CN117089653A - Compositions for RNA virus detection based on high throughput amplicon sequencing - Google Patents
Compositions for RNA virus detection based on high throughput amplicon sequencing Download PDFInfo
- Publication number
- CN117089653A CN117089653A CN202311124538.9A CN202311124538A CN117089653A CN 117089653 A CN117089653 A CN 117089653A CN 202311124538 A CN202311124538 A CN 202311124538A CN 117089653 A CN117089653 A CN 117089653A
- Authority
- CN
- China
- Prior art keywords
- seq
- amplifying
- primer
- primer groups
- groups
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 239000000203 mixture Substances 0.000 title claims abstract description 46
- 238000012163 sequencing technique Methods 0.000 title claims abstract description 38
- 238000001514 detection method Methods 0.000 title claims abstract description 29
- 108091093088 Amplicon Proteins 0.000 title claims abstract description 23
- 241001493065 dsRNA viruses Species 0.000 title claims abstract description 14
- 241000713196 Influenza B virus Species 0.000 claims abstract description 10
- 241001678559 COVID-19 virus Species 0.000 claims abstract description 5
- 241001466951 Coxsackievirus A2 Species 0.000 claims abstract description 5
- 241001529459 Enterovirus A71 Species 0.000 claims abstract description 5
- 241000988556 Enterovirus B Species 0.000 claims abstract description 5
- 241000342334 Human metapneumovirus Species 0.000 claims abstract description 5
- 241000726041 Human respirovirus 1 Species 0.000 claims abstract description 5
- 241000712003 Human respirovirus 3 Species 0.000 claims abstract description 5
- 241001559187 Human rubulavirus 2 Species 0.000 claims abstract description 5
- 241000712431 Influenza A virus Species 0.000 claims abstract description 5
- 241000725643 Respiratory syncytial virus Species 0.000 claims abstract description 5
- 241001325464 Rhinovirus A Species 0.000 claims abstract description 5
- 239000003153 chemical reaction reagent Substances 0.000 claims description 18
- 230000003321 amplification Effects 0.000 claims description 13
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 13
- 108020004707 nucleic acids Proteins 0.000 claims description 10
- 102000039446 nucleic acids Human genes 0.000 claims description 10
- 150000007523 nucleic acids Chemical class 0.000 claims description 10
- 238000002360 preparation method Methods 0.000 claims description 5
- 241000988559 Enterovirus A Species 0.000 claims description 4
- 238000000605 extraction Methods 0.000 claims description 4
- 238000003556 assay Methods 0.000 claims description 3
- 238000012545 processing Methods 0.000 claims description 2
- 238000011144 upstream manufacturing Methods 0.000 claims description 2
- 238000004458 analytical method Methods 0.000 abstract description 7
- LFQSCWFLJHTTHZ-UHFFFAOYSA-N Ethanol Chemical compound CCO LFQSCWFLJHTTHZ-UHFFFAOYSA-N 0.000 description 20
- 238000000034 method Methods 0.000 description 12
- 239000006228 supernatant Substances 0.000 description 12
- 108020004414 DNA Proteins 0.000 description 11
- 238000006243 chemical reaction Methods 0.000 description 10
- 239000011324 bead Substances 0.000 description 9
- 239000000047 product Substances 0.000 description 6
- 239000002096 quantum dot Substances 0.000 description 6
- 230000015572 biosynthetic process Effects 0.000 description 5
- 238000003786 synthesis reaction Methods 0.000 description 5
- 238000012408 PCR amplification Methods 0.000 description 4
- 238000005119 centrifugation Methods 0.000 description 4
- 244000005700 microbiome Species 0.000 description 4
- 238000002156 mixing Methods 0.000 description 4
- 244000052769 pathogen Species 0.000 description 4
- 238000010276 construction Methods 0.000 description 3
- 230000007613 environmental effect Effects 0.000 description 3
- 239000012634 fragment Substances 0.000 description 3
- 230000000813 microbial effect Effects 0.000 description 3
- 238000012070 whole genome sequencing analysis Methods 0.000 description 3
- 108091092584 GDNA Proteins 0.000 description 2
- 101710163270 Nuclease Proteins 0.000 description 2
- 238000013399 early diagnosis Methods 0.000 description 2
- 239000003623 enhancer Substances 0.000 description 2
- 238000002474 experimental method Methods 0.000 description 2
- 230000002068 genetic effect Effects 0.000 description 2
- 238000011068 loading method Methods 0.000 description 2
- 238000007403 mPCR Methods 0.000 description 2
- 229930014626 natural product Natural products 0.000 description 2
- 230000001717 pathogenic effect Effects 0.000 description 2
- 238000000746 purification Methods 0.000 description 2
- 238000011160 research Methods 0.000 description 2
- 238000010839 reverse transcription Methods 0.000 description 2
- 230000035945 sensitivity Effects 0.000 description 2
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 2
- TVEXGJYMHHTVKP-UHFFFAOYSA-N 6-oxabicyclo[3.2.1]oct-3-en-7-one Chemical group C1C2C(=O)OC1C=CC2 TVEXGJYMHHTVKP-UHFFFAOYSA-N 0.000 description 1
- 102000053602 DNA Human genes 0.000 description 1
- 102000016928 DNA-directed DNA polymerase Human genes 0.000 description 1
- 108010014303 DNA-directed DNA polymerase Proteins 0.000 description 1
- 102000004190 Enzymes Human genes 0.000 description 1
- 108090000790 Enzymes Proteins 0.000 description 1
- 102100034343 Integrase Human genes 0.000 description 1
- 108010092799 RNA-directed DNA polymerase Proteins 0.000 description 1
- 108020005202 Viral DNA Proteins 0.000 description 1
- 241000700605 Viruses Species 0.000 description 1
- 239000013543 active substance Substances 0.000 description 1
- 238000013459 approach Methods 0.000 description 1
- 238000003149 assay kit Methods 0.000 description 1
- 239000008280 blood Substances 0.000 description 1
- 210000004369 blood Anatomy 0.000 description 1
- 238000010805 cDNA synthesis kit Methods 0.000 description 1
- 239000012295 chemical reaction liquid Substances 0.000 description 1
- 239000007795 chemical reaction product Substances 0.000 description 1
- 239000002299 complementary DNA Substances 0.000 description 1
- 238000007405 data analysis Methods 0.000 description 1
- 238000012350 deep sequencing Methods 0.000 description 1
- 238000004925 denaturation Methods 0.000 description 1
- 230000036425 denaturation Effects 0.000 description 1
- 238000010586 diagram Methods 0.000 description 1
- 230000004069 differentiation Effects 0.000 description 1
- 239000012154 double-distilled water Substances 0.000 description 1
- 230000000694 effects Effects 0.000 description 1
- 238000005516 engineering process Methods 0.000 description 1
- 230000030279 gene silencing Effects 0.000 description 1
- 239000001963 growth medium Substances 0.000 description 1
- 238000012165 high-throughput sequencing Methods 0.000 description 1
- 239000004615 ingredient Substances 0.000 description 1
- 238000007689 inspection Methods 0.000 description 1
- 244000000010 microbial pathogen Species 0.000 description 1
- 108090000623 proteins and genes Proteins 0.000 description 1
- 239000012264 purified product Substances 0.000 description 1
- 208000023504 respiratory system disease Diseases 0.000 description 1
- 241000894007 species Species 0.000 description 1
- 208000024891 symptom Diseases 0.000 description 1
- 238000012360 testing method Methods 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Analytical Chemistry (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the field of biological detection. In particular, to compositions for high throughput amplicon sequencing detection, and more particularly, to compositions for high throughput amplicon sequencing detection of RNA viruses. The present invention provides a composition for detecting RNA viruses based on high throughput amplicon sequencing, comprising at least 4 targets as shown below: human metapneumovirus, parainfluenza virus type 1, parainfluenza virus type 2, parainfluenza virus type 3, 2019 novel coronavirus, respiratory syncytial virus a, influenza B virus Yamagata, influenza B virus Victoria, human rhinovirus a, enterovirus a71, enterovirus B, coxsackie virus A2, influenza a virus. The composition can amplify and enrich a plurality of targets in one tube simultaneously, so that the data volume required by subsequent sequencing is obviously reduced, the analysis work is simplified, and the whole detection is more accurate and efficient.
Description
Technical Field
The invention belongs to the field of biological detection. In particular, to compositions for high throughput amplicon sequencing detection, and more particularly, to compositions for high throughput amplicon sequencing detection of RNA viruses.
Background
Metagenomics (Metagenomics) is also known as microbial environmental genomics. The method constructs a metagenome library by directly extracting DNA of all microorganisms from an environmental sample, and researches genetic composition and community functions of all microorganisms contained in the environmental sample by utilizing a research strategy of genomics. The metagenome is developed on the basis of microbiology, is independent of the isolated culture of microorganisms, can be used for researching natural products in microorganisms which are difficult to culture or can not be cultured and natural products in a silencing state, and greatly improves the utilization degree of microbial resources in metagenome samples. By performing deep sequencing analysis on metagenomic samples, the true species diversity and genetic diversity in the environment can be revealed or estimated, and the metagenomic samples can be used for discovering novel microbial active substances (or novel genes). Currently, metagenomic studies mainly include two approaches, whole Genome Sequencing (WGS) and targeted resequencing (tNGS).
Unlike whole genome sequencing, targeted resequencing techniques can directly perform targeted enrichment on the genome of interest in the sample to be tested, separating the target genome from the complex background nucleic acid, and resequencing. The method is more economical and efficient, and has higher sensitivity and is more convenient for subsequent data analysis. For example, in clinical sample sequencing data, the background data of human genome may be up to 99%, only 1% of the data is the target sequence, so that a large amount of data is required to ensure the accuracy of the data, if the target sequence is enriched and then sequenced separately, the required data amount can be significantly reduced, and the related work can be greatly simplified in subsequent analysis correspondingly.
Thus, there is a need in the art for a composition that enriches targets such that the amount of data required for subsequent sequencing is significantly reduced, and that can simplify analysis, allow for accurate and efficient detection of various targets, allow for accurate differentiation of pathogens responsible for various etiologies, and provide a means for early diagnosis and early treatment.
Disclosure of Invention
In view of this, in a first aspect, the present invention provides a composition for detecting RNA viruses based on high throughput amplicon sequencing, comprising at least 4 targets in the primer set as follows:
primer groups for amplifying human metapneumovirus shown as SEQ ID NO. 1-10;
primer groups for amplifying parainfluenza virus type 1 shown in SEQ ID NO. 11-16;
primer groups for amplifying parainfluenza virus type 2 shown in SEQ ID NO. 17-22;
primer groups for amplifying parainfluenza virus type 3 shown in SEQ ID NO. 23-32;
primer group for amplifying 2019 novel coronavirus as shown in SEQ ID NO. 33-38;
primer groups for amplifying the respiratory syncytial virus A shown as SEQ ID NO. 39-46;
primer groups for amplifying influenza B virus Yamagata shown in SEQ ID NO. 47-50;
primer groups for amplifying influenza B virus Victoria shown in SEQ ID No. 51-56;
a primer group for amplifying the human rhinovirus A as shown in SEQ ID NO. 57-58;
primer groups for amplifying enterovirus A shown as SEQ ID NO. 59-60;
primer group for amplifying enterovirus A71 as shown in SEQ ID NO. 61-66;
primer groups for amplifying enterovirus B shown as SEQ ID NO. 67-68;
primer groups for amplifying the coxsackievirus A2 shown as SEQ ID NO. 69-72; or alternatively
Primer groups for amplifying influenza A viruses are shown as SEQ ID NO. 73-82.
Further, the present invention provides a composition based on high throughput amplicon sequencing detection comprising at least 5 targets in the primer set as indicated above.
Further, the present invention provides a composition based on high throughput amplicon sequencing detection comprising at least 6 targets in the primer set as indicated above.
Further, the present invention provides a composition based on high throughput amplicon sequencing detection comprising at least 7 targets in the primer set as indicated above.
Further, the present invention provides a composition based on high throughput amplicon sequencing detection comprising at least 8 targets in the primer set as indicated above.
Further, the present invention provides a composition based on high throughput amplicon sequencing detection comprising at least 9 targets in the primer set as indicated above.
Further, the present invention provides a composition based on high throughput amplicon sequencing detection comprising at least 10, 11, 12, 13, 14 targets in the primer set as indicated above.
The composition can amplify and enrich a plurality of targets in one tube simultaneously, so that the data volume required by subsequent sequencing is obviously reduced, the analysis work is simplified, and the whole detection is more accurate and efficient. Can rapidly lock in pathogens causing etiology (particularly, respiratory diseases, more particularly, similar clinical symptoms), and provides means for early diagnosis and early treatment.
It is needless to say that if 14 targets can be PCR amplified simultaneously within a tube, any combination of these 14 targets (e.g., any 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14) can be PCR amplified within a tube, as will be appreciated by those skilled in the art.
Still further, the present invention provides a composition based on high throughput amplicon sequencing detection, comprising:
primer groups for amplifying human metapneumovirus shown as SEQ ID NO. 1-10;
primer groups for amplifying parainfluenza virus type 1 shown in SEQ ID NO. 11-16;
primer groups for amplifying parainfluenza virus type 2 shown in SEQ ID NO. 17-22;
primer groups for amplifying parainfluenza virus type 3 shown in SEQ ID NO. 23-32;
primer group for amplifying 2019 novel coronavirus as shown in SEQ ID NO. 33-38;
primer groups for amplifying the respiratory syncytial virus A shown as SEQ ID NO. 39-46;
primer groups for amplifying influenza B virus Yamagata shown in SEQ ID NO. 47-50;
primer groups for amplifying influenza B virus Victoria shown in SEQ ID No. 51-56;
a primer group for amplifying the human rhinovirus A as shown in SEQ ID NO. 57-58;
primer groups for amplifying enterovirus A shown as SEQ ID NO. 59-60;
primer group for amplifying enterovirus A71 as shown in SEQ ID NO. 61-66;
primer groups for amplifying enterovirus B shown as SEQ ID NO. 67-68;
primer groups for amplifying the coxsackievirus A2 shown as SEQ ID NO. 69-72; and
primer groups for amplifying influenza A viruses are shown as SEQ ID NO. 73-82.
The composition provided by the invention can amplify and enrich 14 targets in one tube at the same time, so that the data volume required by subsequent sequencing is obviously reduced, the analysis work is simplified, and the whole detection is more accurate and efficient.
Further, the primer sets each have a linker sequence to facilitate sequencing.
Further, the upstream primer adapter sequence was ACACGACGCTCTTCCGATCT and the downstream primer adapter sequence was CTTGGCACCCGAGAATTCCA.
In some specific embodiments, the ingredients of the composition are present in the same package.
Further, the components of the composition of the present invention are present in a mixed form.
In a second aspect, the present invention provides the use of a composition as described above for the preparation of a kit for high throughput amplicon sequencing detection of RNA viruses.
In a third aspect, the present invention provides a kit for high throughput amplicon sequencing detection of RNA viruses comprising the composition described above.
Further, the kit further comprises at least one of the following: reagents required for nucleic acid extraction, reagents required for nucleic acid amplification, and reagents required for sequencing.
Further, the reagent required for nucleic acid extraction may be a reagent for extracting DNA from blood.
Further, the reagents required for nucleic acid amplification include reverse transcriptase, DNA polymerase, dNTPs, buffer, and Mg 2+ 。
Further, reagents required for sequencing include magnetic beads.
In a fourth aspect, the present invention provides a use for preparing a composition for high throughput amplicon sequencing detection of RNA viruses, wherein the detection comprises:
1) Extracting or releasing nucleic acid of a sample to be tested;
2) Amplifying using a composition as described above to obtain an amplified product;
3) Processing the amplified products and establishing a library; and
4) Sequencing and analyzing the result.
Further, the amplification is classified into reverse transcription and then the first PCR amplification is performed.
Further, the amplified product is treated to perform a second PCR amplification.
Further, the conditions of the amplification are:
drawings
FIG. 1 is a flow chart of library construction;
FIG. 2 is a schematic diagram of library construction;
FIG. 3 is a graph of library fragment size results.
Detailed Description
The advantages and various effects of the present invention will be more clearly apparent from the following detailed description and examples. It will be understood by those skilled in the art that these specific embodiments and examples are intended to illustrate the invention, not to limit the invention.
Example 1 primers used in the present invention
The primer sets used in the present invention are shown in Table 1.
TABLE 1
Example 2 method of detection of different targets based on high throughput amplicon sequencing
A specific library construction scheme is shown in FIG. 1. The principle is shown in figure 2, in brief, a specific primer is designed based on a target area of pathogenic microorganism, a general sequence is added to the 5' end of all the specific primers, the nucleic acid to be detected is used as a template for first round of amplification, and the obtained amplification product is added with a label primer for second round of amplification to complete library establishment.
1 Experimental reagent and apparatus
The reagents and instrumentation required are shown in tables 2 and 3 below.
TABLE 2
TABLE 3 Table 3
| Name of the name | Branding |
| LabChip GX | caliper |
| Sansureseq1000 | Saint Hunan organism |
| PCR amplification instrument | Hangzhou Bo-day technology |
| Qubit 3.0fluorometer | thermo fisher |
2 experimental procedure
2.1 preparation of multiplex amplification primer set
The synthesized multiplex amplification primers (100. Mu.M) with the adaptor sequences were mixed in the same volume.
2.2 sample preparation
Clinical samples or outsourced virus culture medium standard RNA are extracted by using a FastPure Viral DNA/RNAMini Kit extraction Kit.
2.3 reverse transcription
2.3.1 RNA denaturation
8. Mu.L of RNA was denatured, and the reaction system was as shown in Table 4.
TABLE 4 RNA pretreatment reaction System
| 65℃ | 5min | 1cycle |
| On ice | 2min | - |
2.3.2 genomic DNA removal
The above denatured 8. Mu.L RNA was prepared according to the genomic DNA removal system shown in Table 5, and the reaction procedure was as shown in Table 6, and all the reagents were reverse transcribed and contained in the HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wind) kit purchased from Nanjinopran.
TABLE 5 genomic DNA removal System
| Reagent | Volume(μL) |
| Denatured RNA | 8 |
| 5×gDNAwiper Mix | 2 |
TABLE 6 genomic DNA removal reaction procedure
| 42℃ | 2min | 1cycle |
2.3.3 one Strand Synthesis
A chain synthesis was carried out using the above reaction product as a template, a chain synthesis system is shown in Table 7, and a reaction procedure is shown in Table 8.
TABLE 7 one chain synthesis System
| Reagent | Volume(μL) |
| The reaction liquid of the last step | 10 |
| 10×RT Mix | 2 |
| HiScript III Enzyme Mix | 2 |
| Oligo(dT)20VN | 1 |
| Random hexamers | 1 |
| RNase-free ddH2O | 4 |
TABLE 8 one Strand Synthesis procedure
2.4 first round multiplex amplification
Multiplex PCR amplification was performed using the reverse transcribed single stranded cDNA as a template and the mixed primer set, the amplification system is shown in Table 9, the reaction procedure is shown in Table 10, and all reagents were included in the Ai Jitai well MultipSeq Library Prep Kit kit.
TABLE 9
| Reagent | Volume(μl) |
| ddH 2 O | 9-x |
| Enhancer buffer NB(1N) | 3.5 |
| Enhancer buffer M | 2.5 |
| Primer pool | 5 |
| Stencil (one tube includes all targets) | x |
| IGT EM808Polymerase Mixture | 10 |
Table 10
2.5 purification after first round PCR amplification
Mu.l of PCR product was taken and 27. Mu.l of Nanjinozan DNA clear beads equilibrated to room temperature was added, mixed well with shaking and incubated at room temperature for 5min to bind the DNA to the magnetic beads.
Centrifuging instantly, placing the centrifuge tube on a magnetic rack for 3min until the centrifuge tube is clear, and discarding the supernatant;
adding 50 mu L of YF buffer B into the centrifuge tube, fully oscillating and uniformly mixing, incubating for 5min at room temperature, performing instantaneous centrifugation, placing the centrifuge tube on a magnetic rack for 3min until the centrifuge tube is clear, and discarding the supernatant.
200 mu L of 80% ethanol is added into the centrifuge tube, the magnetic beads are ensured to be completely immersed into the 80% ethanol, the centrifuge tube is kept stand for 1min, and the supernatant is discarded.
200 mu L of 80% ethanol is added into the centrifuge tube, the magnetic beads are ensured to be completely immersed into the 80% ethanol, the centrifuge tube is kept stand for 1min, and the supernatant is discarded.
After sufficient centrifugation, the supernatant was thoroughly removed with a 10. Mu.L pipette and left to stand for 3min to allow the residual ethanol to evaporate thoroughly.
Adding 24 mu l Nuclease free water, shaking, mixing, and standing for 2min.
The centrifuge tube was placed on a magnetic rack for 3min to clarify, 13.5 μl of supernatant was pipetted into a new 200 μl PCR tube.
2.6 round 2 linker sequence PCR reactions
The PCR reaction system of round 2 was prepared as shown in Table 11 using the first round of PCR purified product as a template, and CDIPrimer was included in the purchased MultipSeq CDI Adapter kit, and all other was included in the purchased Ai Jitai cm MultipSeq Library Prep Kit kit, and the reaction procedure was as shown in Table 12.
TABLE 11
Table 12
2.7 round 2 PCR reactions followed by purification.
Mu.l of PCR product was taken and 27. Mu.l of Nanjinozan DNA clear beads equilibrated to room temperature was added, mixed well with shaking and incubated at room temperature for 5min to bind the DNA to the magnetic beads.
Centrifuging instantly, placing the centrifuge tube on a magnetic rack for 3min until the centrifuge tube is clear, and discarding the supernatant;
adding 50 mu L of YF buffer B into the centrifuge tube, fully oscillating and uniformly mixing, incubating for 5min at room temperature, performing instantaneous centrifugation, placing the centrifuge tube on a magnetic rack for 3min until the centrifuge tube is clear, and discarding the supernatant.
200 mu L of 80% ethanol is added into the centrifuge tube, the magnetic beads are ensured to be completely immersed into the 80% ethanol, the centrifuge tube is kept stand for 1min, and the supernatant is discarded.
200 mu L of 80% ethanol is added into the centrifuge tube, the magnetic beads are ensured to be completely immersed into the 80% ethanol, the centrifuge tube is kept stand for 1min, and the supernatant is discarded.
After sufficient centrifugation, the supernatant was thoroughly removed with a 10. Mu.L pipette and left to stand for 3min to allow the residual ethanol to evaporate thoroughly.
Adding 24 mu l Nuclease free water, shaking, mixing, and standing for 2min.
The centrifuge tube was placed on a magnetic rack for 3min to clarify, 20. Mu.L of supernatant was pipetted into a new 200. Mu.L PCR tube, where the prepared multiplex PCR library was prepared.
2.8 library quality inspection machine
By usingdsDNAHS Assay Kit library concentrations were determined. The specific operation is as follows:
preparation of a standard: qubit dsDNAHS Master Mix was dispensed into 2 centrifuge tubes of standard at 190. Mu.L, 10. Mu.L of standard Qubit dsDNAHS Standard #1 and Qubit dsDNA HS Standard #2 were added, respectively, and vortexed for further use, taking care that no air bubbles were present.
1 mu L of a sample to be measured is taken, qubit dsDNAHS Master Mix mu L of the sample is uniformly mixed by vortex, and no bubbles are generated.
The prepared standard and sample were left to react at room temperature for 3min, and library concentration was determined using a Qubit 3.0 fluorometer.
The library fragment size was examined using HT DNAHigh Sensitivity Reagent Kit and the fragment size should be centered at 300-500bp as shown in FIG. 3.
2.9 on-machine sequencing
The library was diluted to 20pM according to the library loading instructions and high throughput sequencing was run on a santhreeq 1000 platform in a SE75+8 loading mode. The machine was started up at 2M/sample.
2.10 analysis of results
Sequencing results show that the primer set can specifically amplify target sequences and realize pathogen detection under 2M data volume. The data volume required by the experimental method is far smaller than the data volume (20M) required by metagenomic sequencing, so that the accurate and reliable result is ensured, the method is more economical and efficient, and the workload is greatly reduced.
Example 3 detection results of test samples of the inventive composition
The gDNA mix samples of 14 RNA viruses were tested as in example 2 using the compositions shown in Table 1. The detection results are shown in Table 13 below. Comparing the off-line data reads with pathogen reference genome by mem algorithm of BWA software, and taking the optimally compared reads with score more than 30 as the reads detected by the method. From the results, it can be seen that the composition of the present invention is capable of amplifying and enriching all targets within a tube, is detected in subsequent sequencing assays, and requires a greatly reduced amount of data.
TABLE 13
/>
Claims (10)
1. A composition for detecting RNA viruses based on high throughput amplicon sequencing, comprising at least 4 targets in the primer set as follows:
primer groups for amplifying human metapneumovirus shown as SEQ ID NO. 1-10;
primer groups for amplifying parainfluenza virus type 1 shown in SEQ ID NO. 11-16;
primer groups for amplifying parainfluenza virus type 2 shown in SEQ ID NO. 17-22;
primer groups for amplifying parainfluenza virus type 3 shown in SEQ ID NO. 23-32;
primer group for amplifying 2019 novel coronavirus as shown in SEQ ID NO. 33-38;
primer groups for amplifying the respiratory syncytial virus A shown as SEQ ID NO. 39-46;
primer groups for amplifying influenza B virus Yamagata shown in SEQ ID NO. 47-50;
primer groups for amplifying influenza B virus Victoria shown in SEQ ID No. 51-56;
a primer group for amplifying the human rhinovirus A as shown in SEQ ID NO. 57-58;
primer groups for amplifying enterovirus A shown as SEQ ID NO. 59-60;
primer group for amplifying enterovirus A71 as shown in SEQ ID NO. 61-66;
primer groups for amplifying enterovirus B shown as SEQ ID NO. 67-68;
primer groups for amplifying the coxsackievirus A2 shown as SEQ ID NO. 69-72; or alternatively
Primer groups for amplifying influenza A viruses are shown as SEQ ID NO. 73-82.
2. The composition of claim 1, comprising at least 8 targets in the primer set as set forth above.
3. A composition according to claim 2, comprising:
primer groups for amplifying human metapneumovirus shown as SEQ ID NO. 1-10;
primer groups for amplifying parainfluenza virus type 1 shown in SEQ ID NO. 11-16;
primer groups for amplifying parainfluenza virus type 2 shown in SEQ ID NO. 17-22;
primer groups for amplifying parainfluenza virus type 3 shown in SEQ ID NO. 23-32;
primer group for amplifying 2019 novel coronavirus as shown in SEQ ID NO. 33-38;
primer groups for amplifying the respiratory syncytial virus A shown as SEQ ID NO. 39-46;
primer groups for amplifying influenza B virus Yamagata shown in SEQ ID NO. 47-50;
primer groups for amplifying influenza B virus Victoria shown in SEQ ID No. 51-56;
a primer group for amplifying the human rhinovirus A as shown in SEQ ID NO. 57-58;
primer groups for amplifying enterovirus A shown as SEQ ID NO. 59-60;
primer group for amplifying enterovirus A71 as shown in SEQ ID NO. 61-66;
primer groups for amplifying enterovirus B shown as SEQ ID NO. 67-68;
primer groups for amplifying the coxsackievirus A2 shown as SEQ ID NO. 69-72; and
primer groups for amplifying influenza A viruses are shown as SEQ ID NO. 73-82.
4. A composition according to any one of claims 1 to 3, wherein the primer sets each bear a linker sequence.
5. The composition of claim 4, wherein the upstream primer adapter sequence is set forth in SEQ ID NO. 83: ACACGACGCTCTTCCGATCT, the sequence of the downstream primer linker is the sequence shown in SEQ ID NO. 84: CTTGGCACCCGAGAATTCCA.
6. The composition of claim 5, wherein the components of the composition are present in a mixed form.
7. Use of a composition according to any one of claims 1 to 6 for the preparation of a kit for high throughput amplicon sequencing detection of RNA viruses.
8. A kit for high throughput amplicon sequencing detection of RNA viruses comprising the composition of any one of claims 1-6.
9. The kit of claim 8, further comprising at least one of: reagents required for nucleic acid extraction, reagents required for nucleic acid amplification, and reagents required for sequencing.
10. Use of a composition for preparing a high throughput amplicon sequencing assay for RNA virus, wherein the assay comprises:
1) Extracting or releasing nucleic acid of a sample to be tested;
2) Amplifying using the composition of any one of claims 1 to 6 to obtain an amplified product;
3) Processing the amplified products and establishing a library; and
4) Sequencing and analyzing the result.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202311124538.9A CN117089653A (en) | 2023-09-01 | 2023-09-01 | Compositions for RNA virus detection based on high throughput amplicon sequencing |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202311124538.9A CN117089653A (en) | 2023-09-01 | 2023-09-01 | Compositions for RNA virus detection based on high throughput amplicon sequencing |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN117089653A true CN117089653A (en) | 2023-11-21 |
Family
ID=88775215
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202311124538.9A Pending CN117089653A (en) | 2023-09-01 | 2023-09-01 | Compositions for RNA virus detection based on high throughput amplicon sequencing |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN117089653A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117867180A (en) * | 2024-03-12 | 2024-04-12 | 北京雅康博生物科技有限公司 | Primer combination, kit and application for detecting respiratory tract pathogens |
-
2023
- 2023-09-01 CN CN202311124538.9A patent/CN117089653A/en active Pending
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117867180A (en) * | 2024-03-12 | 2024-04-12 | 北京雅康博生物科技有限公司 | Primer combination, kit and application for detecting respiratory tract pathogens |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP5367078B2 (en) | Improved lysis and reverse transcription for mRNA quantification | |
| CN107475252B (en) | Nucleic acid releasing agent, method for rapidly releasing nucleic acid and application thereof | |
| CN117089653A (en) | Compositions for RNA virus detection based on high throughput amplicon sequencing | |
| CN113201594A (en) | Method for rapidly detecting food-borne Burkholderia gladioli | |
| CN116287357A (en) | Respiratory tract pathogenic bacteria detection kit based on targeted amplicon sequencing | |
| Yin et al. | Visual detection of duck tembusu virus with CRISPR/Cas13: a sensitive and specific point-of-care detection | |
| US20210363517A1 (en) | High throughput amplification and detection of short rna fragments | |
| WO2011146942A1 (en) | Methods and kits to analyze microrna by nucleic acid sequencing | |
| CN116042927B (en) | CRISPR-Cas13 system for detecting novel coronaviruses, kit and method thereof | |
| CN112410465A (en) | Novel coronavirus SARS-CoV-2ORF1ab and N gene constant temperature amplification primer group and kit | |
| CN115896356A (en) | Reagent for detecting nucleic acid of novel coronavirus, influenza A virus and influenza B virus and application of reagent | |
| CN115029345A (en) | Nucleic acid detection kit based on CRISPR and application thereof | |
| CN113444835A (en) | 2019 novel coronavirus N gene detection primer group, constant-temperature fluorescence detection kit and method | |
| CN111074002A (en) | Probe for EBV detection and detection method | |
| CN112680794A (en) | Ultramicro nucleic acid sample library building method applied to NGS platform | |
| CN112359143A (en) | Isothermal index amplification method based on Y-type probe set and application thereof | |
| CN117305495A (en) | Compositions for fungal detection based on high throughput amplicon sequencing | |
| CN117070647A (en) | Compositions for pathogen detection based on high throughput amplicon sequencing | |
| CN117144031A (en) | Composition for gram-negative bacterial detection based on high throughput amplicon sequencing | |
| CN116463398B (en) | Specific probe set combined with chicken ribosomal RNA and application thereof | |
| CN117025836A (en) | Novel coronavirus primer probe combination, detection kit and application | |
| Ruiz-Ojeda et al. | RNA Analyses | |
| CN113293200B (en) | Method for reducing or eliminating amplification product pollution in next generation sequencing and application | |
| CN112553378B (en) | Reagent and kit for detecting 2019-nCoV and application | |
| CN116103443A (en) | Primer group and kit for CRISPR (clustered regularly interspaced short palindromic repeats) detection of PRRSV (porcine reproductive and respiratory syndrome virus) lineage 1C variant and detection method of primer group and kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |