CN106636421A - Method for detecting mouse original components by specific primer - Google Patents
Method for detecting mouse original components by specific primer Download PDFInfo
- Publication number
- CN106636421A CN106636421A CN201710014015.7A CN201710014015A CN106636421A CN 106636421 A CN106636421 A CN 106636421A CN 201710014015 A CN201710014015 A CN 201710014015A CN 106636421 A CN106636421 A CN 106636421A
- Authority
- CN
- China
- Prior art keywords
- specific primer
- primer
- mouse
- dna
- pcr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the technical field of the detection of mouse original components, and particularly relates to a method for detecting the mouse original components by a specific primer. The craft process of method comprises the following five steps: specific primer design synthesis, DNA (Deoxyribonucleic Acid) extraction, reaction system establishment, PCR (Polymerase Chain Reaction) amplification and the analysis result evaluation of the mouse original components. The specific primer is designed and synthetized according to the mitochondrial cytochrome b gene sequence of a mouse in Genbank, wherein the base sequence of the forward primer F of the specific primer is 5'-GCCTTATAATTAATTGGAGGTA-3', and the base sequence of the downstream primer F of the specific primer is 5'-AGCTATATTATGTGCTTGAT-3'; on the basis of the mitochondrial cytochrome Cyt b gene sequence of the mouse, a real-time quantitative PCR method is used for detecting the mouse original components so as to bring good specificity and repeatability. When the real-time fluorescence quantitative PCR method carried out by the primer is used for detecting the mouse original components, operation is simple, short time is consumed, and specificity is high. Secondary pollution caused by product amplification when an amplification product is taken out to carry out electrophoresis identification in a traditional detection method is avoided, and a new approach is provided for the detection of the mouse original components.
Description
Technical field：
The invention belongs to animal derived materials detection technique field, and in particular to a species-specific primer detect mouse into
The method divided, mouse composition is detected using specific primer using real-time fluorescence quantitative PCR (PCR) method.
Background technology：
PCR (PCR) be using DNA in vitro 95 DEG C of high temperature time variation into single-stranded, at 60 DEG C or so
During low temperature, primer is combined with single-stranded by the principle of base pair complementarity, then temperature regulating is to the optimum 72 DEG C of reactions of archaeal dna polymerase
Temperature, direction composition complementary strand of the archaeal dna polymerase along phosphoric acid to pentose (5'-3'), based on the PCR instrument reality that polymerase is manufactured
Border is exactly a temperature control device, can be well controlled between denaturation temperature, renaturation temperature and elongating temperature；Polymerase chain
Formula reaction is a kind of Protocols in Molecular Biology for amplifying the specific DNA fragmentation of amplification, can regard the spy of in vitro as
Different DNA replication dna, the maximum feature of PCR is to be significantly increased micro DNA, so, either the extinct plants and animal in fossil or go through
The remains of history personage, hair, skin or blood that still decades ago assailant is left in murder case, as long as a fourth can be isolated
The DNA of point, just can be amplified with PCR, be compared；It is that some are possessed with a lust for gain that mouse meat pretends to be expensive beef and mutton
Businessman Jing frequently with mean tricks, mouse meat directly pretend to be beef and mutton or be entrained in cattle and sheep meat products flow into common people meal
Table, brings great social influence, and huge personal injury is caused to user, this is because the self-contained various diseases of mouse
The reservoir and major source of infection of bacterium, inherently multiple infectious disease cause of disease, meanwhile, lead and arsenic contained by mouse meat etc. are poisonous
The content of harmful substance is also far above other meats, directly edible to bring great body harm and epidemic disease infection wind
Danger, is gently then poisoned, heavy then dead；At present, the national standard or professional standard still without mouse composition detection, ordinary consumption
Person or even Shi Yao quality supervision departments are difficult to differentiate by naked eyes, and traditional detection method is loaded down with trivial details, and time-consuming.It is contemplated that by real
When quantitative fluorescent PCR nucleic acid detection technique, develop a species-specific primer detect mouse composition method, be mouse composition
Detection provide technical support, for standard method foundation provides experiment support, for strike meat adulteration strong science is provided
Foundation, with good society and application prospect.
The content of the invention：
It is an object of the invention to overcome the deficiencies in the prior art, species-specific primer detection mouse composition is designed
Method, the detection for mouse composition provides technical support, and the foundation for standard detecting method provides experiment support, is strike meat
The adulterated administrative law enforcement of class provides strong scientific basis.
To achieve these goals, the technical process of the method for specific primer detection mouse composition according to the present invention
It is divided into specific primer design synthesis, DNA extractions, reaction system is set up, PCR is expanded, mouse composition analysis result evaluates five
Individual step：
(1), specific primer design synthesis：According to mitochondrial cytochrome b (Cyt b) the gene sequence of mouse in Genba nk
Row design and synthesize specific primer, and the base sequence of the upstream primer F of specific primer is 5 '-
The base sequence of GCCTTATAATTAATTGGAGGTA-3 ', the downstream primer R of specific primer be 5 '-
AGCTATATTATGTGCTTGAT-3’；
(2), DNA is extracted：Take mouse musculature 1g and grind to form rotten shape, then according to tissue gene group DNA extraction kit
Operation instruction is operated, and extracts DNA, and the concentration of the DNA that Jing nucleic acid-proteins analysis-e/or determining is extracted is 220ng/ μ L, and purity is
1.85, with RNase/DNase-free (going RNase and DNA enzymatic) H2The DNA concentration of extraction is diluted to 5ng/ μ L by O, standby；
(3), reaction system is set up：DNA with step (2) extraction is as template, and the PCR for setting up 10 μ L with specific primer is anti-
System is answered, volume is 2 μ L and concentration is 5ng/ μ L DNA profiling, upstream primer F, the body that volume is 1 μ L and concentration is 5 μM is taken
Product is the 1 μ L and downstream primer R that concentration is 5 μM and 2 × Master mixture (2 × reactant mixture) that volume is 5 μ L,
Remainder RNase/DNase-free H2O is supplied, and realizes the foundation of reaction system, and arranges parallel test；
(4), PCR amplifications：The reaction system that step (3) is set up is placed on real-time fluorescence quantitative PCR instrument, following bar is set
Part：1., template denaturation：95℃-5min；2., QPCR amplifications：95 DEG C of -20s, 60 DEG C of -10s, 72 DEG C of -10s, 40 circulations, 72
DEG C when gather fluorescence signal；3., melting curve：The speed of 95 DEG C of -5s, 65 DEG C of 97 DEG C of to is 0.5 DEG C/5s, and 1 circulates；
(5), mouse composition analysis result is evaluated：Determine and the average Cp values of weighted calculation real-time fluorescence quantitative PCR product,
Cp values are less than 33, and melting curve shows obvious single main peak, without non-specific PCR products, shows to draw using the specificity
Thing is able to detect that mouse composition, and specificity and repeatability are good.
Mitochondrial cytochrome b of the specific primer according to the present invention according to mouse in Genbank (DNA sequence data storehouse)
What gene order was designed and synthesized, the base sequence of the upstream primer F of specific primer is 5 '-
The base sequence of GCCTTATAATTAATTGGAGGTA-3 ', the downstream primer R of specific primer be 5 '-
AGCTATATTATGTGCTTGAT-3’。
The specific findings of specific primer according to the present invention only obvious single main peak in solubility curve figure, does not have
There are other peaks, primer has purity, and main peak has unicity, can only synthesize single substance to mouse composition targetedly.
The base sequence of specific primer according to the present invention is synthesized by Shanghai Jierui Biology Engineering Co., Ltd；It is real
When quantitative real time PCR Instrument be Roche (Roche) biotechnologies company production the formula real time fluorescent quantitatives of Light Cycler 480
PCR；Nucleic acid-protein analyzer is the BioDrop- μ Lite formulas nucleic acid-protein analysis of Biochrom (Bai Nuo) Co., Ltd production
Instrument；High speed freezing centrifuge is the table-type high-speed refrigerated centrifuge of Hunan Xiang Yi experimental facilities Co., Ltd production；2×Master
Mixture is the LightCycler480SYBR Green I Master of Roche (Roche) biotechnologies company production；DNA is carried
Take the tissue gene group DNA extraction kit that kit is the production of Tiangeng biochemical technology Co., Ltd.
Compared with prior art, mitochondrial cytochrome b genes sequences Design based on mouse has simultaneously synthesized utilization to the present invention
Quantitative real-time PCR detects the specific primer of mouse composition, can realize the work(to mouse composition qualitative detection
Effect.
The invention has the beneficial effects as follows providing the primer that mouse composition is detected using real-time fluorescence quantitative PCR, the primer
With good specific and repeatability so that the quantitative real-time PCR carried out using the primer detects mouse composition
When it is easy to operate, time-consuming less, specificity it is high, it is to avoid taking out amplified production in traditional detection method carries out expansion during electroresis appraisal
The secondary pollution that volume increase thing is caused, the detection for mouse composition provides new approach.
Description of the drawings：
Fig. 1 is the solubility curve figure that the embodiment of the present invention 1 is related to.
Fig. 2 is the solubility curve figure that the embodiment of the present invention 2 is related to.
Specific embodiment：
Below by embodiment and combine accompanying drawing the present invention is described further.
Embodiment 1：
The technical process of the method for the specific primer detection mouse composition that the present embodiment is related to is divided into specific primer
Synthesis, DNA are extracted, reaction system is set up, PCR is expanded, mouse composition analysis result evaluates five steps：
(1), specific primer design synthesis：According to the mitochondrial cytochrome b genes sequences Design of mouse in Genbank simultaneously
Synthesis specific primer, the base sequence of the upstream primer F of specific primer is 5 '-GCCTTATAATTAATTGGAGGTA-3 ',
The base sequence of the downstream primer R of specific primer is 5 '-AGCTATATTATGTGCTTGAT-3 '；
(2), DNA is extracted：Take mouse musculature 1g and grind to form rotten shape, then according to tissue gene group DNA extraction kit
Operation instruction is operated, and extracts DNA, and the concentration of the DNA that Jing nucleic acid-proteins analysis-e/or determining is extracted is 220ng/ μ L, and purity is
1.85, use RNase/DNase-free H2The DNA concentration of extraction is diluted to 5ng/ μ L by O, standby；
(3), reaction system is set up：DNA with step (2) extraction is as template, and the PCR for setting up 10 μ L with specific primer is anti-
System is answered, volume is 2 μ L and concentration is 5ng/ μ L DNA profiling, upstream primer F, the body that volume is 1 μ L and concentration is 5 μM is taken
Product is the 1 μ L and downstream primer R that concentration is 5 μM and 2 × Master mixture that volume is 5 μ L, and remainder is used
RNase/DNase-free H2O is supplied, and realizes the foundation of reaction system；Meanwhile, three groups of parallel laboratory tests are set；
(4), PCR amplifications：The reaction system that step (3) is set up is placed on real-time fluorescence quantitative PCR instrument, following bar is set
Part：1., template denaturation：95℃-5min；2., QPCR amplifications：95 DEG C of -20s, 60 DEG C of -10s, 72 DEG C of -10s, 40 circulations, 72
DEG C when gather fluorescence signal；3., melting curve：The speed of 95 DEG C of -5s, 65 DEG C of 97 DEG C of to is 0.5 DEG C/5s, and 1 circulates.
(5), mouse composition analysis result is evaluated：Jing determine obtain three groups of parallel laboratory tests Cp values respectively 16.35,
16.94 and 16.10, it is weight averaged be calculated Cp values be 16.47, Cp values standard deviation be 0.430, melting curve such as Fig. 1
It is shown, there is obvious single main peak, and registration is good, show to be able to detect that mouse composition using the primer, and specifically
Property is good.
Mitochondrial cytochrome b genes sequences Design of the specific primer that the present embodiment is related to according to mouse in Genbank
And synthesize, the base sequence of the upstream primer F of specific primer is 5 '-GCCTTATAATTAATTGGAGGTA-3 ', specific
The base sequence of the downstream primer R of primer is 5 '-AGCTATATTATGTGCTTGAT-3 '.
The specific findings of the specific primer that the present embodiment is related to only obvious single main peak in solubility curve figure,
Without other peaks, primer has purity, and main peak has unicity, can only synthesize single thing to mouse composition targetedly
Matter.
The base sequence of the specific primer that the present embodiment is related to is synthesized by Shanghai Jierui Biology Engineering Co., Ltd；
Real-time fluorescence quantitative PCR instrument is that the formula real-time fluorescences of Light Cycler 480 of Roche (Roche) biotechnologies company production are determined
Amount PCR；Nucleic acid-protein analyzer is the BioDrop- μ Lite formulas nucleic acid-protein analysis of Biochrom (Bai Nuo) Co., Ltd production
Instrument；High speed freezing centrifuge is the table-type high-speed refrigerated centrifuge of Hunan Xiang Yi experimental facilities Co., Ltd production；2×Master
Mixture is the LightCycler480SYBR Green I Master of Roche (Roche) biotechnologies company production；DNA is carried
Take the tissue gene group DNA extraction kit that kit is the production of Tiangeng biochemical technology Co., Ltd.
Embodiment 2：
The technical process of the method for the specific primer detection mouse composition that the present embodiment is related to is divided into specific primer
Synthesis, DNA are extracted, reaction system is set up, PCR is expanded, mouse composition analysis result evaluates five steps：
(1), specific primer design synthesis：According to the mitochondrial cytochrome b genes sequences Design of mouse in Genbank simultaneously
Synthesis specific primer, the base sequence of the upstream primer F of specific primer is 5 '-GCCTTATAATTAATTGGAGGTA-3 ',
The base sequence of the downstream primer R of specific primer is 5 '-AGCTATATTATGTGCTTGAT-3 '；
(2), DNA is extracted：1g grinds to form rotten shape to take mouse musculature (different from the mouse source of embodiment 1), then according to group
The operation of genome DNA extracting reagent kit operation instruction is knitted, DNA, the concentration of the DNA that Jing nucleic acid-proteins analysis-e/or determining is extracted is extracted
For 220ng/ μ L, purity is 1.85, uses RNase/DNase-free H2The DNA concentration of extraction is diluted to 5ng/ μ L by O, standby；
(3), reaction system is set up：DNA with step (2) extraction is as template, and the PCR for setting up 10 μ L with specific primer is anti-
System is answered, volume is 2 μ L and concentration is 5ng/ μ L DNA profiling, upstream primer F, the body that volume is 1 μ L and concentration is 5 μM is taken
Product is the 1 μ L and downstream primer R that concentration is 5 μM and 2 × Master mixture that volume is 5 μ L, and remainder is used
RNase/DNase-free H2O is supplied, and realizes the foundation of reaction system；Meanwhile, three groups of parallel laboratory tests are set；
(4), PCR amplifications：The reaction system that step (3) is set up is placed on real-time fluorescence quantitative PCR instrument, following bar is set
Part：1., template denaturation：95℃-5min；2., QPCR amplifications：95 DEG C of -20s, 60 DEG C of -10s, 72 DEG C of -10s, 40 circulations, 72
DEG C when gather fluorescence signal；3., melting curve：The speed of 95 DEG C of -5s, 65 DEG C of 97 DEG C of to is 0.5 DEG C/5s, and 1 circulates.
(5), mouse composition analysis result is evaluated：Jing determine obtain three groups of parallel laboratory tests Cp values respectively 16.33,
16.94 and 16.28, it is weight averaged be calculated Cp values be 16.52, Cp values standard deviation be 0.366, melting curve such as Fig. 2
It is shown, there is obvious single main peak, and registration is good, show to be able to detect that mouse composition using the primer, and specifically
Property is good.
Mitochondrial cytochrome b genes sequences Design of the specific primer that the present embodiment is related to according to mouse in Genbank
And synthesize, the base sequence of the upstream primer F of specific primer is 5 '-GCCTTATAATTAATTGGAGGTA-3 ', specific
The base sequence of the downstream primer R of primer is 5 '-AGCTATATTATGTGCTTGAT-3 '.
Upstream primer F：GCCTTATAATTAATTGGAGGTA
Downstream primer R：AGCTATATTATGTGCTTGAT
Claims (3)
1. the method that a species-specific primer detects mouse composition, it is characterised in that technical process is divided into specific primer design
Synthesis, DNA are extracted, reaction system is set up, PCR is expanded, mouse composition analysis result evaluates five steps：
(1), specific primer design synthesis：According to the mitochondrial cytochrome b genes sequences Design of mouse in Genbank and synthesize
Specific primer, the base sequence of the upstream primer F of specific primer is 5 '-GCCTTATAATTAATTGGAGGTA-3 ', specifically
Property primer downstream primer R base sequence be 5 '-AGCTATATTATGTGCTTGAT-3 '；
(2), DNA is extracted：Take mouse musculature 1g and grind to form rotten shape, then according to tissue gene group DNA extraction kit is used
Operation is illustrated, DNA is extracted, the concentration of the DNA that Jing nucleic acid-proteins analysis-e/or determining is extracted is 220ng/ μ L, and purity is 1.85, is used
RNase/DNase-free H2The DNA concentration of extraction is diluted to 5ng/ μ L by O, standby；
(3), reaction system is set up：DNA with step (2) extraction sets up the PCR reactants of 10 μ L as template with specific primer
System, it is 1 to take volume is 2 μ L and concentration is 5ng/ μ L DNA profiling, the upstream primer F that volume is 1 μ L and concentration is 5 μM, volume
2 × Master mixture that μ L and concentration are 5 μM of downstream primer R and volume is 5 μ L, remainder RNase/
DNase-free H2O is supplied, and realizes the foundation of reaction system, and arranges parallel test；
(4), PCR amplifications：The reaction system that step (3) is set up is placed on real-time fluorescence quantitative PCR instrument, following condition is set：
1., template denaturation：95℃-5min；2., QPCR amplifications：95 DEG C of -20s, 60 DEG C of -10s, 72 DEG C of -10s, 40 circulations, at 72 DEG C
When gather fluorescence signal；3., melting curve：The speed of 95 DEG C of -5s, 65 DEG C of 97 DEG C of to is 0.5 DEG C/5s, and 1 circulates；
(5), mouse composition analysis result is evaluated：Determine and the average Cp values of weighted calculation real-time fluorescence quantitative PCR product, Cp values
Less than 33, melting curve shows obvious single main peak, without non-specific PCR products, shows using the specific primer energy
Mouse composition is enough detected, and specificity and repeatability are good.
2. the method that specific primer according to claim 1 detects mouse composition, it is characterised in that the specificity
Primer is according to the mitochondrial cytochrome b genes sequences Design of mouse in Genbank and synthesizes, the upstream of the specific primer
The base sequence of primers F be 5 '-GCCTTATAATTAATTGGAGGTA-3 ', the base of the downstream primer R of the specific primer
Sequence is 5 '-AGCTATATTATGTGCTTGAT-3 '.
3. the method that specific primer according to claim 1 detects mouse composition, it is characterised in that specific primer
Base sequence be to be synthesized by Shanghai Jierui Biology Engineering Co., Ltd；Real-time fluorescence quantitative PCR instrument is Roche biotechnologies
The formula real-time fluorescence quantitative PCRs of LightCycler 480 of company's production；Nucleic acid-protein analyzer is the life of Biochrom Co., Ltds
The BioDrop- μ Lite formula nucleic acid-protein analyzers of product；High speed freezing centrifuge is the life of Hunan Xiang Yi experimental facilities Co., Ltd
The table-type high-speed refrigerated centrifuge of product；2 × Mastermixture is the production of Roche biotechnologies company
LightCycler480SYBR Green I Master；DNA extraction kit is the group of Tiangeng biochemical technology Co., Ltd production
Knit genome DNA extracting reagent kit.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710014015.7A CN106636421A (en) | 2017-01-10 | 2017-01-10 | Method for detecting mouse original components by specific primer |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710014015.7A CN106636421A (en) | 2017-01-10 | 2017-01-10 | Method for detecting mouse original components by specific primer |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106636421A true CN106636421A (en) | 2017-05-10 |
Family
ID=58842786
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710014015.7A Pending CN106636421A (en) | 2017-01-10 | 2017-01-10 | Method for detecting mouse original components by specific primer |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106636421A (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105132569A (en) * | 2015-09-18 | 2015-12-09 | 李欣南 | Whole set of LAMP (loop-mediated isothermal amplification) primers for identifying or assisting in identifying murine components as well as applications of whole set of primers |
-
2017
- 2017-01-10 CN CN201710014015.7A patent/CN106636421A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105132569A (en) * | 2015-09-18 | 2015-12-09 | 李欣南 | Whole set of LAMP (loop-mediated isothermal amplification) primers for identifying or assisting in identifying murine components as well as applications of whole set of primers |
Non-Patent Citations (4)
| Title |
|---|
| I. MARTI´N: "Technical Note: Detection of cat, dog, and rat or mouse tissues in food and animal feed using species-specific polymerase chain reaction", 《JOURNAL OF ANIMAL SCIENCE》 * |
| 周如华: "实时荧光定量PCR检测羊肉制品中鼠源性成分", 《中国法医学杂志》 * |
| 张伟: "《野生动物产业管理学》", 30 November 2012, 东北林业大学出版社 * |
| 温旺荣等: "《临床分子诊断学》", 30 April 2015, 广东科技出版社 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102719526B (en) | MicroRNA quantitative detection analytic method by utilizing isothermal amplification to synthesize fluorescent nano silver cluster probe | |
| CN101638685A (en) | Method for amplifying target nucleic acid sequence by using cross primer and kit for amplifying target nucleic acid sequence and application thereof | |
| CN102337345B (en) | Medicolegal composite assay kit based on twenty triallelic SNP (single nucleotide polymorphism) genetic markers | |
| CN105695628B (en) | A kind of HRM detection primer and method identifying swine foot-and-mouth disease virus and pig Sai Neijia paddy virus | |
| CN103468830A (en) | NASBA kit for detecting monkey pox virus and application thereof | |
| CN102099488A (en) | Method for amplifying oligonucleotide and small RNA by using polymerase-endonuclease chain reaction | |
| CN102605092B (en) | LAMP (Loop-mediated isothermal amplification) rapid detection method of Citrus huanglongbing | |
| CN104789667A (en) | Small RNA (ribonucleic acid) detection kit and quantitative method based on unbiased recognition and isothermal amplification | |
| CN105462957A (en) | Splitting decomposition composition, application thereof, kit, method for preparing nucleic acid through splitting decomposition composition and method for analyzing nucleic acid | |
| CN102643912B (en) | Amplification primer for detecting mink derived ingredients | |
| CN114381550A (en) | Multi-target nucleic acid detection kit and detection method for HPV typing | |
| CN110592268A (en) | RAA constant temperature fluorescence detection method and reagent for lake luo virus (TiLV) | |
| CN117089653A (en) | Compositions for RNA virus detection based on high throughput amplicon sequencing | |
| CN106636421A (en) | Method for detecting mouse original components by specific primer | |
| RU2415948C1 (en) | METHOD OF SUBSPECIFIC DIFFERENTIATION OF Yersinia pestis STRAINS BY MULTILOCUS SEQUENCE TYPING | |
| CN107287352A (en) | The probe primer group and its method of duck enteritis virus and duck hepatitis virus quick detection | |
| CN104073560B (en) | The rapid molecular discrimination method of a kind of Eucommia ulmoides or former plant | |
| CN106591469A (en) | Specific primer for detecting mouse-derived components | |
| RU2550257C2 (en) | METHOD OF DIFFERENTIATING TYPICAL AND ATYPICAL STRAINS Yersinia pestis OF MEDIEVAL BIOVAR BY PCR METHOD WITH HYBRIDISATION-FLUORESCENT RECORDING RESULTS | |
| CN107365766B (en) | Method for extracting RNA of mould spore by mechanical crushing method | |
| CN110564823A (en) | DNA constant temperature amplification method and kit | |
| CN106868185A (en) | A kind of specific primer group and its application for detecting rat derived component | |
| CN106636364B (en) | Multiplex PCR kit for rapidly identifying species of arowana and identification method thereof | |
| CN103320519B (en) | The pcr analysis method of detection by quantitative microRNA | |
| CN102676678A (en) | PCR (Polymerase Chain Reaction) primer group for distinguishing five types of shellfish bait microalgae |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170510 |