CN105647933A - Alpha-fetoprotein nucleic acid aptamer AFP4 and preparation method thereof - Google Patents

Alpha-fetoprotein nucleic acid aptamer AFP4 and preparation method thereof Download PDF

Info

Publication number
CN105647933A
CN105647933A CN201610176305.7A CN201610176305A CN105647933A CN 105647933 A CN105647933 A CN 105647933A CN 201610176305 A CN201610176305 A CN 201610176305A CN 105647933 A CN105647933 A CN 105647933A
Authority
CN
China
Prior art keywords
alpha
fetoprotein
aptamer
nucleic acid
preparation
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201610176305.7A
Other languages
Chinese (zh)
Inventor
徐大鹏
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Individual
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Priority to CN201610176305.7A priority Critical patent/CN105647933A/en
Publication of CN105647933A publication Critical patent/CN105647933A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/16—Aptamers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/46—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from vertebrates
    • G01N2333/47—Assays involving proteins of known structure or function as defined in the subgroups

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Biotechnology (AREA)
  • Hematology (AREA)
  • General Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Urology & Nephrology (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • General Physics & Mathematics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Pathology (AREA)
  • Plant Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Food Science & Technology (AREA)
  • Cell Biology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses an alpha-fetoprotein nucleic acid aptamer with high specificity and high affinity and a preparation method thereof. The alpha-fetoprotein nucleic acid aptamer has the nucleotide sequence of ggatgcggta acggtacgta cctgtatagt gtgacatcct gtctccaacc acctgctgac gtgc and is named AFP4. The preparation method of the alpha-fetoprotein nucleic acid aptamer comprises the steps of constructing a random sequence library, screening a target material, i.e., a nucleic acid complex, separating a target oligonucleotide aptamer, carrying out PCR (Polymerase Chain Reaction) amplification on the target oligonucleotide aptamer, carrying out cyclic screening so as to obtain an aptamer with high specificity, and modifying an alpha-fetoprotein nucleic acid aptamer. The prepared nucleic acid aptamer is non-toxic, is small in molecular weight, is easy to synthesize and mark, only specifically recognizes alpha-fetoprotein, does not recognize and combine other heterotype globulin or analogs thereof and can serve as a molecular beacon for detecting the content of alpha-fetoprotein.

Description

Alpha-fetoprotein aptamer AFP4 and preparation method thereof
Technical field
The invention belongs to globulin detection technique field, relate to a kind of nucleic acid, alpha-fetoprotein aptamer particularly relating to high specific and high-affinity and preparation method thereof.
Background technology
Alpha-fetoprotein (AFP) is a kind of glycoprotein, and under normal circumstances, this albumen is essentially from the hepatocyte of embryo, and after fetal birth, about two weeks alpha-fetoproteins disappear from blood, therefore in normal human serum the content of alpha-fetoprotein still less than 20 micrograms per litre. Alpha-fetoprotein AFP in puerpera's amniotic fluid or Maternal plasma can be used for fetus prenatal monitoring. As when neural-tube defect, spina bifida, anencephaly etc., AFP can be entered amniotic fluid by open neurocele and cause that its content in amniotic fluid significantly raises. Fetus birth defect such as death, teratoma in uterine cavity also can have AFP in amniotic fluid to increase. AFP can be partially into parent blood circulation through amniotic fluid. At the parent of 85% spina bifida and anencephaly, plasma A FP has diagnostic value in the visible rising of gestation 16-18 week, but must be combined with clinical experience, in order to avoid there is false-positive mistake.
The method of detection alpha-fetoprotein has several, the alpha-fetoprotein that radioimmunology records is more than alpha-fetoprotein (AFP)5 00 micrograms per litre and continues 4 weeks persons, or alpha-fetoprotein is 200��500 micrograms per litre, lasting 8 weeks persons, after getting rid of other factor such as acute hepatitis, chronic hepatitis, posthepatitic cirrhosis causing alpha-fetoprotein to increase, embryoma, alimentary tract cancer, in conjunction with localization examination, need to can make diagnosis such as B ultrasonic, CT, magnetic resonance (MRI) and hepatic angiography etc. But, when the women of normal pregnancy, minority hepatitis and liver cirrhosis, gonad malignant tumor, alpha-fetoprotein also can raise, but the amplitude raised is high like that not as hepatocarcinoma. Patient with liver cirrhosis serum alpha-fetoprotein concentration is many between 25��200 micrograms per litre, is typically in 2 months with the good of the state of an illness then declines, most not over 2 months; Raising with transaminase, after transaminase declines, alpha-fetoprotein also declines therewith simultaneously, serum alpha-fetoprotein concentration often and transaminase be parallel relation. If alpha-fetoprotein concentration is more than 500 micrograms per litre, though there being transaminase to raise, but the probability of hepatocarcinoma is big, and transaminase declines or stable, and alpha-fetoprotein rises, and also answers strong suspicion hepatocarcinoma.The detection method of current alpha-fetoprotein has three major types: chromatography, Immunological Method, Enzymatic cycling. Chromatography is highly sensitive, specificity good, but sample treatment, separation condition, chromatographic column prepare all multi-Varis so that it is be difficult to standardization; And hplc device is expensive, technical conditions require height, needs special attendant so that it is Difficulty. Immunological Method needs the free AFP form of reduction, and antibody fluorescence analytic process and turbidimetry can not directly detect sequestered Homocysteine, can only detect the total Homocysteine of blood plasma, with reducing agent 37 DEG C half an hour ovum educate blood sample carried out reduction treatment. Immunological Method needs just to go out result, complex operation step in more than one hour, can be affected by some uncertain factors since it is desired that carry out reduction treatment. Enzymatic cycling process is loaded down with trivial details, and detection limit is low, it is relatively big to produce error, expensive, therefore can not get promoting.
Aptamer is the novel identification molecule of class that developed recently gets up, and is subject to the extensive concern of scientist in recent years, and the aptamer for important physiologically active molecule is screened out in a large number; The various analysis methods based on aptamer and technology are in the news; Aptamer medicine " Macugen " was also listed by FDA official approval in 2005. The oligonucleotide sequence that SELEX technology screening obtains is referred to as aptamer, and domestic its is translated as aptamer, nucleic acid aptamer, aptamer or aptamer etc. SELEX technology refers to that applied chemistry method synthesizes jumbo random oligonucleotide (being made up of the fixed sequence program at two ends and middle random sequence) library, by applying selection pressure (in conjunction with target, the process of elutriation and target high special binding fragment), and in conjunction with Amplification Technologies, circulation selective enrichment through too much wheel, obtaining the oligonucleotide molecules that is combined with target material high special, it is possible to be RNA can also be DNA, length is generally 25 ~ 60 nucleotide.
As from the foregoing, aptamer is combined the hypersensitivity and high specific that present with target material, it is made to have a good application prospect in medical diagnosis on disease, although clinical practice report ripe at present is less, but the research applying fit detection globulin is on the increase, and also constantly occurs based on fit new detecting technique. But the efficient specific recognition research being directed to alpha-fetoprotein being currently based on aptamer also lacks very much, and be directed to alpha-fetoprotein aptamer and screening preparation method there is not yet report.
Summary of the invention
The technical problem to be solved in the present invention is the deficiency overcoming existing alpha-fetoprotein detection technique, fill up the aptamer that yet there are no alpha-fetoprotein and screening preparation method is blank, a kind of alpha-fetoprotein aptamer and preparation method thereof, aptamer provided by the present invention name AFP4 are provided.
The solution of the present invention is by being achieved in that: a kind of alpha-fetoprotein aptamer, it is characterized in that, its sequence of the nucleotide sequence of described aptamer is: ggatgcggtaacggtacgtacctgtatagtgtgacatcctgtctccaaccacctgc tgacgtgc.
The derivant of the above alpha-fetoprotein aptamer, described derivant includes any one in following four:
(1) after the base A on aptamer optional position described in claim 1, T, C or G being replaced as rare bases methylated purines, dihydrouracil or hypoxanthine, the nucleic acid aptamer derivative obtained;
(2) phosphorothioate backbone that the skeleton of the nucleotide sequence of aptamer described in claim 1 derives;
(3) peptide nucleic acid(PNA) that aptamer described in claim 1 is transformed into;
(4) the lock nucleic acid that aptamer described in claim 1 is transformed into.
More than one described alpha-fetoprotein aptamer or derivatives thereofs are identifying, are detecting alpha-fetoprotein or the application of the test kit aspect of preparation detection alpha-fetoprotein.
In order to make disclosure abundant, the preparation method step of alpha-fetoprotein aptamer of the present invention is as follows:
The preparation method of alpha-fetoprotein aptamer comprises the following steps:
1) synthesizing single-stranded DNA random sequence oligonucleotides storehouse: the two ends in described single stranded DNA random oligonucleotide storehouse are fixed sequence program, as pcr amplification PBR, centre is the random sequence of 60 bases, storage capacity 1015Above. Described PCR primer is:
Primer 1:5 '-ATACCAGCTTATTCAATT-3 '
Primer 2: 5 '-Biotin-AGATTGCACTTACTATCT-3 '
Described PCR primer 2 holds biotin labeling with 5 '.
2) preparation connects the solid-phase matrix of alpha-fetoprotein: with micro-magnetic bead for substrate, by chemical method, alpha-fetoprotein is covalently attached on micro-magnetic bead by its carboxyl.
3) first screening purpose oligonucleotide sequence: DNA random oligonucleotide storehouse is mixed with alpha-fetoprotein, screening removes in DNA random oligonucleotide storehouse and does not combine and the oligonucleotide sequence of non-specific binding alpha-fetoprotein, reclaims the nucleotide sequence of specific bond alpha-fetoprotein.
4) the secondary single strand dna oligonucleotide storehouse of preparation: the oligonucleotide sequence of gained in step 3 Yu alpha-fetoprotein specific bond is carried out pcr amplification, pcr amplification product is easily separated with the micro-magnetic bead of Streptavidin for substrate, unwind through alkaline denaturation, filter, purification, obtain secondary DNA oligonucleotide library, screen for next round.
5) screen and identify alpha-fetoprotein aptamer: the secondary single strand dna oligonucleotide storehouse of step 4 gained is carried out next round screening, after 15 take turns screening, obtaining target widow's nucleotide sequence. Clone and check order described target widow's nucleotide sequence, join aptamer adsorption measurement by enzyme and identify its specificity being combined with alpha-fetoprotein and affinity.
6) described alpha-fetoprotein aptamer can be used for detecting alpha-fetoprotein as detectable.
Beneficial effects of the present invention is as follows: the Nucleic acid aptamer molecules amount that (1) screens is little, and avirulence is conducive to the design of molecular probe, it is easy to synthesis and labelling; (2) the identification alpha-fetoprotein that aptamer is only special, not in conjunction with non-alpha-fetoprotein and other globulin molecule, in conjunction with 20 ~ 80 times that the ability of alpha-fetoprotein is the ability in conjunction with non-alpha-fetoprotein Hb, the reagent differentiating alpha-fetoprotein can be become, improve specificity and the sensitivity of detection method, simplification detection method, reduces cost.
Accompanying drawing explanation
Fig. 1 is the binding ability of aptamer of the present invention and alpha-fetoprotein, in Fig. 1, abscissa is aptamer dna concentration, vertical coordinate is dissociation constant (Kd) relative value, in figure, AFP curve represents the binding curve that the binding curve of aptamer AFP4 and alpha-fetoprotein, Ap curve represent aptamer AFP4 and non-alpha-fetoprotein (globulin A p).
Detailed description of the invention
Implement the preparation of the aptamer AFP4 of 1 alpha-fetoprotein specific bond
Building random sequence oligonucleotides storehouse: synthetic single-stranded DNA sequence, building storage capacity is 1 �� 105Single stranded DNA random sequence oligonucleotides storehouse, the DNA sequence that single stranded DNA random oligonucleotide storehouse includes is:
5��-GGATCCACCAGCGTCATCAGCA-N25~40-AGATAGTAAGTGCAATCTGGC-3��
The DNA sequence in described single stranded DNA random oligonucleotide storehouse includes middle random sequence N25~60With two ends fixed sequence program, described middle random sequence N25~40Being the random sequence of 30 ~ 40 bases, described two ends fixed sequence program is: 5 '-GGATCCACCAGCGTCATCAGCA, 3 '-CGGTCTAACGTGAATGATAGA, and described two ends fixed sequence program is pcr amplification PBR.
1) by 0.5ml (1x109Microgranule) micro-magnetic bead and the 1mol/L alpha-fetoprotein with activation amino of Invitrogen company be at coupling buffer (20mM potassium phosphate buffer, 0.15MNaCl, 1mMDTT, pH5.5) mixing in, add 200ul coupling agent solution [57%1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC)], gently mix 24 hours when above-mentioned reaction is placed in 25oC. After Rhizoma Nelumbinis is connected magnetic bead magnetic bead separating device and cleanout fluid (PBS, 1mMDTT, crowd H7.3) cleaning of alpha-fetoprotein, it is resuspended in 0.5mlPBS.
2) 5nmol single-stranded DNA banks is dissolved in binding buffer liquid (100mMNaCl, 20mMTris-HClpH7.6,2mMMgCl2,5mMKCl, 1mMCaCl2,0.02%Tween20,1mMDTT), being heated processing: 90oC heats 10min, is placed in 10min on ice, then temperature places 5min.
3), after the single-stranded DNA banks handled well and the micro-magnetic bead being combined with globulin being hatched, collect not in conjunction with the liquid of magnetic bead.
4) together with alpha-fetoprotein-magnetic bead of obtaining with 25ul step 1) of liquid that step 3) is collected in binding buffer liquid 37oC incubation 30min.
5) with the magnetic bead after binding buffer liquid washing incubation, it is subsequently adding 200ul elution buffer (20mMTris-HClpH7.6,200mMNaCl, 10mMEDTA), after 92oC hatches 5min, reclaim the elution buffer with single strand oligonucleotide acid sequence, carry out PCR reaction.
6) PCR response procedures is: 94oC denaturation 5min; 94oC30s, 47oC1min, 72oC1min, expand 20 circulations; Final extension is 72oC10min.
7) PCR primer is that 5 ' ends are with biotin labeled double-stranded DNA, product is mixed with Streptavidin MagneSphere, after 25oC hatches 30min, make double-stranded DNA degeneration be single stranded DNA with 0.15mol/LNaOH, namely obtained the single-stranded DNA banks of next round screening by desalting column purification.
8) use the new single-stranded DNA banks that obtains of 200pmol step 7), repeat step 2) to the screening sequence of step 8), carry out 15 altogether and take turns screening. Finally clone and check order and the 15th take turns single-stranded DNA banks, obtain AFP4 nucleotide sequence: ggatgcggtaacggtacgtacctgtatagtgtgacatcctgtctccaaccacctgc tgacgtgc.
Embodiment 2 detects the binding ability of aptamer AFP4 and alpha-fetoprotein with flow cytometer showed method
1) the synthesis 5 ' end alpha-fetoprotein aptamer with fluorophor FAM labelling.
2) 0nml/L, 5nml/L, 10nml/L are used, 20nml/L, micro-magnetic bead of aptamer connection alpha-fetoprotein (AFP) of the FAM labelling of 50nml/L, 100nml/L, 200nml/L Concentraton gradient measures the dissociation constant (kd) of alpha-fetoprotein aptamer. Fit with the above-mentioned various concentration nucleic acid of 200 �� L binding buffer liquid dilutions, add 150nmol/L and connect micro-magnetic bead of alpha-fetoprotein, 37oC incubation 30min. After washing magnetic bead with binding buffer liquid, it is resuspended in 250 �� L binding buffer liquid. The oligonucleotide fragment arranging random sequence and the micro-magnetic bead connecting globulin (Ap) are as comparison.
3) using the flow cytometer of BD company that microballon is carried out fluoremetry, then with the mapping of Sigmaplot software, calculate dissociation constant (kd) relative value that the aptamer screened interacts with alpha-fetoprotein, result is as shown in Figure 1.
Sequence table
<110>Xu great Peng
<120>alpha-fetoprotein aptamer AFP4 and preparation method thereof
<130>2016
<160>1
<170>PatentInversion3.3
<210>1
<211>39
<212>DNA
<213>artificial sequence
<400>1
ggatgcggtaacggtacgtacctgtatagtgtgacatcctgtctccaaccacctgctgacgtgc64

Claims (3)

1. an alpha-fetoprotein aptamer, it is characterised in that its sequence of the nucleotide sequence of described aptamer is:
ggatgcggtaacggtacgtacctgtatagtgtgacatcctgtctccaaccacctgctgacgtgc��
2. a derivant for arbitrary described alpha-fetoprotein aptamer in claim 1, described derivant includes any one in following four:
(1) after the base A on aptamer optional position described in claim 1, T, C or G being replaced as rare bases methylated purines, dihydrouracil or hypoxanthine, the nucleic acid aptamer derivative obtained;
(2) phosphorothioate backbone that the skeleton of the nucleotide sequence of aptamer described in claim 1 derives;
(3) peptide nucleic acid(PNA) that aptamer described in claim 1 is transformed into;
(4) the lock nucleic acid that aptamer described in claim 1 is transformed into.
3. the or derivatives thereof of alpha-fetoprotein aptamer described in claim 1 or 2 is identifying, is detecting an alpha-fetoprotein or the application of the test kit aspect of preparation detection alpha-fetoprotein.
CN201610176305.7A 2016-03-25 2016-03-25 Alpha-fetoprotein nucleic acid aptamer AFP4 and preparation method thereof Pending CN105647933A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201610176305.7A CN105647933A (en) 2016-03-25 2016-03-25 Alpha-fetoprotein nucleic acid aptamer AFP4 and preparation method thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201610176305.7A CN105647933A (en) 2016-03-25 2016-03-25 Alpha-fetoprotein nucleic acid aptamer AFP4 and preparation method thereof

Publications (1)

Publication Number Publication Date
CN105647933A true CN105647933A (en) 2016-06-08

Family

ID=56494693

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201610176305.7A Pending CN105647933A (en) 2016-03-25 2016-03-25 Alpha-fetoprotein nucleic acid aptamer AFP4 and preparation method thereof

Country Status (1)

Country Link
CN (1) CN105647933A (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104131105A (en) * 2014-08-11 2014-11-05 复旦大学附属中山医院 Method for screening aptamer specifically bound with alpha-fetoprotein
CN104561010A (en) * 2014-11-30 2015-04-29 陈燕婷 Homocysteine aptamer HCy5 and preparation method thereof
CN104561008A (en) * 2014-11-30 2015-04-29 陈燕婷 Homocysteine aptamer HCy1 and preparation method thereof

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104131105A (en) * 2014-08-11 2014-11-05 复旦大学附属中山医院 Method for screening aptamer specifically bound with alpha-fetoprotein
CN104561010A (en) * 2014-11-30 2015-04-29 陈燕婷 Homocysteine aptamer HCy5 and preparation method thereof
CN104561008A (en) * 2014-11-30 2015-04-29 陈燕婷 Homocysteine aptamer HCy1 and preparation method thereof

Similar Documents

Publication Publication Date Title
CN105647932A (en) Alpha-fetoprotein nucleic acid aptamer AFP1 and preparation method thereof
US20070243549A1 (en) Enrichment of circulating fetal dna
CN107405540A (en) The enrichment of small nucleic acids
CN104561008A (en) Homocysteine aptamer HCy1 and preparation method thereof
CN105738633B (en) Kit for detecting gynecological chronic pelvic inflammatory disease and detection method of kit
CN105986039A (en) Detection kit for drug-resistant mutation locus and genotype of hepatitis B virus, use method and application thereof
CN102965378A (en) Aptamer of glycosylated hemoglobin and preparation method thereof
CN105602958A (en) Alpha fetoprotein aptamer AFP5 and preparation method thereof
CN105647933A (en) Alpha-fetoprotein nucleic acid aptamer AFP4 and preparation method thereof
CN104164436B (en) A kind of aptamer of glycosylated hemoglobin and preparation method thereof
CN104109675B (en) A kind of aptamer of glycolated hemoglobin and preparation method thereof
CN104109674B (en) A kind of aptamer of glycolated hemoglobin and preparation method thereof
CN105602959A (en) Alpha fetoprotein aptamer AFP2 and preparation method thereof
CN106018828A (en) Reagent kit for detecting intestinal diseases
CN105586345A (en) Alpha fetoprotein nucleic acid aptamer AFP3 and preparation method thereof
CN104561010B (en) Homocysteine aptamer HCy5 and preparation method thereof
CN109679945A (en) It is a kind of for improving the settling agent of dissociative DNA recovery rate in plasma sample
CN106872680A (en) Serum composition target aptamer screening technique
CN106636105B (en) The aptamer C203 and its screening technique of staphylococcus aureus enterotoxin C 2 and application
CN106480042A (en) A kind of quick identification insulin aptamer INS2 and preparation method thereof
CN110951744B (en) Aptamer specifically binding tumor necrosis factor-alpha and application thereof
CN104561009A (en) Homocysteine aptamer HCy2 and preparation method thereof
CN106480043A (en) A kind of high specific insulin aptamer INS1 and preparation method thereof
CN106318949A (en) High-sensitivity insulin nucleic acid aptamer INS3 and preparation method thereof
CN115786351A (en) Aptamer and derivative for detecting TSHR protein and application thereof

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
WD01 Invention patent application deemed withdrawn after publication
WD01 Invention patent application deemed withdrawn after publication

Application publication date: 20160608