A kind of test kit and its detection method for detecting women's chronic pelvic inflammation
Technical field
The present invention relates to medical science, more particularly to a kind of aptamer for chronic pelvic inflammatory disease diagnosis in gynecological
And its test kit.
Background technology
Chronic pelvic inflammatory disease refers to female internal genital organses and its surrounding connective tissue, the chronic inflammatory disease of pelvic peritoneum.Its is main
Clinical manifestation is menoxenia, leucorrhoea grow in quantity, waist abdomen pain and infertile etc., such as forms chronic adnexitiss, then accessible lump.
Symptom is visible:1) chronic pelvic pain:Cicatricial adhesion and pelvic congestion that chronic inflammatory disease is formed, often cause hypogastric region falling inflation, pain
Pain and lumbosacral region are ached.Often aggravate after tired, sexual intercourse and before and after menstruation.2) infertile and ectopic pregnancy:Fallopian tube adhesion is blocked
Infertile and ectopic pregnancy can be caused.Infertile incidence rate is 20%~30% after acute pelvic inflammatory disease.3) irregular menstruation:Endometritis are normal
There is irregular menses;Pelvic congestion can cause menorrhagia;Ovarian function can cause menoxenia when damaging.4) General Symptomies:More not
Substantially, only low grade fever sometimes, it is susceptible tired.Because the course of disease time is longer, some patientss may occur in which neurasthenia symptom, such as spirit
The depressed, whole body is uncomfortable, have a sleepless night etc..When patient's resistance difference, acute or subacute outbreak is tended to have.Sign, if endometrium
Inflammation, uterus increase, tenderness;If salpingitis, then the thick fallopian tube of increasing in rope strip is contacted in uterus one or both sides, and had
Mild tenderness.If hydrosalpinx or tubo-ovarian cyst, then Cystic lesions are touched in pelvic cavity one or both sides, activity is more
It is limited.If during inflammation of pelvic connective tissue, uterus is in often retroversioflexion, limitation of activity or adhesion are fixed, uterus one or both sides
Have lamellar to thicken, tenderness, uterosacral ligament often increase it is thick, be hardened, have tenderness.
The inspection of pelvic inflammatory disease is broadly divided into following three step:The first step checks clinical symptoms.Second step leucorrhea routine examination, this
Item is checked and mainly check that vagina cleanness degree, bacterial vaginosis include mycete, infusorian etc..3rd step ultrasound diagnosis, using B ultrasonic
Inspection can recognize that the enclosed mass formed together from fallopian tube, ovary and intestinal tube adhesion or abscess have 85% accuracy.But it is light
Degree or in isocratic pelvic inflammatory disease be difficult to show feature in Type B ultrasound video.If after carrying out three inspections of the above, not
It was found that obvious pelvic inflammatory disease feature, can also do the auxiliary examination of correlation whether to make a definite diagnosis with pelvic inflammatory disease.Clinically, mainly have
Three auxiliary examinations below:Section 1 radioisotope scanning in recent years someone using 67 galliums or 111 indium labellings leukocyte
Scan to diagnose peritoneal abscess, obtain higher accuracy rate, scan using 111 indiums, accuracy rate may be up to 85~100%.
But clinically still apply less at present, if Section 2 ultrasonic examination conditions permit, should also make ultrasonic examination to understand basin to patient
Intracavity whether there is enclosed mass.If any enclosed mass, see whether be abscess.This method is noninjurious examination, and simple and easy to do, reliability may be up to
More than 90%.Section 3 computed tomography (CT).But detect above, detect that than relatively time-consuming, primary dcreening operation is complicated, and efficiency is low
Under, therefore with very big room for improvement.
It is known in the art that cervical secretionses in, SigA sIgA (SIgA) content is to chronic pelvic
Scorching diagnostic value.Make SIgA quantitative determinations by extracting mucus in cervical canal, the SIgA average contents of pelvic inflammatory disease patient can be with
166.8mg/L is reached, and the result of normal women is for about 9.8mg/L, the two significant difference, therefore, by quantitative analyses cervix uteri
With chronic pelvic inflammatory disease when the content of SIgA tentatively can be used for judging in secretions.
Although can using antibody by enzyme linked immunoassay come the content of SIgA in quantitative analyses cervical secretionses,
The requirement of the method antagonist is higher, and testing cost is also higher, therefore, for poor and backward area, and it is not suitable for
Spread.
SELEX technologies are a kind of new combinatorial chemistry technique for growing up early 1990s.Can using the technology
To screen specificity and the highly affine aptamer of target substance from random single chain oligonucleotide library.Its basic ideas is
Iii vitro chemical synthesizes a single stranded oligonucleotide storehouse, mixes with target substance, forms target substance-nucleic acid complexes, and eluting is not associated with
Nucleic acid, separate the nucleic acid molecules that combined with target substance, and enter performing PCR as template with this nucleic acid molecules and expand, enter back into lower whorl
Screening.By the screening that repeats and amplification, some are not combined with target substance or are had low-affinity, middle affinity with target substance
Nucleic acid molecules are washed away, and with leather G materials have the nucleic acid molecules of strong affinity from it is very big with hangar points still out, it is and pure
Degree increase with the carrying out of SELEX processes, finally occupy storehouse great majority (>90% or so).From Tuerk and Ellington etc.
First with this technology screening to specific adsorption phage T4DNA polymerase and the specific nucleic acid aptamers of organic dye molecule
Afterwards, through the development of more than ten years, SELEX technologies have become a kind of important grinds the means of making internal disorder or usurp and instrument.Therefore, using selex
Technology, the specific aptamers with reference to SIgA of screening, and then aptamers are prepared the reagent for becoming specific detection SIgA content
Box has more important meaning.
The content of the invention
Technical scheme is realized by following steps:
It is an object of the invention to provide a kind of nucleic acid aptamer sequence of SIgA.
In the present invention, the aptamer (sequence 1-15) of described SIgA being capable of specific bond SIgA.
The present invention's further objective is that the purposes for providing the nucleic acid aptamer sequence.According to the sequence in the present invention
Row application, can be further used for preparing the test kit of specific binding SIgA.
From the random oligo DNA library of external synthesis, (5 '-TGACCTAACGGCATGACTTA----N36----
GGCACCATGGACCAGTTACC-3 '), wherein N36 is 36 random oligonucleotides;Therefrom filter out and SIgA specific bond
Aptamer;By the sequence for filtering out primer P1:TGACCTAACGGCATGACTTA;Primer P2:
GGTAACTGGTCCATGGTGCC, is expanded and is carried out TA and be cloned into pMD19-T carriers (purchased from the rich photo bio company in Shanghai),
Conversion DH5a antibacterials (are purchased from Beijing Tiangeng biotech firm);Choose white colony and enter performing PCR and determine after positive colony, extract plasmid
And sequencing reaction, upper sequencer.
The present invention, with SIgA as target is just sieved, is screened and SIgA using in-vitro screening (SELEX) technology of aptamer
The aptamer of specific bond, is obtained the sequence with specific bond SIgA, and in the present invention aptamers SIgA ap-1 is named as
~15.Sequence is as follows:
SIgAap-1:UGACCUAACGGCAUGACUUAUCCAAAUCCUCUCAUCUAUGCUACCAAUCUUACAUUGGCA
CCAUGGACCAGUUACC;
SIgAap-2:UGACCUAACGGCAUGACUUACCUUCCACUCCCUUAUGCAUCUUACAUUCCCCCUCAGGCA
CCAUGGACCAGUUACC;
SIgAap-3:UGACCUAACGGCAUGACUUAUUUCUACCAACUCCUUGUUCCUUCUUCACACCACUUGGCA
CCAUGGACCAGUUACC;
SIgAap-4:UGACCUAACGGCAUGACUUACCCUUAUCCCAAUUUUCUGCUUCAACAUAAACAAUCGGCA
CCAUGGACCAGUUACC;
SIgAap-5:UGACCUAACGGCAUGACUUAUACUAAUCAAACUCUUAGCCCACCCUCUAUCUUAUAGGCA
CCAUGGACCAGUUACC;
SIgAap-6:UGACCUAACGGCAUGACUUACUCACCAUAACUUUUACGAUCUAAUACCCACACACCGGCA
CCAUGGACCAGUUACC;
SIgAap-7:UGACCUAACGGCAUGACUUACCACCUAACUUCUUUAAGCUUAAAUACUUCUUCCAAGGCA
CCAUGGACCAGUUACC;
SIgAap-8:UGACCUAACGGCAUGACUUACCUUCCCCAUUAAAUCAGCACCAUUCACCUCAAUCAGGCA
CCAUGGACCAGUUACC;
SIgAap-9:UGACCUAACGGCAUGACTTACTCACCCATTCACTCATGACTTCATAATCTTTTCTCGGCA
CCATGGACCAGTTACC;
SIgAap-10:TGACCUAACGGCAUGACUUAACCUCAAUUCCAUCCAUAUCUUAAUCUCUAUACAUAGGC
ACCAUGGACCAGUUACC;
SIgAap-11:UGACCUAACGGCAUGACUUAACUCCACAUACACCCCAGACACCCCUAAUAUUAUAUGGC
ACCAUGGACCAGUUACC;
SIgAap-12:UGACCUAACGGCAUGACUUAUAAUAACUACUUUUACCAGCUUCUAUCAUACCAUAUGGC
ACCAUGGACCAGUUACC;
SIgAap-13:UGACCUAACGGCAUGACUUACAAUCUAAAACUCUUCUAUUCUAUACCCUUUAAUUCGGC
ACCAUGGACCAGUUACC;
SIgAap-14:UGACCUAACGGCAUGACUUAAUAACAAAUCCUCCCAUCACACCCACUUAUAAAAAUGGC
ACCAUGGACCAGUUACC;
SIgAap-15:UGACCUAACGGCAUGACUUAUCCUCUCCCUCCUAUAAUACAAUCCUCAAACUCUACGGC
ACCAUGGACCAGUUACC;
The aptamer of the present invention can be used for building test kit, and the test kit can be used for the separation of specificity and quantitative inspection
SIgA is surveyed, fast with separating effect, efficiency high is time-consuming, cost-effective effect.With very wide application prospect.
Beneficial effects of the present invention:Obtain it is a kind of can differential high efficient combine SIgA aptamer, by the way that this is adapted to
Son prepares the concentration for detecting SIgA for becoming quantitative by test kit, you can rapidly and efficiently for the fast of chronic pelvic inflammatory disease
Fast examination.
Specific embodiment
Embodiment 1:Aptamer is screened
From the random oligo DNA library of external synthesis, 5 '-TGACCTAACGGCATGACTTA----N36----
GGCACCATGGACCAGTTACC-3′。
The primer:
F:5 ,-TGACCTAACGGCATGACTTA-3
R:5 ,-GGTAACTGGTCCATGGTGCC-3
It is double-stranded DNA by single-stranded DNA banks amplification, the agarose gel electrophoresiies of product Jing 2% simultaneously cut glue reclaim purification;To return
The double-stranded DNA of receipts is template, and in vitro transcription goes out single stranded RNA random library, transcription product Jing PAGE purification.80 μ g RNA library Jing
Nitrocellulose filter is counter to be weeded out except the RNA molecule with film combination, is then incubated 40min, reactant liquor with 10ug SIgA protein 37s DEG C
Jing nitrocellulose filters are filtered, and wash filter membrane;Then filter membrane is shredded, is placed in elution buffer (6mol/L carbamide, 0.7mol/L
Ammonium acetate, l.6mmol/L EDTA, 0.15%SDS) in boil 5min, be centrifuged, take supernatant, dehydrated alcohol precipitation RNA, and again
In being dissolved in 20 μ 1DEPC water;With RNA as template RT-PCR amplifying doulbe-chain DNA, in vitro transcription goes out RNA libraries for next round sieve
Choosing;Often take turns RT-PCR in screening process and obtain double-stranded DNA library, by template in vitro transcription of the double-stranded DNA RNA aptamer is gone out
Storehouse, screening carries out altogether 16 wheels.Sequencer on the aptamer that last wheel screening is obtained.Measure obtains sequence such as SEQ ID
NO:Shown in 1-15.
The SIgA of the specificity high-affinity of embodiment 2 combines the acquisition of aptamer
RNA aptamer is taken respectively 1.5 μ g, with 37 DEG C of digestion 1h of calf intestinal alkaline phosphatase (CIP), purification reclaims dephosphorization
The RNA of acidifying;By T4 polynucleotide kinase labellings [γ -32P] ATP in dephosphorylized RNA molecule end.10nmol is radiated
Property labelling RNA aptamer be incubated 30min, each group reactant liquor Jing with the SIgA protein 37s DEG C of variable concentrations (1-200nM) respectively
Nitrocellulose filter is filtered, and washs filter membrane, is dried filter membrane, and liquid scintillation counter determines the exit dose remained on filter membrane, same sample
Parallel doing determines twice.Calculate the dissociation constant of each aptamer and SIgA albumen.As a result it is as follows:
Title |
Dissociation constant Kd (nM) |
SIgA ap-1 |
9.7 |
SIgA ap-2 |
8.5 |
SIgA ap-3 |
7.6 |
SIgA ap-4 |
8.8 |
SIgA ap-5 |
9.0 |
SIgA ap-6 |
10.2 |
SIgA ap-7 |
11.3 |
SIgA ap-8 |
9.7 |
SIgA ap-9 |
9.4 |
SIgA ap-10 |
8.6 |
SIgA ap-11 |
11.3 |
SIgA ap-12 |
9.5 |
SIgA ap-13 |
8.8 |
SIgA ap-14 |
9.5 |
SIgA ap-15 |
10.5 |
PBS blanks |
Without binding ability |
Aptamer specificity analyses and stability analyses described in embodiment 3
As can be seen from the above results, 15 aptamers of the invention have very strong binding characteristic, in prior art
Also the aptamer without the binding characteristic can be with reference to SIgA albumen.
The degrading activity of embodiment 4 is analyzed
Human Albumin is respectively adopted, IgA, IgG, hemoglobin carries out specific detection, Jing Guojie with 15 aptamers
Close test to find, these aptamers only keep higher specificity not in combination with these albumen with SIgA protein binding.
By described aptamer, 0.5ug is taken, in being respectively placed in the serum of room temperature, aqueous solution, place surrounding.By RT-
PCR detects, finds placement its Stability Analysis of Structures of surrounding, is not degraded.
The clinical trial analysis of embodiment 5
The clinical sample of the woman vagina secretions that 15 aptamers are respectively used to detect same, includes chronic pelvic
Scorching group and healthy control group, wherein chronic pelvic inflammatory disease group are 60, and healthy control group is 10, is made with the vaginal secretionies of women
For sample to be checked.
70 groups of woman vagina secretions are added in sterile centrifugation tube, PBS solution concussion dissolving is added.To be coupled respectively
There is vaginal secretionies solution of the 15 groups of aptamers of magnetic bead with 70 groups to mix incubation 20 minutes, then Magneto separate, you can to obtain phase
The detached SIgA albumen answered, finds, in 60 chronic pelvic inflammatory disease groups, 15 groups of aptamers detect high concentration by detecting
SIgA albumen, average detected concentration is 158.1mg/L, and is evenly distributed, and the concentration of SIgA albumen is put down in healthy group
It is 10.2mg/L to be equally evenly distributed, it can be seen that, 15 kinds of aptamers of the present invention can be adopted quickly to realize
The Detection results of 100% preliminary screening.With high accuracy.
Above-described embodiment is the present invention preferably embodiment, but embodiments of the present invention not by above-described embodiment
Limit, other any spirit without departing from the present invention and the change, modification, replacement made under principle, combine, simplification,
Equivalent substitute mode is should be, is included within protection scope of the present invention.
Sequence table
The > Yang Ling swallows of < 110
A kind of test kits and its detection method for detecting women's chronic pelvic inflammation of the > of < 120
〈210〉1
〈211〉76
〈212〉RNA
The > artificial sequences of < 213
〈400〉SIgAap-1
UGACCUAACGGCAUGACUUAUCCAAAUCCUCUCAUCUAUGCUACCAAUCUUACAUUGGCACCAUGGACC
AGUUACC;
〈210〉2
〈211〉76
〈212〉RNA
The > artificial sequences of < 213
〈400〉SIgAap-2
UGACCUAACGGCAUGACUUACCUUCCACUCCCUUAUGCAUCUUACAUUCCCCCUCAGGCACCAUGGACC
AGUUACC;
〈210〉3
〈211〉76
〈212〉RNA
The > artificial sequences of < 213
〈400〉SIgAap-3
UGACCUAACGGCAUGACUUAUUUCUACCAACUCCUUGUUCCUUCUUCACACCACUUGGCACCAUGGACC
AGUUACC;
〈210〉4
〈211〉76
〈212〉RNA
The > artificial sequences of < 213
〈400〉SIgAap-4
UGACCUAACGGCAUGACUUACCCUUAUCCCAAUUUUCUGCUUCAACAUAAACAAUCGGCACCAUGGACC
AGUUACC;
〈210〉5
〈211〉76
〈212〉RNA
The > artificial sequences of < 213
〈400〉SIgAap-5
UGACCUAACGGCAUGACUUAUACUAAUCAAACUCUUAGCCCACCCUCUAUCUUAUAGGCACCAUGGACC
AGUUACC;
〈210〉6
〈211〉76
〈212〉RNA
The > artificial sequences of < 213
〈400〉SIgAap-6
UGACCUAACGGCAUGACUUACUCACCAUAACUUUUACGAUCUAAUACCCACACACCGGCACCAUGGACC
AGUUACC;
〈210〉7
〈211〉76
〈212〉RNA
The > artificial sequences of < 213
〈400〉SIgAap-7
UGACCUAACGGCAUGACUUACCACCUAACUUCUUUAAGCUUAAAUACUUCUUCCAAGGCACCAUGGACC
AGUUACC;
〈210〉8
〈211〉76
〈212〉RNA
The > artificial sequences of < 213
〈400〉SIgAap-8
UGACCUAACGGCAUGACUUACCUUCCCCAUUAAAUCAGCACCAUUCACCUCAAUCAGGCACCAUGGACC
AGUUACC;
〈210〉9
〈211〉76
〈212〉RNA
The > artificial sequences of < 213
〈400〉SIgAap-9
UGACCUAACGGCAUGACTTACTCACCCATTCACTCATGACTTCATAATCTTTTCTCGGCACCATGGACC
AGTTACC;
〈210〉10
〈211〉76
〈212〉RNA
The > artificial sequences of < 213
〈400〉SIgAap-10
TGACCUAACGGCAUGACUUAACCUCAAUUCCAUCCAUAUCUUAAUCUCUAUACAUAGGCACCAUGGACC
AGUUACC;
〈210〉11
〈211〉76
〈212〉RNA
The > artificial sequences of < 213
〈400〉SIgAap-11
UGACCUAACGGCAUGACUUAACUCCACAUACACCCCAGACACCCCUAAUAUUAUAUGGCACCAUGGACC
AGUUACC;
〈210〉12
〈211〉76
〈212〉RNA
The > artificial sequences of < 213
〈400〉SIgAap-12
UGACCUAACGGCAUGACUUAUAAUAACUACUUUUACCAGCUUCUAUCAUACCAUAUGGCACCAUGGACC
AGUUACC;
〈210〉13
〈211〉76
〈212〉RNA
The > artificial sequences of < 213
〈400〉SIgAap-13
UGACCUAACGGCAUGACUUACAAUCUAAAACUCUUCUAUUCUAUACCCUUUAAUUCGGCACCAUGGACC
AGUUACC;
〈210〉14
〈211〉76
〈212〉RNA
The > artificial sequences of < 213
〈400〉SIgAap-14
UGACCUAACGGCAUGACUUAAUAACAAAUCCUCCCAUCACACCCACUUAUAAAAAUGGCACCAUGGACC
AGUUACC;
〈210〉15
〈211〉76
〈212〉RNA
The > artificial sequences of < 213
〈400〉SIgAap-15
UGACCUAACGGCAUGACUUAUCCUCUCCCUCCUAUAAUACAAUCCUCAAACUCUACGGCACCAUGGACC
AGUUACC;