CN106480043A - A kind of high specific insulin aptamer INS1 and preparation method thereof - Google Patents

Abstract

The present invention is open to have insulin aptamer of high specific and high-affinity and preparation method thereof.The nucleotides sequence of insulin aptamer is classified as：Tactaggaca cgagcgattc gtgtaatggc tcgatgacc agtcggcat tggtaccg, is named as INS1.Insulin aptamer preparation method includes：Build Random Sequence Library, screen target substance nucleic acid complexes, separate purpose oligonucleotide aptamers, PCR expands purpose oligonucleotide aptamers, cycle sieve selects that high degree of specificity is fit, the modification of insulin aptamer.The aptamer avirulence preparing, molecular weight is little to be combined it is easy to synthesis and labelling, a specific recognition insulin to other atypical insulins or its analog nonrecognition, can become the molecular beacon of detection insulin content.

Description

A kind of high specific insulin aptamer INS1 and preparation method thereof

Technical field

The invention belongs to protein detection technology field, it is related to a kind of nucleic acid, more particularly to high specific and high-affinity Insulin aptamer and preparation method thereof.

Background technology

Insulin is to be subject to endogenouss or exogenous material such as glucose, Lactose, ribose, essence by the beta Cell of islet in pancreas The stimulation of propylhomoserin, glucagon etc. and a kind of proteohormone of secreting.Insulin is that in body, unique fall is hypoglycemic to swash Element, simultaneously facilitates glycogen, fat, protein synthesis.Exogenous insulin is mainly used to treating diabetes.

The biosynthesiss speed of insulin is affected by plasma glucose concentration, when blood sugar concentration raises, pancreas in β cell Element former content in island increases, and insulin synthesis accelerate.Insulin synthesizes in beta Cell of islet.The molecular weight 5700 of insulin, by two Bar amino acid peptide chain forms.A chain has 21 aminoacid, and B chain has 30 aminoacid.Disulfide bond at two is had to be connected between A-B chain. Insulin is to secrete with equivalent molecular with C peptide to enter blood., in serum, there is pancreas in the clinically patient of use of exogenous insulin Island element antibody, impact radioimmunoassay measures blood insulin levels, can pass through in this case to measure plasma C peptide level, To understand endogenous insulin secretion state.

The detection method of insulin has three major types at present：Chromatography, Immunological Method, Enzymatic cycling.Chromatography sensitivity height, Specificity is good, but sample treatment, separation condition, chromatographic column prepare all multi-Varis so as to be difficult to standardization；And hplc device valency Lattice are expensive, technical conditions have high demands, and need special attendant so as to Difficulty.Immunological Method needs the free INS shape of reduction Formula, antibody fluorescence analytic process and turbidimetry are unable to direct detection sequestered Homocysteine, can only detect the total homotype of blood plasma half Cystine, is educated in 37 DEG C of half an hour ovum with reducing agent and carries out reduction treatment to blood sample.Immunological Method needs just can go out for more than one hour As a result, complex operation step, since it is desired that carry out reduction treatment can be affected by some uncertain factors.Enzymatic cycling process is numerous Trivial, and test limit is low, it is larger to produce error, expensive, therefore cannot promote.

Aptamer is a class new identification molecule that developed recently gets up, and is subject to the extensive pass of scientist in recent years Note, the aptamer being directed to important physiologically active molecule in a large number is screened out；The various analysis sides based on aptamer Method and technology are reported；Aptamer medicine " Macugen " was also listed by FDA official approval in 2005.SELEX skill The oligonucleotide sequence that art screening obtains is referred to as aptamer, and domestic its is translated as aptamer, nucleic acid aptamer, nucleic acid knowledge Body or aptamer etc..SELEX technology refers to that applied chemistry method synthesizes jumbo random oligonucleotide (consolidating by two ends Sequencing row and middle random sequences composition) library, by applying selection pressure (in conjunction with target, elutriation and target height The process of specific bond fragment), and combine Amplification Technologies, the circulation selective enrichment through excessive wheel, obtain and target substance High special combine oligonucleotide molecules, can be RNA can also be DNA, length be generally 25 ~ 60 nucleotide.

From the foregoing, it will be observed that aptamer is combined presented hypersensitivity and high specific so as to examine in disease with target substance Have a good application prospect in disconnected, although clinical practice report ripe at present is less, apply fit detection globulin Research be but on the increase, also continuously emerged based on fit new detecting technique.But it is currently based on being directed to of aptamer The efficient specific recognition research of insulin also lacks very much, and is directed to the aptamer of insulin and its screens preparation method still Have no and have been reported that.

Content of the invention

The technical problem to be solved in the present invention is to overcome the shortcomings of existing insulin detection technique, fills up and yet there are no islets of langerhans The aptamer of element and its screening preparation method are blank, provide a kind of insulin aptamer and preparation method thereof, institute of the present invention The aptamer name INS1 providing.

The solution of the present invention is by being achieved in that：A kind of insulin aptamer is it is characterised in that described nucleic acid is fitted Its sequence of the nucleotide sequence of body is： tactaggaca cgagcgattc gtgtaatggc tcgatgacc agtcggcat tggtaccg.

The derivant of the above insulin aptamer, described derivant includes any one in following four：

（1）Base A, T on aptamer optional position described in claim 1, C or G are replaced as rare bases and methylate After purine, dihydrouracil or hypoxanthine, the nucleic acid aptamer derivative that obtains；

（2）The phosphorothioate backbone that the skeleton of the nucleotide sequence of aptamer described in claim 1 derives；

（3）The peptide nucleic acid(PNA) that aptamer described in claim 1 is transformed into；

（4）The lock nucleic acid that aptamer described in claim 1 is transformed into.

More than one described insulin aptamers or derivatives thereof are in identification, detection insulin, or preparation detection pancreas The application of the test kit aspect of island element.

In order that the present invention is open fully, the preparation method step of insulin aptamer of the present invention is as follows：

The preparation method of insulin aptamer comprises the following steps：

1）Synthesizing single-stranded DNA random sequence oligonucleotides storehouse：The two ends in described single stranded DNA random oligonucleotide storehouse are fixing sequence Row, as pcr amplification primer thing land, the middle random sequences for 60 bases, storage capacity 10¹⁵More than.Described PCR primer For：

Primer 1：5’-ATACCAGCTTATTCAATT-3’

Primer 2：5’-Biotin-AGATTGCACTTACTATCT-3’

Described PCR primer 2 carries 5 ' end biotin labelings.

2）Preparation connects the solid-phase matrix of insulin：With micro- magnetic bead as substrate, it is passed through insulin by chemical method Carboxyl is covalently attached on micro- magnetic bead.

3）First screening purpose oligonucleotide sequence：DNA random oligonucleotide storehouse is mixed with insulin, screening removes Do not combine the oligonucleotide sequence with non-specific binding insulin in DNA random oligonucleotide storehouse, reclaim specific bond insulin Nucleotide sequence.

4）The secondary single strand dna oligonucleotide storehouse of preparation：Oligonucleotide by gained in step 3 and insulin specific bond Sequence enters performing PCR amplification, and pcr amplification product carries out separating with the micro- magnetic bead of Streptavidin for substrate, unwinds through alkaline denaturation, mistake Filter, purification, obtain secondary DNA oligonucleotide library, for next round screening.

5）Screen and identify insulin aptamer：Under the secondary single strand dna oligonucleotide storehouse of step 4 gained is carried out One wheel screening, obtains target oligonucleotide sequence after 15 wheel screenings.Clone and be sequenced described target oligonucleotide sequence, by enzyme Connection aptamer adsorption measurement identifies its specificity being combined with insulin and affinity.

6）Described insulin aptamer can be used for detecting insulin as detectable.

Beneficial effects of the present invention are as follows：（1）The Nucleic acid aptamer molecules amount being screened is little, and avirulence is conducive to molecule The design of probe is it is easy to synthesize and labelling；（2）The only special identification insulin of aptamer, does not combine non-insulin and other Globulin molecule, the ability of bound insulin is 20 ~ 80 times of the ability with reference to non-insulin Hb, can become discriminating insulin Reagent, improve the specificity of detection method and sensitivity, simplification detection method, reduces cost.

Brief description

Fig. 1 is the binding ability of aptamer of the present invention and insulin, and in Fig. 1, abscissa is aptamer dna concentration, indulges Coordinate is dissociation constant (Kd) relative value, and in figure INS curve represents the binding curve of aptamer INS1 and insulin, IN curve Represent the binding curve of aptamer INS1 and non-insulin.

Specific embodiment

Implement the preparation of the aptamer INS1 of 1 insulin specific bond

Build random sequence oligonucleotides storehouse：Synthetic single-stranded DNA sequence, building storage capacity is 1 × 10⁵Single stranded DNA with Machine sequence oligonucleotides storehouse, the DNA sequence that single stranded DNA random oligonucleotide storehouse includes is：

5’-GGATCCACCAGCGTCATCAGCA-N_25~40-AGATAGTAAGTGCAATCTGGC-3’

The DNA sequence in described single stranded DNA random oligonucleotide storehouse includes middle random sequences N_25~60With two ends fixed sequence program, institute State middle random sequences N_25~40For the random sequences of 30 ~ 40 bases, described two ends fixed sequence program is：5’- GGATCCACCAGCGTCATCAGCA, 3 '-CGGTCTAACGTGAATGATAGA, described two ends fixed sequence program is pcr amplification primer thing Land

1）By 0.5ml (1x10⁹Microgranule) Invitrogen company with activation micro- magnetic bead of amino and 1 mol/L islets of langerhans Element is in coupling buffer（20mM potassium phosphate buffer, 0.15M NaCl, 1mM DTT, pH 5.5）Middle mixing, adds 200ul coupling agent solution [57% 1-ethyl-3- (3-dimethylaminopropyl) carbodiimide (EDC)], Gently mix 24 hours under the conditions of above-mentioned reaction is placed in 25 C.Rhizoma Nelumbinis are connected magnetic bead magnetic bead separating device and the cleanout fluid of insulin （PBS, 1mM DTT, crowd H7.3）After cleaning, it is resuspended in 0.5ml PBS.

2）5nmol single-stranded DNA banks are dissolved in combination buffer（100 mM NaCl, 20 mM Tris-HCl pH 7.6, 2 mM MgCl2, 5mM KCl, 1 mM CaCl2,0.02% Tween 20, 1 mM DTT）, carry out heat treated： 90 C heating 10min, are placed in 10min on ice, then temperature places 5min.

3）After the single-stranded DNA banks handled well are incubated with the micro- magnetic bead being combined with globulin, collect and do not combine magnetic bead Liquid.

4）By step 3）The liquid collected and 25ul step 1）Insulin-the magnetic bead obtaining is together 37 in combination buffer C incubates 30min.

5）Wash the magnetic bead after incubating with combination buffer, be subsequently adding 200ul elution buffer（20 mM Tris-HCl pH7.6, 200 mM NaCl, 10 mM EDTA）, after 92 C incubation 5min, reclaim the eluting with single strand oligonucleotide acid sequence Buffer, enters performing PCR reaction.

6）PCR response procedures are：94 C denaturation 5 min;94 C 30s, 47 C 1min, 72 C 1min, amplification 20 circulations；Final extension is 72 C 10min.

7）PCR primer is the double-stranded DNA with biotin labeling for the 5 ' ends, product is mixed with Streptavidin MagneSphere, 25 After C incubation 30min, making double-stranded DNA degeneration with 0.15 mol/L NaOH is single stranded DNA, obtains final product next by desalination column purification The single-stranded DNA banks of wheel screening.

8）Using 200pmol step 7）The new single-stranded DNA banks obtaining, repeat step 2）To step 8）Screening journey Sequence, carries out 15 wheel screenings altogether.Finally clone and be sequenced the 15th wheel single-stranded DNA banks, obtain INS1 nucleotide sequence：tactaggaca cgagcgattc gtgtaatggc tcgatgacc agtcggcat tggtaccg.

Embodiment 2 detects the binding ability of aptamer INS1 and insulin with flow cytometer showed method

1）Synthesis 5 ' the insulin aptamer with fluorophor FAM labelling for the end.

2）Using 0 nml/L, 5 nml/L, 10 nml/L, 20 nml/L, 50 nml/L, 100 nml/L, 200 The aptamer of the FAM labelling of nml/L Concentraton gradient connects micro- magnetic bead of insulin (INS) to measure insulin aptamer Dissociation constant（kd）.Above-mentioned various concentration nucleic acid with 200 μ L combination buffer dilutions are fit, add 150 nmol/L to connect pancreas Micro- magnetic bead of island element, 37 C incubate 30min.Washed with combination buffer after magnetic bead, be resuspended in 250 μ L combination buffers In.Micro- magnetic bead of the oligonucleotide fragment of setting random sequences and connection para-insulin (IN) is as comparison.Para-insulin is behaved The insulin analog of work synthesis（Insulin detemir）.

3）Flow cytometer using BD company carries out fluoremetry to microballon, then uses Sigma plot software to map, Calculate the dissociation constant that screened aptamer is interacted with insulin（kd）Relative value, result is as shown in Figure 1.

Sequence table

<110>Liuzhou Li Jie Science and Technology Ltd.

<120>A kind of high specific insulin aptamer INS1 and preparation method thereof

<130> 2016

<160> 1

<170> PatentIn version 3.3

<210> 1

<211> 58

<212> DNA

<213>Artificial sequence

<400> 1

tactaggaca cgagcgattc gtgtaatggc tcgatgacc agtcggcat tggtaccg 58

Claims (3)

1. a kind of insulin aptamer is it is characterised in that its sequence of nucleotide sequence of described aptamer is：

tactaggaca cgagcgattc gtgtaatggc tcgatgacc agtcggcat tggtaccg.

2. in a kind of claim 1 arbitrary described insulin aptamer derivant, described derivant includes in following four Any one：

（1）Base A, T on aptamer optional position described in claim 1, C or G are replaced as rare bases and methylate After purine, dihydrouracil or hypoxanthine, the nucleic acid aptamer derivative that obtains；

（2）The phosphorothioate backbone that the skeleton of the nucleotide sequence of aptamer described in claim 1 derives；

（3）The peptide nucleic acid(PNA) that aptamer described in claim 1 is transformed into；

（4）The lock nucleic acid that aptamer described in claim 1 is transformed into.

3. insulin aptamer or derivatives thereof described in a kind of claim 1 or 2 is in identification, detection insulin, or system The application of the test kit aspect of standby detection insulin.