-08 | A kind of kit and its detection method for detecting women's chronic pelvic inflammation |
CN201710157654.9A Pending CN106701769A (en) | 2016-05-08 | 2016-05-08 | Kit for detecting gynecological chronic pelvic inflammation and detection method of kit |
CN201710158171.0A Pending CN106636113A (en) | 2016-05-08 | 2016-05-08 | Kit used for detecting gynecological chronic pelvic inflammation and detection method thereof |
CN201710158170.6A Pending CN106701773A (en) | 2016-05-08 | 2016-05-08 | Kit for detecting gynecologic chronic pelvic inflammatory disease and detection method thereof |
CN201710157917.6A Pending CN106636111A (en) | 2016-05-08 | 2016-05-08 | Kit and detection method for detecting gynecological chronic pelvic inflammation |
CN201710157655.3A Pending CN106636109A (en) | 2016-05-08 | 2016-05-08 | Kit for detecting chronic pelvic inflammatory disease of gynaecology and detection method thereof |
CN201710158169.3A Pending CN106636112A (en) | 2016-05-08 | 2016-05-08 | Kit for detecting gynecologic chronic pelvic inflammation and detection method of kit |
CN201710157666.1A Pending CN106701770A (en) | 2016-05-08 | 2016-05-08 | Kit for detecting gynecologic chronic pelvic inflammation and detection method thereof |
CN201710157669.5A Pending CN106701771A (en) | 2016-05-08 | 2016-05-08 | Kit for detecting gynecologic chronic pelvic inflammation and detection method of kit |
CN201710157670.8A Pending CN106754939A (en) | 2016-05-08 | 2016-05-08 | A kind of kit and its detection method for detecting women's chronic pelvic inflammation |
CN201710158172.5A Pending CN106636114A (en) | 2016-05-08 | 2016-05-08 | Kit for detection on gynecologic chronic pelvic inflammation and detection method thereof |
CN201610301090.7A Active CN105738633B (en) | 2016-05-08 | 2016-05-08 | Kit for detecting gynecological chronic pelvic inflammatory disease and detection method of kit |
CN201710157668.0A Pending CN106636110A (en) | 2016-05-08 | 2016-05-08 | Kit for detecting gynecologic chronic pelvic inflammation and detection method thereof |
Family Applications Before (7)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201710158166.XA Pending CN106868009A (en) | 2016-05-08 | 2016-05-08 | A kind of kit and its detection method for detecting women's chronic pelvic inflammation |
CN201710158168.9A Pending CN106701772A (en) | 2016-05-08 | 2016-05-08 | Kit for detecting gynecologic chronic pelvic inflammation and detection method thereof |
CN201710158891.7A Pending CN106868010A (en) | 2016-05-08 | 2016-05-08 | A kind of kit and its detection method for detecting women's chronic pelvic inflammation |
CN201710157654.9A Pending CN106701769A (en) | 2016-05-08 | 2016-05-08 | Kit for detecting gynecological chronic pelvic inflammation and detection method of kit |
CN201710158171.0A Pending CN106636113A (en) | 2016-05-08 | 2016-05-08 | Kit used for detecting gynecological chronic pelvic inflammation and detection method thereof |
CN201710158170.6A Pending CN106701773A (en) | 2016-05-08 | 2016-05-08 | Kit for detecting gynecologic chronic pelvic inflammatory disease and detection method thereof |
CN201710157917.6A Pending CN106636111A (en) | 2016-05-08 | 2016-05-08 | Kit and detection method for detecting gynecological chronic pelvic inflammation |
Family Applications After (7)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201710158169.3A Pending CN106636112A (en) | 2016-05-08 | 2016-05-08 | Kit for detecting gynecologic chronic pelvic inflammation and detection method of kit |
CN201710157666.1A Pending CN106701770A (en) | 2016-05-08 | 2016-05-08 | Kit for detecting gynecologic chronic pelvic inflammation and detection method thereof |
CN201710157669.5A Pending CN106701771A (en) | 2016-05-08 | 2016-05-08 | Kit for detecting gynecologic chronic pelvic inflammation and detection method of kit |
CN201710157670.8A Pending CN106754939A (en) | 2016-05-08 | 2016-05-08 | A kind of kit and its detection method for detecting women's chronic pelvic inflammation |
CN201710158172.5A Pending CN106636114A (en) | 2016-05-08 | 2016-05-08 | Kit for detection on gynecologic chronic pelvic inflammation and detection method thereof |
CN201610301090.7A Active CN105738633B (en) | 2016-05-08 | 2016-05-08 | Kit for detecting gynecological chronic pelvic inflammatory disease and detection method of kit |
CN201710157668.0A Pending CN106636110A (en) | 2016-05-08 | 2016-05-08 | Kit for detecting gynecologic chronic pelvic inflammation and detection method thereof |
Country Status (1)
Country | Link |
---|---|
CN (15) | CN106868009A (en) |
Families Citing this family (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2018051580A1 (en) | 2016-09-15 | 2018-03-22 | Necソリューションイノベータ株式会社 | Nucleoside derivative or salt thereof, reagent for synthesizing polynucleotide, method for producing polynucleotide, polynucleotide, and method for producing binding nucleic acid molecule |
WO2018051581A1 (en) | 2016-09-15 | 2018-03-22 | Necソリューションイノベータ株式会社 | Nucleoside derivative or salt thereof, reagent for synthesizing polynucleotide, method for producing polynucleotide, polynucleotide, and method for producing binding nucleic acid molecule |
WO2018051569A1 (en) * | 2016-09-15 | 2018-03-22 | Necソリューションイノベータ株式会社 | Secretory immunoglobulin a (siga)-binding nucleic acid molecule, sensor for siga analysis, and analysis method for siga |
JP2019149979A (en) * | 2018-03-05 | 2019-09-12 | Necソリューションイノベータ株式会社 | SECRETORY IMMUNOGLOBULIN A (sIgA)-BINDING NUCLEIC ACID MOLECULE, sIgA DETECTION SENSOR, sIgA DETECTION REAGENT, AND sIgA ANALYSIS METHOD |
CN114592080B (en) * | 2022-04-01 | 2023-12-01 | 领航基因科技(杭州)有限公司 | RT-ddPCR reagent for detecting four pathogenic bacteria |
Family Cites Families (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1105270A (en) * | 1994-01-14 | 1995-07-19 | 中国韬奋基金会 | Product containing secretion-type immunoglobulin A and preparing process thereof |
CN101545904A (en) * | 2009-03-06 | 2009-09-30 | 江苏省农业科学院 | Anti-mycoplasma hyopneumoniae SIgA indirect ELISA detection method |
CN103197057A (en) * | 2013-03-28 | 2013-07-10 | 天津市宝坻区人民医院 | Secreting type IgA endomethal antibody detection kit and use method of secreting type IgA endomethal antibody detection kit |
CN103163292A (en) * | 2013-03-28 | 2013-06-19 | 天津市宝坻区人民医院 | Secreting type IgA anticardiolipin antibody detection kit and use method |
KR101565652B1 (en) * | 2013-10-16 | 2015-11-04 | 인천대학교 산학협력단 | Biosensor for detecting target material using graphene oxide as electrochemical indicator and method for preparing the same |
CN103604932B (en) * | 2013-11-27 | 2015-05-20 | 辽宁宏福肉类集团有限公司 | Detection method for concentration of internal secretion type immune globulin of cattle intestinal mucosa |
-
2016
- 2016-05-08 CN CN201710158166.XA patent/CN106868009A/en active Pending
- 2016-05-08 CN CN201710158168.9A patent/CN106701772A/en active Pending
- 2016-05-08 CN CN201710158891.7A patent/CN106868010A/en active Pending
- 2016-05-08 CN CN201710157654.9A patent/CN106701769A/en active Pending
- 2016-05-08 CN CN201710158171.0A patent/CN106636113A/en active Pending
- 2016-05-08 CN CN201710158170.6A patent/CN106701773A/en active Pending
- 2016-05-08 CN CN201710157917.6A patent/CN106636111A/en active Pending
- 2016-05-08 CN CN201710157655.3A patent/CN106636109A/en active Pending
- 2016-05-08 CN CN201710158169.3A patent/CN106636112A/en active Pending
- 2016-05-08 CN CN201710157666.1A patent/CN106701770A/en active Pending
- 2016-05-08 CN CN201710157669.5A patent/CN106701771A/en active Pending
- 2016-05-08 CN CN201710157670.8A patent/CN106754939A/en active Pending
- 2016-05-08 CN CN201710158172.5A patent/CN106636114A/en active Pending
- 2016-05-08 CN CN201610301090.7A patent/CN105738633B/en active Active
- 2016-05-08 CN CN201710157668.0A patent/CN106636110A/en active Pending
Also Published As
Publication number | Publication date |
---|---|
CN105738633B (en) | 2017-05-03 |
CN106701770A (en) | 2017-05-24 |
CN106701773A (en) | 2017-05-24 |
CN105738633A (en) | 2016-07-06 |
CN106701772A (en) | 2017-05-24 |
CN106636114A (en) | 2017-05-10 |
CN106868010A (en) | 2017-06-20 |
CN106636110A (en) | 2017-05-10 |
CN106754939A (en) | 2017-05-31 |
CN106701769A (en) | 2017-05-24 |
CN106701771A (en) | 2017-05-24 |
CN106636111A (en) | 2017-05-10 |
CN106636112A (en) | 2017-05-10 |
CN106636113A (en) | 2017-05-10 |
CN106868009A (en) | 2017-06-20 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN105738633B (en) | Kit for detecting gynecological chronic pelvic inflammatory disease and detection method of kit | |
CN113061610B (en) | Aptamer binding to novel coronavirus (SARS-CoV-2) spinous process protein S1 subunit and use thereof | |
CN105647932A (en) | Alpha-fetoprotein nucleic acid aptamer AFP1 and preparation method thereof | |
CN106018828A (en) | Reagent kit for detecting intestinal diseases | |
CN105779459A (en) | Aptamer for diagnosing rupture of fetal membrane in gynaecology and obstetrics and kit thereof | |
CN105334327B (en) | Kit and method for detecting ophthalmopathy | |
CN105223358B (en) | A kind of test kit of carcinoma of endometrium specific detection | |
WO2024123061A1 (en) | Composition for diagnosing endometriosis | |
CN105334328B (en) | Kit and method for detecting ophthalmic diseases | |
CN105802972A (en) | Aptamer and kit for diagnosing fetus premature delivery in gynaecology and obstetrics department | |
CN105586345A (en) | Alpha fetoprotein nucleic acid aptamer AFP3 and preparation method thereof | |
CN116024328A (en) | Application of miRNA in exosomes in preparation of differential diagnosis and early screening kit for neurodegenerative diseases | |
CN105647933A (en) | Alpha-fetoprotein nucleic acid aptamer AFP4 and preparation method thereof | |
CN105823879A (en) | Kit for specific detection of endometrial cancer | |
CN105823894A (en) | Kit for specific detection of endometrial cancer | |
CN105823895A (en) | Kit for specific detection of endometrial cancer | |
CN105785007A (en) | Kit for specific detection of endometrial cancer | |
CN106018812A (en) | Kit for specific detection of lip cancer |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20170510 |
|
WD01 | Invention patent application deemed withdrawn after publication |