CN106636103A - Insulin aptamer INS5 and preparation method thereof - Google Patents

Abstract

The invention discloses an insulin aptamer, which has high specificity and high affinity, and preparation method thereof. A nucleotide sequence of the insulin aptamer is TAGGCCTCGG ACGTTATATA CACGATCTCT ACGACCGTTC TGGCTGCGTT TCGGACTGT, and is named INS5. The preparation method includes the steps of: constructing a random sequence library, screening a target substance-nucleic acid compound, separating a target oligonucleotides aptamer, performing PCR amplification on the target oligonucleotides aptamer, cyclically screening a highly-specific aptamer, and modifying the insulin aptamer. The aptamer has no toxicity and is low in molecular weight, is easy to synthesize and mark, can only specifically the insulin and cannot recognize and be matched with other atypical-para-insulin or analogues thereof, and can be used as a molecular beacon for detection of content of insulin.

Description

Insulin aptamer INS5 and preparation method thereof

Technical field

The invention belongs to protein detection technology field, is related to a kind of nucleic acid, more particularly to high specific and high-affinity Insulin aptamer and preparation method thereof.

Background technology

Insulin is by endogenous or exogenous material such as glucose, lactose, ribose, essence by the beta Cell of islet in pancreas The stimulation of propylhomoserin, hyperglycemic factor etc. and a kind of proteohormone for secreting.Insulin is uniquely to drop hypoglycemic sharp in body Element, while promoting glycogen, fat, protein synthesis.Exogenous insulin is mainly used to treating diabetes.

The biosynthesis speed of insulin is affected by plasma glucose concentration, when blood sugar concentration is raised, pancreas in β cells Island element original content increases, and insulin synthesis accelerate.Insulin synthesizes in beta Cell of islet.The molecular weight 5700 of insulin, by two Bar amino acid peptide chain is constituted.A chains have 21 amino acid, and B chains have 30 amino acid.There is disulfide bond at two to be connected between A-B chains. Insulin is to enter blood with equivalent molecular secretion with C peptides.Clinically, there is pancreas in the patient of use of exogenous insulin in serum Island element antibody, affects radioimmunoassay to determine blood insulin levels, can pass through to determine plasma C peptide level in this case, To understand endogenous insulin secretion state.

At present the detection method of insulin has three major types：Chromatography, Immunological Method, Enzymatic cycling.Chromatography sensitivity height, Specificity is good, but sample treatment, separation condition, chromatographic column prepare all multi-Varis so as to be difficult to standardize；And hplc device valency Lattice are expensive, technical conditions have high demands, and need special attendant so as to Difficulty.Immunological Method needs the free INS shapes of reduction Formula, antibody fluorescence analytic approach and turbidimetry are unable to direct detection sequestered Homocysteine, can only detect the total homotype of blood plasma half Cystine, educated in 37 DEG C of half an hour ovum with reducing agent carries out reduction treatment to blood sample.Immunological Method needs just to go out for more than one hour As a result, complex operation step, since it is desired that carry out reduction treatment can be affected by some uncertain factors.Enzymatic cycling process is numerous It is trivial, and test limit is low, it is larger to produce error, it is expensive, therefore cannot promote.

Aptamer is the new identification molecule of a class that developed recently gets up, in recent years by the extensive pass of scientist Note, it is screened out for the aptamer of important physiologically active molecule in a large number；The various analysis sides based on aptamer Method and technology are reported；Aptamer medicine " Macugen " has also been listed in 2005 by FDA official approvals.SELEX skills The oligonucleotide sequence that art screening is obtained is referred to as aptamer, and domestic its is translated as aptamer, nucleic acid aptamer, nucleic acid to be known Body or aptamer etc..SELEX technologies refer to that applied chemistry method synthesizes jumbo random oligonucleotide (consolidating by two ends Sequencing is arranged and middle random sequence composition) library, by applying selection pressure (with reference to target, elutriation and target height The process of specific bond fragment), and Amplification Technologies are combined, through the circulation selective enrichment of many wheels, obtain and target substance High special combine oligonucleotide molecules, can be RNA can also be DNA, length is generally 25 ~ 60 nucleotides.

From the foregoing, it will be observed that aptamer is combined presented hypersensitivity and high specific with target substance so as to examine in disease Have a good application prospect in disconnected, although clinical practice report ripe at present is less, using fit detection class pancreas islet The research of element is but on the increase, and is also continuously emerged based on fit new detecting technique.But it is currently based on being directed to for aptamer Also lack very much in the efficient specific recognition research of insulin, and be directed to the aptamer and its screening preparation method of insulin There is not yet report.

The content of the invention

The technical problem to be solved in the present invention is to overcome the shortcomings of existing insulin detection technique, fills up and yet there are no pancreas islet The aptamer and its screening preparation method of element is blank, there is provided a kind of insulin aptamer and preparation method thereof, institute of the present invention The aptamer name INS5 of offer.

The solution of the present invention is by being achieved in that：A kind of insulin aptamer, it is characterised in that the nucleic acid is fitted The nucleotide sequence of body its sequence is：taggcctcgg acgttatata cacgatctct acgaccgttc tggctgcgtt tcggactgt。

The derivative of the above insulin aptamer, the derivative includes any one in following four：

（1）Base A, T on aptamer optional position described in claim 1, C or G are replaced as into rare bases to methylate After purine, dihydrouracil or hypoxanthine, the nucleic acid aptamer derivative for obtaining；

（2）The phosphorothioate backbone that the skeleton of the nucleotide sequence of aptamer described in claim 1 is derived；

（3）The peptide nucleic acid that aptamer described in claim 1 is transformed into；

（4）The lock nucleic acid that aptamer described in claim 1 is transformed into.

More than one described insulin aptamers or derivatives thereof are in identification, detection insulin, or prepare detection pancreas Application in terms of the kit of island element.

In order that the present invention is disclosed fully, the preparation method step of insulin aptamer of the present invention is as follows：

The preparation method of insulin aptamer is comprised the following steps：

1）Synthesizing single-stranded DNA random sequence oligonucleotides storehouse：The two ends in the single stranded DNA random oligonucleotide storehouse are fixed sequence Row, as pcr amplification primer thing land, the middle random sequence for 60 bases, storage capacity 10¹⁵More than.The PCR primer For：

Primer 1：5’-ATACCAGCTTATTCAATT-3’

Primer 2：5’-Biotin-AGATTGCACTTACTATCT-3’

The PCR primer 2 is with 5 ' end biotin labelings.

2）Prepare the solid-phase matrix of connection insulin：With micro- magnetic bead as matrix, it is passed through insulin by chemical method Carboxyl is covalently attached on micro- magnetic bead.

3）First screening purpose oligonucleotide sequence：DNA random oligonucleotides storehouse is mixed with insulin, screening is removed The oligonucleotide sequence with non-specific binding insulin is not combined in DNA random oligonucleotides storehouse, specific bond insulin is reclaimed Nucleotide sequence.

4）Prepare secondary single strand dna oligonucleotide storehouse：By the oligonucleotides of gained and insulin specific bond in step 3 Sequence enters performing PCR amplification, and pcr amplification product is separated as matrix with the micro- magnetic bead of Streptavidin, unwind through alkaline denaturation, mistake Filter, purifying obtains secondary DNA oligonucleotide libraries, for next round screening.

5）Screen and identify insulin aptamer：The secondary single strand dna oligonucleotide storehouse of step 4 gained is carried out down One wheel screening, after 15 wheel screenings target oligonucleotide sequence is obtained.The target oligonucleotide sequence is cloned and is sequenced, by enzyme Connection aptamer adsorption measurement identifies its specificity combined with insulin and affinity.

6）The insulin aptamer can be used to detect insulin as detection reagent.

Beneficial effects of the present invention are as follows：（1）The Nucleic acid aptamer molecules amount for being screened is little, non-toxic, is conducive to molecule The design of probe, it is easy to synthesis and mark；（2）The only special identification insulin of aptamer, do not combine non-insulin and other Insulin molecule, the ability of bound insulin is 20 ~ 80 times of the ability for combining non-insulin Hb, can become discriminating insulin Reagent, improve detection method specificity and sensitivity, simplification detection method, reduces cost.

Description of the drawings

Fig. 1 is the binding ability of aptamer of the present invention and insulin, and abscissa is aptamer dna concentration in Fig. 1, is indulged Coordinate is dissociation constant (Kd) relative value, and INS curves represent the binding curve of aptamer INS5 and insulin, IN curves in figure Represent aptamer INS4 and non-insulin（Para-insulin IN）Binding curve.

Specific embodiment

Implement the preparation of the aptamer INS5 of 1 insulin specific bond

Build random sequence oligonucleotides storehouse：Artificial synthesized single-stranded DNA sequence, it is 1 × 10 to build storage capacity⁵Single stranded DNA with Machine sequence oligonucleotides storehouse, the DNA sequence dna that single stranded DNA random oligonucleotide storehouse includes is：

5’-GGATCCACCAGCGTCATCAGCA-N_25~40-AGATAGTAAGTGCAATCTGGC-3’

The DNA sequence dna in the single stranded DNA random oligonucleotide storehouse includes middle random sequence N_25~60With two ends fixed sequence program, institute State middle random sequence N_25~40For the random sequence of 30 ~ 40 bases, the two ends fixed sequence program is：5’- GGATCCACCAGCGTCATCAGCA, 3 '-CGGTCTAACGTGAATGATAGA, the two ends fixed sequence program is pcr amplification primer thing Land.

1）By 0.5ml (1x10⁹Particulate) Invitrogen companies with activation amino micro- magnetic bead and 1 mol/L Insulin is in coupling buffer（20mM potassium phosphate buffer solutions, 0.15M NaCl, 1mM DTT, pH 5.5）Middle mixing, plus Enter 200ul coupling agent solutions [57% 1-ethyl-3- (3-dimethylaminopropyl) carbodiimide (EDC)], above-mentioned reaction is placed under the conditions of 25 C light mixed 24 hours.By lotus root connect insulin magnetic bead magnetic bead separating device and Cleaning fluid（PBS, 1mM DTT, crowd H7.3）After cleaning, in being resuspended in 0.5ml PBS.

2）5nmol single-stranded DNA banks are dissolved in into combination buffer（100 mM NaCl, 20 mM Tris-HCl pH 7.6, 2 mM MgCl2, 5mM KCl, 1 mM CaCl2,0.02% Tween 20, 1 mM DTT）, heated： 90 C heat 10min, are placed in 10min on ice, and then temperature places 5min.

3）By the single-stranded DNA banks handled well be combined with micro- magnetic bead of para-insulin incubation after, collection do not combine magnetic bead Liquid.

4）By step 3）The liquid of collection and 25ul steps 1）Insulin-the magnetic bead for obtaining is together 37 in combination buffer C incubates 30min.

5）The magnetic bead after incubating is washed with combination buffer, 200ul elution buffers are subsequently adding（20 mM Tris-HCl pH7.6, 200 mM NaCl, 10 mM EDTA）, after 92 C incubation 5min, reclaim the wash-out with single strand oligonucleotide acid sequence Buffer solution, enters performing PCR reaction.

6）PCR response procedures are：The min of 94 C denaturations 5;94 C 30s, 47 C 1min, 72 C 1min, amplification 20 circulations；Final extension is 72 C 10min.

7）PCR primer is 5 ' double-stranded DNAs of the end with biotin labeling, product is mixed with Streptavidin MagneSphere, 25 After C incubation 30min, it is single stranded DNA to make double-stranded DNA denaturation with 0.15 mol/L NaOH, is obtained down by desalting column purifying The single-stranded DNA banks of one wheel screening.

8）Using 200pmol steps 7）The new single-stranded DNA banks for obtaining, repeat step 2）To step 8）Screening journey Sequence, carries out altogether 15 wheel screenings.The 15th wheel single-stranded DNA banks are finally cloned and be sequenced, INS5 nucleotide sequences are obtained：taggcctcgg acgttatata cacgatctct acgaccgttc tggctgcgtt tcggactgt。

Embodiment 2 detects the binding ability of aptamer INS5 and insulin with flow cytometer showed method

1）Insulin aptamer of the end of synthesis 5 ' with fluorophor FAM marks.

2）Using 0 nml/L, 5 nml/L, 10 nml/L, 20 nml/L, 50 nml/L, 100 nml/L, 200 Micro- magnetic bead of aptamer connection insulin (INS) of the FAM marks of nml/L concentration gradients is determining insulin aptamer Dissociation constant（kd）.The above-mentioned various concentration nucleic acids diluted with 200 μ L combination buffers are fit, add 150 nmol/L connection pancreases Micro- magnetic bead of island element, 37 C incubate 30min.Washed with combination buffer after magnetic bead, be resuspended in 250 μ L combination buffers In.The oligonucleotide fragment of random sequence and micro- magnetic bead of connection para-insulin (IN) are set used as control.Para-insulin is behaved The insulin analog of work synthesis（Insulin detemir）.

3）Fluoremetry is carried out to microballon using the flow cytometer of BD companies, is then mapped with Sigma plot softwares, Calculate the dissociation constant that screened aptamer interacts with insulin（kd）Relative value, as a result as shown in Figure 1.

Sequence table

<110>Liuzhou Li Jie Science and Technology Ltd.s

<120>Insulin aptamer INS5 and preparation method thereof

<130> 2016

<160> 1

<170> PatentIn version 3.3

<210> 1

<211> 58

<212> DNA

<213>Artificial sequence

<400> 1

taggcctcgg acgttatata cacgatctct acgaccgttc tggctgcgtt tcggactgt 58

Claims (3)

1. a kind of insulin aptamer, it is characterised in that the nucleotide sequence of the aptamer its sequence is：

taggcctcgg acgttatata cacgatctct acgaccgttc tggctgcgtt tcggactgt。

2. in a kind of claim 1 arbitrary insulin aptamer derivative, the derivative include following four in Any one：

（1）Base A, T on aptamer optional position described in claim 1, C or G are replaced as into rare bases to methylate After purine, dihydrouracil or hypoxanthine, the nucleic acid aptamer derivative for obtaining；

（2）The phosphorothioate backbone that the skeleton of the nucleotide sequence of aptamer described in claim 1 is derived；

（3）The peptide nucleic acid that aptamer described in claim 1 is transformed into；

（4）The lock nucleic acid that aptamer described in claim 1 is transformed into.

3. insulin aptamer or derivatives thereof described in a kind of claim 1 or 2 is in identification, detection insulin, or system Application in terms of the kit of standby detection insulin.