CN113481203B

CN113481203B - Aptamer specifically combined with human FXYD2 gamma a, derivative thereof, screening method and application

Info

Publication number: CN113481203B
Application number: CN202110641301.2A
Authority: CN
Inventors: 贾黎静; 罗茜; 陈南迪; 郑沛林
Original assignee: Shenzhen Peoples Hospital
Current assignee: Shenzhen Peoples Hospital
Priority date: 2021-06-08
Filing date: 2021-06-08
Publication date: 2022-10-11
Anticipated expiration: 2041-06-08
Also published as: CN113481203A

Abstract

The invention provides a nucleic acid aptamer specifically combined with human FXYD2 gamma a, a derivative, a screening method and application thereof, wherein the nucleotide sequence of the nucleic acid aptamer obtained by the screening method is as follows: 5 'AACGAAGGTATACAAAATATAATATAAATCTACTACTAC TACG-3', compared with the FXYD2 gamma a specific antibody, the aptamer has the advantages of short screening period, low cost, stability, easy storage, normal-temperature transportation, wide application and the like.

Description

Aptamer specifically combined with human FXYD2 gamma a, derivative thereof, screening method and application

Technical Field

The invention relates to the technical field of biology, in particular to a nucleic acid aptamer specifically combined with human FXYD2 gamma a, a derivative, a screening method and application thereof.

Background

Aptamer (Aptamer) is a structured oligonucleotide sequence (RNA or DNA) obtained by Systematic evolution of ligands by exponential enrichment (SELEX) through in vitro screening technology, and has similar functions to antibodies, but has more advantages compared with antibodies, higher affinity and specificity; no immunogenicity; the chemical synthesis can be realized, and the cost is low; can be marked; good qualitative property, easy preservation and the like. The target molecules of the nucleic acid aptamers are more extensive, including metal ions, amino acids, nucleic acids, polypeptides, proteins, and extend from a single target to complex targets such as complete viral particles and cells. Therefore, the aptamer has wide application prospect.

Diabetes mellitus is a metabolic disease characterized by hyperglycemia due to defective insulin secretion or impaired insulin action, and is largely classified into type 1 diabetes, type 2 diabetes, gestational diabetes, and other types of diabetes. The etiology of both type 1 and type 2 diabetes is due to a decrease in the number of islet beta cells that secrete insulin. Islets are composed of beta cells, alpha cells, delta cells, and PP cells, which have common origins with other islet endocrine cells, including acinar cells and pancreatic duct cells. Therefore, finding islet β cell-specific biomarkers is very difficult.

Gene FXYD2 gamma encodes Na ⁺ -K ⁺ -the regulatory subunit of atpase, with 3 isoforms in humans: FXYD2 γ a, FXYD2 γ b and FXYD2 γ c. There are several references that show that the FXYD2 γ a isoform is expressed only in human islet β cells. FXYD2 γ a was first present in β cells 15 weeks into human embryos, was not co-localized with somatostatin expressing δ cells, pancreatic polypeptide expressing PP cells, and was expressed in very low amounts in other organs or cells in the human body. Patients with type 1 diabetes have a reduced number of beta cells destroyed by autoimmune attack. FXYD2 γ a was also correspondingly low in the sera of these patients. Professor Decio l.eizirik at the university of luwenun, belgium found that nuclide-coupled FXYD2 γ a antibodies better monitored the survival of transplanted β cells in islet transplantation. Therefore, FXYD2 gamma a is used as a specific marker of islet beta cells, and the number of the islet beta cells can be reflected by detecting the number of the FXYD2 gamma a, so that the incidence rate and the treatment effect of diabetes mellitus can be reflected.

The detection of FXYD2 gamma a is a detection method based on an antibody or a derivative thereof, but the detection method has the defects of unstable antibody, high probability of irreversible denaturation, large batch difference, long production time, high cost and the like, and the screening research on the aptamer of FXYD2 gamma a is not reported in the prior art.

Disclosure of Invention

The invention mainly aims to provide a nucleic acid aptamer specifically combined with a specific marker FXYD2 gamma a of human islet beta cells, and aims to further develop a kit for detecting the human islet beta cells through the nucleic acid aptamer, so that a tool is provided for predicting and diagnosing diabetes and tracking the treatment effect of islet transplantation, and the nucleic acid aptamer has the advantages of short screening time, small batch difference, stability and the like.

In order to achieve the above object, the present invention provides, in a first aspect, an aptamer that specifically binds to human FXYD2 γ a, the aptamer having a nucleotide sequence: 5 'AACGAAGGTATACAAAATATAATATAAATATCTACG) 3' (SEQ ID NO. 1).

Optionally, any base on the nucleotide sequence of the aptamer is phosphorylated, methylated, aminated, thiolated, or isotopically esterified.

Optionally, biotin, digoxigenin, a fluorescent substance, a nano-luminescent material, or an enzyme label is bound to the nucleotide sequence of the aptamer.

In a second aspect, the invention provides a derivative of an aptamer which specifically binds to human FXYD2 γ a, said derivative being a phosphorothioate backbone derived from the backbone of the nucleotide sequence of said aptamer of the first aspect, or a corresponding peptide nucleic acid modified from said aptamer of the first aspect.

The third aspect of the invention provides an application of the aptamer of the first aspect or the aptamer derivative of the second aspect in preparing an FXYD2 gamma a detection reagent, a kit or a sensor.

The fourth aspect of the invention also provides application of the aptamer specifically combined with human FXYD2 gamma a in preparing a kit or a sensor for assisting in diagnosing and predicting diabetes, wherein the nucleotide sequence of the aptamer is as follows: 5 'AACGAAGGTATACAAAATATAATATAAATATCTACG) -3' (SEQ ID NO. 1).

The fifth aspect of the invention also provides an application of the aptamer specifically combined with human FXYD2 gamma a in preparing a kit or a sensor for predicting the effect of pancreatic islet transplantation of a diabetic patient, wherein the nucleotide sequence of the aptamer is as follows: 5 'AACGAAGGTATACAAAATATAATATAAATATCTACG) -3' (SEQ ID NO. 1).

The sixth aspect of the present invention also provides a method for screening for an aptamer according to the first aspect, comprising:

(1) Synthesis of random single-stranded DNA library: 5'-AGAGTCCTGAGTGCCGATGA-N (40) -TAGGCAGGTGGTCATCGTCCA-3' (SEQ ID NO. 4), primer F:5'-Biotin-AGAGTCCTGAGTGCCGATGA-3' (SEQ ID No. 2), primer R:5 '-FITC-TGACGACCACCTGCCTA-3' (SEQ ID No. 3);

(2) Screening: pretreating a random single-stranded DNA library, then incubating with FXYD2 gamma a, washing off single-stranded DNA which is not combined with the FXYD2 gamma a, and separating the single-stranded DNA combined with the FXYD2 gamma a;

(3) And (3) PCR amplification: performing PCR amplification on the single-stranded DNA separated in the step (2) by using a primer F and a primer R to obtain a double-stranded DNA product;

(4) Preparation of single-stranded DNA: preparing a new single-stranded DNA library by melting the double-stranded DNA product;

(5) And (4) repeated screening: replacing the random single-stranded DNA library in the step (2) with the single-stranded DNA library obtained in the step (4), and repeating the processes from the step (2) to the step (4) at least once;

(6) Sequencing: and (4) after repeated screening for multiple times, sequencing the double-stranded DNA product obtained in the last screening in the step (3).

Optionally, the step (5) is repeated for 15 times of screening, i.e. 16 times of screening in total.

Optionally, empty magnetic beads are added for back-screening at 5 th and 6 th screening.

The invention has the beneficial technical effects that:

the aptamer specifically combined with the human FXYD2 gamma a is successfully screened by the screening method, and has higher affinity and specificity than a protein antibody; no immunogenicity; can be chemically synthesized in vitro, has small molecular weight, can modify and replace different parts, has stable sequence and is easy to store; convenient labeling (no labeled secondary antibody required), etc. When the aptamer is used for detecting FXYD2 Gamma a, the operation is simpler and quicker, and the synthesis cost of the aptamer is lower than that of an antibody, so that the period is short and the reproducibility is good. The aptamer has good application prospects in diagnosis of diabetes, prediction of incidence of diabetes and recovery.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, it is obvious that the drawings in the following description are only some embodiments of the present invention, and for those skilled in the art, other drawings can be obtained according to the structures shown in the drawings without creative efforts.

FIG. 1 is a diagram showing the results of the number optimization experiment of PCR amplification rounds after 12 th round screening of the aptamer of the present invention. M is Marker,7-14 and 16 are products of 7-14 and 16 amplification rounds respectively, and water is blank control for amplification by taking water as a template.

FIG. 2 is a diagram showing the results of the detection of the enrichment degree of the library after 11 th and 13 th to 16 th rounds of screening of the aptamer of the invention. And (3) selecting equivalent screening products (with FITC fluorescence) of each round, incubating the screening products with the polypeptide coated by the magnetic beads for 60min, and then carrying out flow detection on the recognition binding condition of the screening products and the polypeptide of each round. FITC-H (high) on the abscissse:Sub>A and FITC-A (arese:Sub>A) on the ordinate. The cells shown in the boxes are positive cells, and the positive proportion is the number under the box.

FIG. 3A is a diagram showing the results of a size-verified gel electrophoresis test before sequencing of the aptamer of the invention. The PCR products of marker,9 th round repetition, 13 th round, 14 th round and 16 th round are sequentially arranged from left to right.

FIG. 3B is a graph of the results of size-verified non-denaturing PAGE electrophoresis prior to sequencing of the aptamer of the invention. The PCR products of marker,9 th round repetition, 13 th round, 14 th round and 16 th round are sequentially arranged from left to right.

FIG. 4 is a graph showing the results of a verification test for the binding of the aptamer selected according to the present invention to the target Fxyd2 γ a. Control is 40 bases at random.

The implementation, functional features and advantages of the objects of the present invention will be further explained with reference to the accompanying drawings.

Detailed Description

The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be obtained by a person skilled in the art without inventive step based on the embodiments of the present invention, are within the scope of protection of the present invention.

Example (b):

aptamers directed against FXYD2 γ a are the subject of development herein and ultimately the subject of protection herein, the scope of which relates to the resulting aptamers that specifically bind to FXYD2 γ a, materials (e.g., probes, detection reagents, kits, sensors, etc.) comprising the aptamers, applications (e.g., diagnostic applications, preparative applications, etc.), however, it will be appreciated by those skilled in the art that the subject of protection herein is not limited to these exemplified ones.

The invention provides a nucleic acid aptamer which is specifically combined with human FXYD2 gamma a and can be used for detecting pancreatic beta cells, wherein the nucleotide sequence of the nucleic acid aptamer is as follows: 5 'AACGAAGGTATACAAAATATAATATAAATATCTACG) -3' (SEQ ID NO. 1).

Alternatively, the base at any position on the nucleotide sequence of the aptamer may be phosphorylated, methylated, aminated, thiolated, or isotopically esterified. The nucleotide sequence of the aptamer can be combined with biotin, digoxigenin, fluorescent substance, nano luminescent material or enzyme label. It is understood that the base of the aptamer is modified without affecting its steric structure.

In other embodiments, the backbone of the nucleotide sequence of the aptamer may also be derived to be a phosphorothioate backbone useful for detection of FXYD2 γ a, and the aptamer may also be modified to be a corresponding peptide nucleic acid.

The aptamer binding specifically to human FXYD2 γ a can be synthesized in a large amount and used. The aptamer can be used for preparing a detection reagent, a kit or a sensor for detecting FXYD2 gamma and islet beta cells, and can also be used for preparing a kit or a sensor for assisting in diagnosing a diabetic patient, predicting the incidence of diabetes and predicting the effect of islet transplantation.

Preferably, the aptamer is labeled at the 5 'end or 3' end with a fluorescent group, biotin group or radionuclide as a probe, which can be present in the form of a reagent, or can be immobilized or coupled to a carrier. The carrier on which the aptamer or the derivative thereof is immobilized or coupled may be a nanoparticle or a microparticle or a chip. The nano particles are nano/micro particles modified by modifiers; the modifier is streptavidin, carboxyl, amino or vegetable base.

The aptamer for detecting pancreatic islet beta cells in the embodiment is obtained by screening mainly by the following screening method, and specifically comprises the following steps:

(1) Synthesis of random Single-stranded DNA library and primers shown in the following sequence

Random single-stranded DNA library: 5'-AGAGTCCTGAGTGCCGATGA-N (40) -TAGGCAGGTGGTCATCGTCCA-3' (SEQ ID NO. 4);

and (3) primer F:5'-Biotin-AGAGTCCTGAGTGCCGATGA-3' (SEQ ID NO. 2);

and (3) primer R:5 '-FITC-TGACGACGCTGCCTA-3' (SEQ ID NO. 3).

Meanwhile, a biotin-labeled FXYD2 gamma a extracellular peptide fragment (Bio-MTGLSMDGGGSPKGDVDPFYYDYETV) (SEQ ID NO. 5), a FXYD2 gamma b extracellular peptide fragment (Bio-MDRWYLGPKGDVDPFYYDYETV) (SEQ ID NO. 6) and a FXYD2 gamma c extracellular peptide fragment (Bio-MTGLSMDGGGSPKGDVDPFYYGKPGP) (SEQ ID NO. 7) are synthesized by a company and used for subsequent experiments.

(2) Screening of random Single-stranded DNA libraries

And (3) incubating the pretreated random single-stranded DNA library with FXYD2 gamma a, washing single-stranded DNA which is not combined with the FXYD2 gamma a, and separating the single-stranded DNA combined with the FXYD2 gamma a.

Specifically, single-stranded DNA was centrifuged at 10000rpm for 5min, then 1ml of 1 × Binding Buffer was added, the mixture was mixed well, heated in a metal bath at 95 ℃ for 5min, immediately taken out of the bath for 5min, and then kept at room temperature for 5min for pretreatment. The library was pre-treated before each round of screening was initiated.

Specifically, 1ml of random single-stranded DNA library (5 nmol) is added into an ep tube, FXYD2 gamma a coated by magnetic beads is added, binding Buffer is added, and +/-FBS is incubated for 30-90min at room temperature in a dark place until the total volume is 1.2 ml.

After the incubation, the ep tube was placed on a magnetic separator, left to stand for 1min, the supernatant was aspirated by a pipette, the single-stranded DNA not bound to FXYD2 γ a was removed, and after Washing 2 to 3 times with 1ml Washing Buffer, the ep tube was removed from the magnetic separator.

And (3) only single-stranded DNA combined with FXYD2 gamma a remains in the ep tube, adding 1.3ml of sterile water into the magnetic beads combined with FXYD2 gamma a, heating at 100 ℃ for 5min, placing on ice for 5min, magnetically separating to leave supernatant, and separating to obtain the single-stranded DNA combined with FXYD2 gamma a.

(3) PCR amplification

And (2) carrying out PCR amplification on the single-stranded DNA combined with FXYD2 gamma a separated in the step (2) by using the primer F and the primer R synthesized in the step (1) to obtain a double-stranded DNA product.

Because the PCR amplification reaction has a single template and high abundance, the number of amplification rounds has a large influence on PCR, and the number of amplification rounds can generate non-specific amplification, so that the optimal cycle number is found by a PCR amplification round number optimization method before the single-stranded DNA screened out in each round is enriched and amplified.

The reaction system with optimized number of PCR amplification rounds is shown in Table 1, the reaction system with enriched amplification of single-stranded DNA by PCR amplification is shown in Table 2, and the reaction conditions are shown in Table 3, wherein the number of cycles of the 2 nd step in the reaction conditions is determined by the experiment with optimized number of PCR amplification rounds.

TABLE 1 PCR amplification round number optimization reaction System

TABLE 2 Single-stranded DNA amplification enrichment reaction System

2X PCR MIX (Baitaike)	50μl
		Primer F (100. Mu.M)	0.5μl(500nM)
Primer R (100. Mu.M)	0.5μl(500nM)
		H ₂ O	39μl
Form panel	10μl

TABLE 3 PCR reaction conditions

FIG. 1 shows the results of the PCR amplification cycle number optimization experiment in one round of screening, and FIG. 1 is a diagram of the results of the PCR amplification cycle number optimization experiment after the 12 th round of screening of the aptamer of the invention, where M is Marker,7-14 and 16 are products from 7-14 and 16 rounds of amplification, respectively, and water is blank control for amplification using water as a template. As can be seen from the figure, the enrichment of single stranded DNA after 12 th round of selection is optimal for 14 rounds of PCR amplification.

(4) Preparation of Single-stranded DNA

And (4) melting the double-stranded DNA product obtained in the step (3) to prepare a new single-stranded DNA library.

Firstly, agarose microbeads marked by streptomycin are mixed evenly in a vortex mode, 100ul is taken, 5000rpm is used for centrifuging to remove protective solution, DPBS 200ul is added for cleaning for 3 times, then the mixture is added into 2ml of the double-stranded DNA product, the mixture is subjected to oscillation incubation for 30min (in dark place) at 25 ℃, supernatant is removed by centrifugation, the mixture is cleaned for 3 times by sterilized water until the supernatant is clear, and the agarose microbead double-stranded DNA compound is obtained after the supernatant is removed. Adding 1100 μ l of 200mM NaOH into the agarose bead double-stranded DNA complex, incubating for 12min in a dark place at 25 ℃ for single-stranded treatment, centrifuging, collecting the supernatant, and combining the single-stranded DNA with the avidin with the agarose beads for precipitation, wherein the supernatant is the single-stranded DNA without the avidin label to obtain the single-stranded DNA solution. The resulting single-stranded DNA solution was desalted using a desalting column, which was washed 4 times with 4ml of double distilled water, 1ml of the supernatant collected above was added and discarded, and about 1.5ml of single-stranded DNA was collected by adding 1.5ml of sterilized water.

Preferably, the single-stranded DNA library obtained after screening can also be subjected to enrichment degree detection. After equal amount of screening products (with FITC fluorescence) and FXY2D gamma a coated by magnetic beads are selected and incubated for 60min, flow detection is carried out on the recognition binding condition of the screening products and the FXY2D gamma a in each round, the result is shown in figure 2, figure 2 shows a part of detection results, and it can be seen that from the 11 th round, the fluorescence intensity of the screening library and FXY2D gamma a after incubation is enhanced along with the increase of the number of screening rounds.

(5) Repeat screening

And (3) replacing the random single-stranded DNA library in the step (2) with the single-stranded DNA obtained in the step (4), and repeating the processes from the step (2) to the step (4) at least once.

Specifically, in this example, 16 rounds of screening were performed in total, and the screening conditions in each round are shown in table 4, wherein polypeptides B and C are two other sheared isomers of FXYD2 γ a, FXYD2 γ B and FXYD2 γ C, respectively, wherein empty magnetic beads are added to remove nucleic acid sequences bound to the magnetic beads by back-screening, and FXYD2 γ B and FXYD2 γ C are added to remove nucleic acid sequences bound to FXYD2 γ B and FXYD2 γ C by back-screening. FBS is a serum protein that is present in high abundance in vivo as well as in serum. We gradually increased serum concentrations to mimic the future assay environment and increased the probability of screening for aptamers that specifically bind FXYD2 γ a. The initial screening conditions are mild and are intended to enrich for target aptamers and prevent target aptamers from being washed away from the beginning, and the subsequent screening conditions are more severe and intended to improve specificity.

TABLE 4 summary of screening conditions for each run

(6) Sequencing

And (4) after repeated screening for multiple times, sequencing the double-stranded DNA product obtained in the last screening in the step (3).

Specifically, the method can further comprise a step of verifying the size of the single-stranded DNA before sequencing, wherein a 16 th round screening product and the first round screening products are selected before sequencing for performing gel electrophoresis and non-denaturing PAGE electrophoresis experiments, the experimental results are respectively shown in FIG. 3A and FIG. 3B, the marker,9, 13, 14, 15 and 16 rounds of screening products are sequentially arranged from left to right in the figure, and the size of a sequencing sample can be seen to be correct in the figure.

582235 results are obtained from the sequencing result, and a part of results of the top 100 of the repeat number is selected to synthesize corresponding single-stranded DNA for screening of subsequent binding verification.

And (3) verification:

in order to verify whether or not the single-stranded DNA obtained by the above-described sequencing is an FXYD2 γ a aptamer, the single-stranded DNA obtained is subjected to a binding test with FXYD2 γ a, and it is the FXYD2 γ a aptamer finally obtained that can specifically bind to FXYD2 γ a.

SYBR Green dyes specifically bind to double-stranded DNA but not single-stranded DNA. The aptamer is single-stranded DNA and cannot be combined with SYBR Green, but if the aptamer is combined with the FXYD2 gamma a peptide segment, conformation change is caused, a local double-stranded structure is formed, SYBR Green is inserted into the formed double-stranded DNA, an amplified fluorescent signal is generated, and whether the obtained aptamer can be specifically combined with the FXYD2 gamma a can be further verified.

SYBR Green solution: the stock solution concentration was 10000X, the working concentration was 3X. FXYD2 γ a solution: stock solution concentration 1000. Mu.M, working concentration 600nM. The control was a random 40-base sequence synthesized by the company. And (2) mixing the synthesized aptamer with 600nM with FXYD2 gamma a, FXYD2 gamma b, FXYD2 gamma c solutions and SYBR Green solutions respectively, mixing the mixture with the FXYD2 gamma a solutions and the SYBR Green solutions in contrast with random 40 base sequences, incubating the mixture in a refrigerator at 4 ℃ overnight, and detecting the fluorescence intensity of a pore plate by using a multifunctional microplate reader.

Finally, a nucleic acid aptamer sequence capable of being specifically combined with FXYD2 gamma a is obtained, and the experimental result is shown in FIG. 4, wherein Control in the diagram is a combination group of random 40 base sequences and FXYD2 gamma a, FXYD2 gamma a is a combination group of a nucleic acid aptamer and FXYD2 gamma a, FXYD2 gamma b is a combination group of the nucleic acid aptamer and FXYD2 gamma b, and FXYD2 gamma c is a combination group of the nucleic acid aptamer and FXYD2 gamma c. It can be seen from FIG. 4 that the aptamer can specifically bind to FXYD 2. Gamma.a.

The sequence of the aptamer shown in FIG. 4 is G-27:5 'AACGAAGGTATACAAAATATAATATAAATCTACG) -3' (SEQ ID NO. 1), the sequence appeared a plurality of times, and the number of repeats was 34 times.

The above description is only an alternative embodiment of the present invention, and not intended to limit the scope of the present invention, and all modifications and equivalents of the present invention, which are made by the contents of the present specification and the accompanying drawings, or directly/indirectly applied to other related technical fields, are included in the scope of the present invention.

SEQUENCE LISTING

<110> Shenzhen citizen hospital

<120> aptamer specifically bound with human FXYD2 gamma a, derivative, screening method and application thereof

<130> 2020-07-28

<160> 7

<170> PatentIn version 3.3

<210> 1

<211> 40

<212> DNA

<213> Artificial sequence

<400> 1

aacgaaggta tacaaaaata taatataaat atctactacg 40

<210> 2

<211> 20

<212> DNA

<213> Artificial sequence

<400> 2

agagtcctga gtgccgatga 20

<210> 3

<211> 20

<212> DNA

<213> Artificial sequence

<400> 3

tgacgatgac cacctgccta 20

<210> 4

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<221> misc_feature

<222> (21)..(60)

<223> n is a,g,c or t

<400> 4

agagtcctga gtgccgatga nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 60

taggcaggtg gtcatcgtca 80

<210> 5

<211> 26

<212> PRT

<213> Artificial sequence

<400> 5

Met Thr Gly Leu Ser Met Asp Gly Gly Gly Ser Pro Lys Gly Asp Val

1 5 10 15

Asp Pro Phe Tyr Tyr Asp Tyr Glu Thr Val

20 25

<210> 6

<211> 24

<212> PRT

<213> Artificial sequence

<400> 6

Met Asp Arg Trp Tyr Leu Gly Gly Ser Pro Lys Gly Asp Val Asp Pro

1 5 10 15

Phe Tyr Tyr Asp Tyr Glu Thr Val

20

<210> 7

<211> 26

<212> PRT

<213> Artificial sequence

<400> 7

Met Thr Gly Leu Ser Met Asp Gly Gly Gly Ser Pro Lys Gly Asp Val

1 5 10 15

Asp Pro Phe Tyr Tyr Gly Lys Pro Gly Pro

20 25

Claims

1. An aptamer specifically binding to human FXYD2 gamma a, wherein the nucleotide sequence of the aptamer is shown as SEQ ID NO. 1: 5 'AACGAAGGTATACAAAATATAATATAAATATCTACG) -3'.

2. Use of the aptamer according to claim 1 for preparing a FXYD2 γ a detection reagent, kit or sensor.

3. The application of the aptamer specifically combined with human FXYD2 gamma a in preparing a kit or a sensor for assisting in diagnosing and predicting diabetes, wherein the nucleotide sequence of the aptamer is shown as SEQ ID NO. 1: 5 'AACGAAGGTATACAAAATATAATATAAATATCTACG) -3'.

4. The application of the aptamer specifically combined with human FXYD2 gamma a in preparing a kit or a sensor for predicting the effect of islet transplantation of a diabetic patient, wherein the nucleotide sequence of the aptamer is shown as SEQ ID NO. 1: 5 'AACGAAGGTATACAAAATATAATATAAATATCTACG) -3'.