CN105738633B - Kit for detecting gynecological chronic pelvic inflammatory disease and detection method of kit - Google Patents

Kit for detecting gynecological chronic pelvic inflammatory disease and detection method of kit Download PDF

Info

Publication number
CN105738633B
CN105738633B CN201610301090.7A CN201610301090A CN105738633B CN 105738633 B CN105738633 B CN 105738633B CN 201610301090 A CN201610301090 A CN 201610301090A CN 105738633 B CN105738633 B CN 105738633B
Authority
CN
China
Prior art keywords
siga
aptamer
kit
inflammatory disease
pelvic inflammatory
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201610301090.7A
Other languages
Chinese (zh)
Other versions
CN105738633A (en
Inventor
宋瑜丽
杜文超
胡永平
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shenzhen Union Medical Biotechnology Co., Ltd.
Original Assignee
Shenzhen Union Medical Biotechnology Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to CN201710158172.5A priority Critical patent/CN106636114A/en
Priority to CN201710157669.5A priority patent/CN106701771A/en
Application filed by Shenzhen Union Medical Biotechnology Co Ltd filed Critical Shenzhen Union Medical Biotechnology Co Ltd
Priority to CN201710157668.0A priority patent/CN106636110A/en
Priority to CN201710158168.9A priority patent/CN106701772A/en
Priority to CN201710157917.6A priority patent/CN106636111A/en
Priority to CN201710158166.XA priority patent/CN106868009A/en
Priority to CN201710158169.3A priority patent/CN106636112A/en
Priority to CN201710157654.9A priority patent/CN106701769A/en
Priority to CN201710157666.1A priority patent/CN106701770A/en
Priority to CN201710158891.7A priority patent/CN106868010A/en
Priority to CN201710157670.8A priority patent/CN106754939A/en
Priority to CN201710158170.6A priority patent/CN106701773A/en
Priority to CN201710158171.0A priority patent/CN106636113A/en
Priority to CN201610301090.7A priority patent/CN105738633B/en
Priority to CN201710157655.3A priority patent/CN106636109A/en
Publication of CN105738633A publication Critical patent/CN105738633A/en
Application granted granted Critical
Publication of CN105738633B publication Critical patent/CN105738633B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/115Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6854Immunoglobulins
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/16Aptamers
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/36Gynecology or obstetrics
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/70Mechanisms involved in disease identification
    • G01N2800/7095Inflammation

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Urology & Nephrology (AREA)
  • Biotechnology (AREA)
  • Hematology (AREA)
  • Genetics & Genomics (AREA)
  • Physics & Mathematics (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Cell Biology (AREA)
  • Pathology (AREA)
  • Wood Science & Technology (AREA)
  • General Physics & Mathematics (AREA)
  • Food Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Analytical Chemistry (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to an aptamer for diagnosing gynecological chronic pelvic inflammatory disease and a kit of the aptamer. The aptamer can be efficiently and specifically combined with SigA, and is obtained by screening an RNA aptamer capable of being specifically combined with SIgA from a random library by a novel combination chemical technology SELEX and with SIgA as a target. The aptamer is specifically combined with SIgA to quantitatively measure the content of SIgA in vaginal secretions, so that the chronic pelvic inflammatory disease can be quickly, efficiently and preliminarily screened. The kit is easy to prepare and low in cost, can be popularized and used in a large range, and has extremely high social value.

Description

A kind of test kit and its detection method for detecting women's chronic pelvic inflammation
Technical field
The present invention relates to medical science, more particularly to a kind of aptamer for chronic pelvic inflammatory disease diagnosis in gynecological And its test kit.
Background technology
Chronic pelvic inflammatory disease refers to female internal genital organses and its surrounding connective tissue, the chronic inflammatory disease of pelvic peritoneum.Its is main Clinical manifestation is menoxenia, leucorrhoea grow in quantity, waist abdomen pain and infertile etc., such as forms chronic adnexitiss, then accessible lump. Symptom is visible:1) chronic pelvic pain:Cicatricial adhesion and pelvic congestion that chronic inflammatory disease is formed, often cause hypogastric region falling inflation, pain Pain and lumbosacral region are ached.Often aggravate after tired, sexual intercourse and before and after menstruation.2) infertile and ectopic pregnancy:Fallopian tube adhesion is blocked Infertile and ectopic pregnancy can be caused.Infertile incidence rate is 20%~30% after acute pelvic inflammatory disease.3) irregular menstruation:Endometritis are normal There is irregular menses;Pelvic congestion can cause menorrhagia;Ovarian function can cause menoxenia when damaging.4) General Symptomies:More not Substantially, only low grade fever sometimes, it is susceptible tired.Because the course of disease time is longer, some patientss may occur in which neurasthenia symptom, such as spirit The depressed, whole body is uncomfortable, have a sleepless night etc..When patient's resistance difference, acute or subacute outbreak is tended to have.Sign, if endometrium Inflammation, uterus increase, tenderness;If salpingitis, then the thick fallopian tube of increasing in rope strip is contacted in uterus one or both sides, and had Mild tenderness.If hydrosalpinx or tubo-ovarian cyst, then Cystic lesions are touched in pelvic cavity one or both sides, activity is more It is limited.If during inflammation of pelvic connective tissue, uterus is in often retroversioflexion, limitation of activity or adhesion are fixed, uterus one or both sides Have lamellar to thicken, tenderness, uterosacral ligament often increase it is thick, be hardened, have tenderness.
The inspection of pelvic inflammatory disease is broadly divided into following three step:The first step checks clinical symptoms.Second step leucorrhea routine examination, this Item is checked and mainly check that vagina cleanness degree, bacterial vaginosis include mycete, infusorian etc..3rd step ultrasound diagnosis, using B ultrasonic Inspection can recognize that the enclosed mass formed together from fallopian tube, ovary and intestinal tube adhesion or abscess have 85% accuracy.But it is light Degree or in isocratic pelvic inflammatory disease be difficult to show feature in Type B ultrasound video.If after carrying out three inspections of the above, not It was found that obvious pelvic inflammatory disease feature, can also do the auxiliary examination of correlation whether to make a definite diagnosis with pelvic inflammatory disease.Clinically, mainly have Three auxiliary examinations below:Section 1 radioisotope scanning in recent years someone using 67 galliums or 111 indium labellings leukocyte Scan to diagnose peritoneal abscess, obtain higher accuracy rate, scan using 111 indiums, accuracy rate may be up to 85~100%. But clinically still apply less at present, if Section 2 ultrasonic examination conditions permit, should also make ultrasonic examination to understand basin to patient Intracavity whether there is enclosed mass.If any enclosed mass, see whether be abscess.This method is noninjurious examination, and simple and easy to do, reliability may be up to More than 90%.Section 3 computed tomography (CT).But detect above, detect that than relatively time-consuming, primary dcreening operation is complicated, and efficiency is low Under, therefore with very big room for improvement.
It is known in the art that cervical secretionses in, SigA sIgA (SIgA) content is to chronic pelvic Scorching diagnostic value.Make SIgA quantitative determinations by extracting mucus in cervical canal, the SIgA average contents of pelvic inflammatory disease patient can be with 166.8mg/L is reached, and the result of normal women is for about 9.8mg/L, the two significant difference, therefore, by quantitative analyses cervix uteri With chronic pelvic inflammatory disease when the content of SIgA tentatively can be used for judging in secretions.
Although can using antibody by enzyme linked immunoassay come the content of SIgA in quantitative analyses cervical secretionses, The requirement of the method antagonist is higher, and testing cost is also higher, therefore, for poor and backward area, and it is not suitable for Spread.
SELEX technologies are a kind of new combinatorial chemistry technique for growing up early 1990s.Can using the technology To screen specificity and the highly affine aptamer of target substance from random single chain oligonucleotide library.Its basic ideas is Iii vitro chemical synthesizes a single stranded oligonucleotide storehouse, mixes with target substance, forms target substance-nucleic acid complexes, and eluting is not associated with Nucleic acid, separate the nucleic acid molecules that combined with target substance, and enter performing PCR as template with this nucleic acid molecules and expand, enter back into lower whorl Screening.By the screening that repeats and amplification, some are not combined with target substance or are had low-affinity, middle affinity with target substance Nucleic acid molecules are washed away, and with leather G materials have the nucleic acid molecules of strong affinity from it is very big with hangar points still out, it is and pure Degree increase with the carrying out of SELEX processes, finally occupy storehouse great majority (>90% or so).From Tuerk and Ellington etc. First with this technology screening to specific adsorption phage T4DNA polymerase and the specific nucleic acid aptamers of organic dye molecule Afterwards, through the development of more than ten years, SELEX technologies have become a kind of important grinds the means of making internal disorder or usurp and instrument.Therefore, using selex Technology, the specific aptamers with reference to SIgA of screening, and then aptamers are prepared the reagent for becoming specific detection SIgA content Box has more important meaning.
The content of the invention
Technical scheme is realized by following steps:
It is an object of the invention to provide a kind of nucleic acid aptamer sequence of SIgA.
In the present invention, the aptamer (sequence 1-15) of described SIgA being capable of specific bond SIgA.
The present invention's further objective is that the purposes for providing the nucleic acid aptamer sequence.According to the sequence in the present invention Row application, can be further used for preparing the test kit of specific binding SIgA.
From the random oligo DNA library of external synthesis, (5 '-TGACCTAACGGCATGACTTA----N36---- GGCACCATGGACCAGTTACC-3 '), wherein N36 is 36 random oligonucleotides;Therefrom filter out and SIgA specific bond Aptamer;By the sequence for filtering out primer P1:TGACCTAACGGCATGACTTA;Primer P2: GGTAACTGGTCCATGGTGCC, is expanded and is carried out TA and be cloned into pMD19-T carriers (purchased from the rich photo bio company in Shanghai), Conversion DH5a antibacterials (are purchased from Beijing Tiangeng biotech firm);Choose white colony and enter performing PCR and determine after positive colony, extract plasmid And sequencing reaction, upper sequencer.
The present invention, with SIgA as target is just sieved, is screened and SIgA using in-vitro screening (SELEX) technology of aptamer The aptamer of specific bond, is obtained the sequence with specific bond SIgA, and in the present invention aptamers SIgA ap-1 is named as ~15.Sequence is as follows:
SIgAap-1:UGACCUAACGGCAUGACUUAUCCAAAUCCUCUCAUCUAUGCUACCAAUCUUACAUUGGCA CCAUGGACCAGUUACC;
SIgAap-2:UGACCUAACGGCAUGACUUACCUUCCACUCCCUUAUGCAUCUUACAUUCCCCCUCAGGCA CCAUGGACCAGUUACC;
SIgAap-3:UGACCUAACGGCAUGACUUAUUUCUACCAACUCCUUGUUCCUUCUUCACACCACUUGGCA CCAUGGACCAGUUACC;
SIgAap-4:UGACCUAACGGCAUGACUUACCCUUAUCCCAAUUUUCUGCUUCAACAUAAACAAUCGGCA CCAUGGACCAGUUACC;
SIgAap-5:UGACCUAACGGCAUGACUUAUACUAAUCAAACUCUUAGCCCACCCUCUAUCUUAUAGGCA CCAUGGACCAGUUACC;
SIgAap-6:UGACCUAACGGCAUGACUUACUCACCAUAACUUUUACGAUCUAAUACCCACACACCGGCA CCAUGGACCAGUUACC;
SIgAap-7:UGACCUAACGGCAUGACUUACCACCUAACUUCUUUAAGCUUAAAUACUUCUUCCAAGGCA CCAUGGACCAGUUACC;
SIgAap-8:UGACCUAACGGCAUGACUUACCUUCCCCAUUAAAUCAGCACCAUUCACCUCAAUCAGGCA CCAUGGACCAGUUACC;
SIgAap-9:UGACCUAACGGCAUGACTTACTCACCCATTCACTCATGACTTCATAATCTTTTCTCGGCA CCATGGACCAGTTACC;
SIgAap-10:TGACCUAACGGCAUGACUUAACCUCAAUUCCAUCCAUAUCUUAAUCUCUAUACAUAGGC ACCAUGGACCAGUUACC;
SIgAap-11:UGACCUAACGGCAUGACUUAACUCCACAUACACCCCAGACACCCCUAAUAUUAUAUGGC ACCAUGGACCAGUUACC;
SIgAap-12:UGACCUAACGGCAUGACUUAUAAUAACUACUUUUACCAGCUUCUAUCAUACCAUAUGGC ACCAUGGACCAGUUACC;
SIgAap-13:UGACCUAACGGCAUGACUUACAAUCUAAAACUCUUCUAUUCUAUACCCUUUAAUUCGGC ACCAUGGACCAGUUACC;
SIgAap-14:UGACCUAACGGCAUGACUUAAUAACAAAUCCUCCCAUCACACCCACUUAUAAAAAUGGC ACCAUGGACCAGUUACC;
SIgAap-15:UGACCUAACGGCAUGACUUAUCCUCUCCCUCCUAUAAUACAAUCCUCAAACUCUACGGC ACCAUGGACCAGUUACC;
The aptamer of the present invention can be used for building test kit, and the test kit can be used for the separation of specificity and quantitative inspection SIgA is surveyed, fast with separating effect, efficiency high is time-consuming, cost-effective effect.With very wide application prospect.
Beneficial effects of the present invention:Obtain it is a kind of can differential high efficient combine SIgA aptamer, by the way that this is adapted to Son prepares the concentration for detecting SIgA for becoming quantitative by test kit, you can rapidly and efficiently for the fast of chronic pelvic inflammatory disease Fast examination.
Specific embodiment
Embodiment 1:Aptamer is screened
From the random oligo DNA library of external synthesis, 5 '-TGACCTAACGGCATGACTTA----N36---- GGCACCATGGACCAGTTACC-3′。
The primer:
F:5 ,-TGACCTAACGGCATGACTTA-3
R:5 ,-GGTAACTGGTCCATGGTGCC-3
It is double-stranded DNA by single-stranded DNA banks amplification, the agarose gel electrophoresiies of product Jing 2% simultaneously cut glue reclaim purification;To return The double-stranded DNA of receipts is template, and in vitro transcription goes out single stranded RNA random library, transcription product Jing PAGE purification.80 μ g RNA library Jing Nitrocellulose filter is counter to be weeded out except the RNA molecule with film combination, is then incubated 40min, reactant liquor with 10ug SIgA protein 37s DEG C Jing nitrocellulose filters are filtered, and wash filter membrane;Then filter membrane is shredded, is placed in elution buffer (6mol/L carbamide, 0.7mol/L Ammonium acetate, l.6mmol/L EDTA, 0.15%SDS) in boil 5min, be centrifuged, take supernatant, dehydrated alcohol precipitation RNA, and again In being dissolved in 20 μ 1DEPC water;With RNA as template RT-PCR amplifying doulbe-chain DNA, in vitro transcription goes out RNA libraries for next round sieve Choosing;Often take turns RT-PCR in screening process and obtain double-stranded DNA library, by template in vitro transcription of the double-stranded DNA RNA aptamer is gone out Storehouse, screening carries out altogether 16 wheels.Sequencer on the aptamer that last wheel screening is obtained.Measure obtains sequence such as SEQ ID NO:Shown in 1-15.
The SIgA of the specificity high-affinity of embodiment 2 combines the acquisition of aptamer
RNA aptamer is taken respectively 1.5 μ g, with 37 DEG C of digestion 1h of calf intestinal alkaline phosphatase (CIP), purification reclaims dephosphorization The RNA of acidifying;By T4 polynucleotide kinase labellings [γ -32P] ATP in dephosphorylized RNA molecule end.10nmol is radiated Property labelling RNA aptamer be incubated 30min, each group reactant liquor Jing with the SIgA protein 37s DEG C of variable concentrations (1-200nM) respectively Nitrocellulose filter is filtered, and washs filter membrane, is dried filter membrane, and liquid scintillation counter determines the exit dose remained on filter membrane, same sample Parallel doing determines twice.Calculate the dissociation constant of each aptamer and SIgA albumen.As a result it is as follows:
Title Dissociation constant Kd (nM)
SIgA ap-1 9.7
SIgA ap-2 8.5
SIgA ap-3 7.6
SIgA ap-4 8.8
SIgA ap-5 9.0
SIgA ap-6 10.2
SIgA ap-7 11.3
SIgA ap-8 9.7
SIgA ap-9 9.4
SIgA ap-10 8.6
SIgA ap-11 11.3
SIgA ap-12 9.5
SIgA ap-13 8.8
SIgA ap-14 9.5
SIgA ap-15 10.5
PBS blanks Without binding ability
Aptamer specificity analyses and stability analyses described in embodiment 3
As can be seen from the above results, 15 aptamers of the invention have very strong binding characteristic, in prior art Also the aptamer without the binding characteristic can be with reference to SIgA albumen.
The degrading activity of embodiment 4 is analyzed
Human Albumin is respectively adopted, IgA, IgG, hemoglobin carries out specific detection, Jing Guojie with 15 aptamers Close test to find, these aptamers only keep higher specificity not in combination with these albumen with SIgA protein binding.
By described aptamer, 0.5ug is taken, in being respectively placed in the serum of room temperature, aqueous solution, place surrounding.By RT- PCR detects, finds placement its Stability Analysis of Structures of surrounding, is not degraded.
The clinical trial analysis of embodiment 5
The clinical sample of the woman vagina secretions that 15 aptamers are respectively used to detect same, includes chronic pelvic Scorching group and healthy control group, wherein chronic pelvic inflammatory disease group are 60, and healthy control group is 10, is made with the vaginal secretionies of women For sample to be checked.
70 groups of woman vagina secretions are added in sterile centrifugation tube, PBS solution concussion dissolving is added.To be coupled respectively There is vaginal secretionies solution of the 15 groups of aptamers of magnetic bead with 70 groups to mix incubation 20 minutes, then Magneto separate, you can to obtain phase The detached SIgA albumen answered, finds, in 60 chronic pelvic inflammatory disease groups, 15 groups of aptamers detect high concentration by detecting SIgA albumen, average detected concentration is 158.1mg/L, and is evenly distributed, and the concentration of SIgA albumen is put down in healthy group It is 10.2mg/L to be equally evenly distributed, it can be seen that, 15 kinds of aptamers of the present invention can be adopted quickly to realize The Detection results of 100% preliminary screening.With high accuracy.
Above-described embodiment is the present invention preferably embodiment, but embodiments of the present invention not by above-described embodiment Limit, other any spirit without departing from the present invention and the change, modification, replacement made under principle, combine, simplification, Equivalent substitute mode is should be, is included within protection scope of the present invention.
Sequence table
The > Yang Ling swallows of < 110
A kind of test kits and its detection method for detecting women's chronic pelvic inflammation of the > of < 120
〈210〉1
〈211〉76
〈212〉RNA
The > artificial sequences of < 213
〈400〉SIgAap-1
UGACCUAACGGCAUGACUUAUCCAAAUCCUCUCAUCUAUGCUACCAAUCUUACAUUGGCACCAUGGACC AGUUACC;
〈210〉2
〈211〉76
〈212〉RNA
The > artificial sequences of < 213
〈400〉SIgAap-2
UGACCUAACGGCAUGACUUACCUUCCACUCCCUUAUGCAUCUUACAUUCCCCCUCAGGCACCAUGGACC AGUUACC;
〈210〉3
〈211〉76
〈212〉RNA
The > artificial sequences of < 213
〈400〉SIgAap-3
UGACCUAACGGCAUGACUUAUUUCUACCAACUCCUUGUUCCUUCUUCACACCACUUGGCACCAUGGACC AGUUACC;
〈210〉4
〈211〉76
〈212〉RNA
The > artificial sequences of < 213
〈400〉SIgAap-4
UGACCUAACGGCAUGACUUACCCUUAUCCCAAUUUUCUGCUUCAACAUAAACAAUCGGCACCAUGGACC AGUUACC;
〈210〉5
〈211〉76
〈212〉RNA
The > artificial sequences of < 213
〈400〉SIgAap-5
UGACCUAACGGCAUGACUUAUACUAAUCAAACUCUUAGCCCACCCUCUAUCUUAUAGGCACCAUGGACC AGUUACC;
〈210〉6
〈211〉76
〈212〉RNA
The > artificial sequences of < 213
〈400〉SIgAap-6
UGACCUAACGGCAUGACUUACUCACCAUAACUUUUACGAUCUAAUACCCACACACCGGCACCAUGGACC AGUUACC;
〈210〉7
〈211〉76
〈212〉RNA
The > artificial sequences of < 213
〈400〉SIgAap-7
UGACCUAACGGCAUGACUUACCACCUAACUUCUUUAAGCUUAAAUACUUCUUCCAAGGCACCAUGGACC AGUUACC;
〈210〉8
〈211〉76
〈212〉RNA
The > artificial sequences of < 213
〈400〉SIgAap-8
UGACCUAACGGCAUGACUUACCUUCCCCAUUAAAUCAGCACCAUUCACCUCAAUCAGGCACCAUGGACC AGUUACC;
〈210〉9
〈211〉76
〈212〉RNA
The > artificial sequences of < 213
〈400〉SIgAap-9
UGACCUAACGGCAUGACTTACTCACCCATTCACTCATGACTTCATAATCTTTTCTCGGCACCATGGACC AGTTACC;
〈210〉10
〈211〉76
〈212〉RNA
The > artificial sequences of < 213
〈400〉SIgAap-10
TGACCUAACGGCAUGACUUAACCUCAAUUCCAUCCAUAUCUUAAUCUCUAUACAUAGGCACCAUGGACC AGUUACC;
〈210〉11
〈211〉76
〈212〉RNA
The > artificial sequences of < 213
〈400〉SIgAap-11
UGACCUAACGGCAUGACUUAACUCCACAUACACCCCAGACACCCCUAAUAUUAUAUGGCACCAUGGACC AGUUACC;
〈210〉12
〈211〉76
〈212〉RNA
The > artificial sequences of < 213
〈400〉SIgAap-12
UGACCUAACGGCAUGACUUAUAAUAACUACUUUUACCAGCUUCUAUCAUACCAUAUGGCACCAUGGACC AGUUACC;
〈210〉13
〈211〉76
〈212〉RNA
The > artificial sequences of < 213
〈400〉SIgAap-13
UGACCUAACGGCAUGACUUACAAUCUAAAACUCUUCUAUUCUAUACCCUUUAAUUCGGCACCAUGGACC AGUUACC;
〈210〉14
〈211〉76
〈212〉RNA
The > artificial sequences of < 213
〈400〉SIgAap-14
UGACCUAACGGCAUGACUUAAUAACAAAUCCUCCCAUCACACCCACUUAUAAAAAUGGCACCAUGGACC AGUUACC;
〈210〉15
〈211〉76
〈212〉RNA
The > artificial sequences of < 213
〈400〉SIgAap-15
UGACCUAACGGCAUGACUUAUCCUCUCCCUCCUAUAAUACAAUCCUCAAACUCUACGGCACCAUGGACC AGUUACC;

Claims (2)

1. a kind of test kit for detecting chronic pelvic inflammatory disease, it is characterised in that:Containing the fit of SIgA, institute can be specifically bound Fit sequence is stated for shown in SEQ ID No.1.
2. the application in the fit test kit for preparing detection chronic pelvic inflammatory disease of the sequence as shown in SEQ ID No.1.
CN201610301090.7A 2016-05-08 2016-05-08 Kit for detecting gynecological chronic pelvic inflammatory disease and detection method of kit Active CN105738633B (en)

Priority Applications (15)

Application Number Priority Date Filing Date Title
CN201710158891.7A CN106868010A (en) 2016-05-08 2016-05-08 A kind of kit and its detection method for detecting women's chronic pelvic inflammation
CN201710158170.6A CN106701773A (en) 2016-05-08 2016-05-08 Kit for detecting gynecologic chronic pelvic inflammatory disease and detection method thereof
CN201710157669.5A CN106701771A (en) 2016-05-08 2016-05-08 Kit for detecting gynecologic chronic pelvic inflammation and detection method of kit
CN201710157917.6A CN106636111A (en) 2016-05-08 2016-05-08 Kit and detection method for detecting gynecological chronic pelvic inflammation
CN201710158166.XA CN106868009A (en) 2016-05-08 2016-05-08 A kind of kit and its detection method for detecting women's chronic pelvic inflammation
CN201710158169.3A CN106636112A (en) 2016-05-08 2016-05-08 Kit for detecting gynecologic chronic pelvic inflammation and detection method of kit
CN201710157654.9A CN106701769A (en) 2016-05-08 2016-05-08 Kit for detecting gynecological chronic pelvic inflammation and detection method of kit
CN201710157666.1A CN106701770A (en) 2016-05-08 2016-05-08 Kit for detecting gynecologic chronic pelvic inflammation and detection method thereof
CN201710158172.5A CN106636114A (en) 2016-05-08 2016-05-08 Kit for detection on gynecologic chronic pelvic inflammation and detection method thereof
CN201710158168.9A CN106701772A (en) 2016-05-08 2016-05-08 Kit for detecting gynecologic chronic pelvic inflammation and detection method thereof
CN201710157668.0A CN106636110A (en) 2016-05-08 2016-05-08 Kit for detecting gynecologic chronic pelvic inflammation and detection method thereof
CN201710158171.0A CN106636113A (en) 2016-05-08 2016-05-08 Kit used for detecting gynecological chronic pelvic inflammation and detection method thereof
CN201610301090.7A CN105738633B (en) 2016-05-08 2016-05-08 Kit for detecting gynecological chronic pelvic inflammatory disease and detection method of kit
CN201710157655.3A CN106636109A (en) 2016-05-08 2016-05-08 Kit for detecting chronic pelvic inflammatory disease of gynaecology and detection method thereof
CN201710157670.8A CN106754939A (en) 2016-05-08 2016-05-08 A kind of kit and its detection method for detecting women's chronic pelvic inflammation

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201610301090.7A CN105738633B (en) 2016-05-08 2016-05-08 Kit for detecting gynecological chronic pelvic inflammatory disease and detection method of kit

Related Child Applications (14)

Application Number Title Priority Date Filing Date
CN201710158171.0A Division CN106636113A (en) 2016-05-08 2016-05-08 Kit used for detecting gynecological chronic pelvic inflammation and detection method thereof
CN201710157917.6A Division CN106636111A (en) 2016-05-08 2016-05-08 Kit and detection method for detecting gynecological chronic pelvic inflammation
CN201710157666.1A Division CN106701770A (en) 2016-05-08 2016-05-08 Kit for detecting gynecologic chronic pelvic inflammation and detection method thereof
CN201710157668.0A Division CN106636110A (en) 2016-05-08 2016-05-08 Kit for detecting gynecologic chronic pelvic inflammation and detection method thereof
CN201710157654.9A Division CN106701769A (en) 2016-05-08 2016-05-08 Kit for detecting gynecological chronic pelvic inflammation and detection method of kit
CN201710157669.5A Division CN106701771A (en) 2016-05-08 2016-05-08 Kit for detecting gynecologic chronic pelvic inflammation and detection method of kit
CN201710158172.5A Division CN106636114A (en) 2016-05-08 2016-05-08 Kit for detection on gynecologic chronic pelvic inflammation and detection method thereof
CN201710158170.6A Division CN106701773A (en) 2016-05-08 2016-05-08 Kit for detecting gynecologic chronic pelvic inflammatory disease and detection method thereof
CN201710157655.3A Division CN106636109A (en) 2016-05-08 2016-05-08 Kit for detecting chronic pelvic inflammatory disease of gynaecology and detection method thereof
CN201710158169.3A Division CN106636112A (en) 2016-05-08 2016-05-08 Kit for detecting gynecologic chronic pelvic inflammation and detection method of kit
CN201710158891.7A Division CN106868010A (en) 2016-05-08 2016-05-08 A kind of kit and its detection method for detecting women's chronic pelvic inflammation
CN201710158166.XA Division CN106868009A (en) 2016-05-08 2016-05-08 A kind of kit and its detection method for detecting women's chronic pelvic inflammation
CN201710157670.8A Division CN106754939A (en) 2016-05-08 2016-05-08 A kind of kit and its detection method for detecting women's chronic pelvic inflammation
CN201710158168.9A Division CN106701772A (en) 2016-05-08 2016-05-08 Kit for detecting gynecologic chronic pelvic inflammation and detection method thereof

Publications (2)

Publication Number Publication Date
CN105738633A CN105738633A (en) 2016-07-06
CN105738633B true CN105738633B (en) 2017-05-03

Family

ID=56288869

Family Applications (15)

Application Number Title Priority Date Filing Date
CN201710158166.XA Pending CN106868009A (en) 2016-05-08 2016-05-08 A kind of kit and its detection method for detecting women's chronic pelvic inflammation
CN201710158168.9A Pending CN106701772A (en) 2016-05-08 2016-05-08 Kit for detecting gynecologic chronic pelvic inflammation and detection method thereof
CN201710158891.7A Pending CN106868010A (en) 2016-05-08 2016-05-08 A kind of kit and its detection method for detecting women's chronic pelvic inflammation
CN201710157654.9A Pending CN106701769A (en) 2016-05-08 2016-05-08 Kit for detecting gynecological chronic pelvic inflammation and detection method of kit
CN201710158171.0A Pending CN106636113A (en) 2016-05-08 2016-05-08 Kit used for detecting gynecological chronic pelvic inflammation and detection method thereof
CN201710158170.6A Pending CN106701773A (en) 2016-05-08 2016-05-08 Kit for detecting gynecologic chronic pelvic inflammatory disease and detection method thereof
CN201710157917.6A Pending CN106636111A (en) 2016-05-08 2016-05-08 Kit and detection method for detecting gynecological chronic pelvic inflammation
CN201710157655.3A Pending CN106636109A (en) 2016-05-08 2016-05-08 Kit for detecting chronic pelvic inflammatory disease of gynaecology and detection method thereof
CN201710158169.3A Pending CN106636112A (en) 2016-05-08 2016-05-08 Kit for detecting gynecologic chronic pelvic inflammation and detection method of kit
CN201710157666.1A Pending CN106701770A (en) 2016-05-08 2016-05-08 Kit for detecting gynecologic chronic pelvic inflammation and detection method thereof
CN201710157669.5A Pending CN106701771A (en) 2016-05-08 2016-05-08 Kit for detecting gynecologic chronic pelvic inflammation and detection method of kit
CN201710157670.8A Pending CN106754939A (en) 2016-05-08 2016-05-08 A kind of kit and its detection method for detecting women's chronic pelvic inflammation
CN201710158172.5A Pending CN106636114A (en) 2016-05-08 2016-05-08 Kit for detection on gynecologic chronic pelvic inflammation and detection method thereof
CN201610301090.7A Active CN105738633B (en) 2016-05-08 2016-05-08 Kit for detecting gynecological chronic pelvic inflammatory disease and detection method of kit
CN201710157668.0A Pending CN106636110A (en) 2016-05-08 2016-05-08 Kit for detecting gynecologic chronic pelvic inflammation and detection method thereof

Family Applications Before (13)

Application Number Title Priority Date Filing Date
CN201710158166.XA Pending CN106868009A (en) 2016-05-08 2016-05-08 A kind of kit and its detection method for detecting women's chronic pelvic inflammation
CN201710158168.9A Pending CN106701772A (en) 2016-05-08 2016-05-08 Kit for detecting gynecologic chronic pelvic inflammation and detection method thereof
CN201710158891.7A Pending CN106868010A (en) 2016-05-08 2016-05-08 A kind of kit and its detection method for detecting women's chronic pelvic inflammation
CN201710157654.9A Pending CN106701769A (en) 2016-05-08 2016-05-08 Kit for detecting gynecological chronic pelvic inflammation and detection method of kit
CN201710158171.0A Pending CN106636113A (en) 2016-05-08 2016-05-08 Kit used for detecting gynecological chronic pelvic inflammation and detection method thereof
CN201710158170.6A Pending CN106701773A (en) 2016-05-08 2016-05-08 Kit for detecting gynecologic chronic pelvic inflammatory disease and detection method thereof
CN201710157917.6A Pending CN106636111A (en) 2016-05-08 2016-05-08 Kit and detection method for detecting gynecological chronic pelvic inflammation
CN201710157655.3A Pending CN106636109A (en) 2016-05-08 2016-05-08 Kit for detecting chronic pelvic inflammatory disease of gynaecology and detection method thereof
CN201710158169.3A Pending CN106636112A (en) 2016-05-08 2016-05-08 Kit for detecting gynecologic chronic pelvic inflammation and detection method of kit
CN201710157666.1A Pending CN106701770A (en) 2016-05-08 2016-05-08 Kit for detecting gynecologic chronic pelvic inflammation and detection method thereof
CN201710157669.5A Pending CN106701771A (en) 2016-05-08 2016-05-08 Kit for detecting gynecologic chronic pelvic inflammation and detection method of kit
CN201710157670.8A Pending CN106754939A (en) 2016-05-08 2016-05-08 A kind of kit and its detection method for detecting women's chronic pelvic inflammation
CN201710158172.5A Pending CN106636114A (en) 2016-05-08 2016-05-08 Kit for detection on gynecologic chronic pelvic inflammation and detection method thereof

Family Applications After (1)

Application Number Title Priority Date Filing Date
CN201710157668.0A Pending CN106636110A (en) 2016-05-08 2016-05-08 Kit for detecting gynecologic chronic pelvic inflammation and detection method thereof

Country Status (1)

Country Link
CN (15) CN106868009A (en)

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018051580A1 (en) 2016-09-15 2018-03-22 Necソリューションイノベータ株式会社 Nucleoside derivative or salt thereof, reagent for synthesizing polynucleotide, method for producing polynucleotide, polynucleotide, and method for producing binding nucleic acid molecule
WO2018051581A1 (en) 2016-09-15 2018-03-22 Necソリューションイノベータ株式会社 Nucleoside derivative or salt thereof, reagent for synthesizing polynucleotide, method for producing polynucleotide, polynucleotide, and method for producing binding nucleic acid molecule
WO2018051569A1 (en) * 2016-09-15 2018-03-22 Necソリューションイノベータ株式会社 Secretory immunoglobulin a (siga)-binding nucleic acid molecule, sensor for siga analysis, and analysis method for siga
JP2019149979A (en) * 2018-03-05 2019-09-12 Necソリューションイノベータ株式会社 SECRETORY IMMUNOGLOBULIN A (sIgA)-BINDING NUCLEIC ACID MOLECULE, sIgA DETECTION SENSOR, sIgA DETECTION REAGENT, AND sIgA ANALYSIS METHOD
CN114592080B (en) * 2022-04-01 2023-12-01 领航基因科技(杭州)有限公司 RT-ddPCR reagent for detecting four pathogenic bacteria

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1105270A (en) * 1994-01-14 1995-07-19 中国韬奋基金会 Product containing secretion-type immunoglobulin A and preparing process thereof
CN101545904A (en) * 2009-03-06 2009-09-30 江苏省农业科学院 Anti-mycoplasma hyopneumoniae SIgA indirect ELISA detection method
CN103197057A (en) * 2013-03-28 2013-07-10 天津市宝坻区人民医院 Secreting type IgA endomethal antibody detection kit and use method of secreting type IgA endomethal antibody detection kit
CN103163292A (en) * 2013-03-28 2013-06-19 天津市宝坻区人民医院 Secreting type IgA anticardiolipin antibody detection kit and use method
KR101565652B1 (en) * 2013-10-16 2015-11-04 인천대학교 산학협력단 Biosensor for detecting target material using graphene oxide as electrochemical indicator and method for preparing the same
CN103604932B (en) * 2013-11-27 2015-05-20 辽宁宏福肉类集团有限公司 Detection method for concentration of internal secretion type immune globulin of cattle intestinal mucosa

Also Published As

Publication number Publication date
CN106701770A (en) 2017-05-24
CN106701773A (en) 2017-05-24
CN105738633A (en) 2016-07-06
CN106701772A (en) 2017-05-24
CN106636114A (en) 2017-05-10
CN106868010A (en) 2017-06-20
CN106636110A (en) 2017-05-10
CN106754939A (en) 2017-05-31
CN106636109A (en) 2017-05-10
CN106701769A (en) 2017-05-24
CN106701771A (en) 2017-05-24
CN106636111A (en) 2017-05-10
CN106636112A (en) 2017-05-10
CN106636113A (en) 2017-05-10
CN106868009A (en) 2017-06-20

Similar Documents

Publication Publication Date Title
CN105738633B (en) Kit for detecting gynecological chronic pelvic inflammatory disease and detection method of kit
CN105647932A (en) Alpha-fetoprotein nucleic acid aptamer AFP1 and preparation method thereof
CN106018828A (en) Reagent kit for detecting intestinal diseases
CN105779459A (en) Aptamer for diagnosing rupture of fetal membrane in gynaecology and obstetrics and kit thereof
CN105602958A (en) Alpha fetoprotein aptamer AFP5 and preparation method thereof
CN105334327B (en) Kit and method for detecting ophthalmopathy
CN105223358B (en) A kind of test kit of carcinoma of endometrium specific detection
CN105602959A (en) Alpha fetoprotein aptamer AFP2 and preparation method thereof
CN105334328B (en) Kit and method for detecting ophthalmic diseases
WO2024123061A1 (en) Composition for diagnosing endometriosis
CN105802972A (en) Aptamer and kit for diagnosing fetus premature delivery in gynaecology and obstetrics department
CN105586345A (en) Alpha fetoprotein nucleic acid aptamer AFP3 and preparation method thereof
CN116218859A (en) Aptamer capable of specifically recognizing tumor and application thereof
CN116024328A (en) Application of miRNA in exosomes in preparation of differential diagnosis and early screening kit for neurodegenerative diseases
CN105647933A (en) Alpha-fetoprotein nucleic acid aptamer AFP4 and preparation method thereof
CN105823894A (en) Kit for specific detection of endometrial cancer
CN105823895A (en) Kit for specific detection of endometrial cancer
CN105823879A (en) Kit for specific detection of endometrial cancer
CN105785007A (en) Kit for specific detection of endometrial cancer

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
CB03 Change of inventor or designer information

Inventor after: Song Yuli

Inventor after: Du Wenchao

Inventor after: Hu Yongping

Inventor before: Yang Lingyan

CB03 Change of inventor or designer information
TA01 Transfer of patent application right

Effective date of registration: 20170406

Address after: 518000 Shenzhen, Nanshan District Province, a high tech in the middle of the road No. ten Shenzhen biological incubation base, building 212, room 2, No.

Applicant after: Shenzhen Union Medical Biotechnology Co., Ltd.

Address before: 510090 Yuexiu District East Road, Guangdong,, No. 729, Guangdong University of Technology

Applicant before: Yang Lingyan

TA01 Transfer of patent application right
GR01 Patent grant
GR01 Patent grant