CN106636133A - Corn specific transport magnesium ion gene ZmMGT10 under low-magnesium condition and application thereof - Google Patents
Corn specific transport magnesium ion gene ZmMGT10 under low-magnesium condition and application thereof Download PDFInfo
- Publication number
- CN106636133A CN106636133A CN201611214392.7A CN201611214392A CN106636133A CN 106636133 A CN106636133 A CN 106636133A CN 201611214392 A CN201611214392 A CN 201611214392A CN 106636133 A CN106636133 A CN 106636133A
- Authority
- CN
- China
- Prior art keywords
- magnesium
- zmmgt10
- under
- conditions
- low
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
Abstract
The invention relates to the field of plant gene engineering, in particular to a corn specific transport magnesium ion gene ZmMGT10 under a low-magnesium condition and application thereof. The nucleotide sequence of the ZmMGT10 is disclosed in SEQ ID NO:1. According to the corn specific transport magnesium ion gene ZmMGT10 under the low-magnesium condition, specific expression is carried out under low magnesium concentration, low magnesium affects the normal growth of plants, and therefore, the ZmGT10 gene has a capability of enhancing the low magnesium stress resistance of the plant.
Description
Technical field
The present invention relates to plant genetic engineering field, and in particular to unitransport magnesium ion gene under the conditions of the low magnesium of corn
ZmMGT10 and its application.
Background technology
Significantly, MGT1 is positioned at plasma membrane to MGT families function difference in arabidopsis, and MGT2 is positioned at vacuole in arabidopsis
Film, MGT10 is positioned at chloroplaset, is high-affinity；MGT3 is positioned at tonoplast, and MGT7 is positioned at endoplasmic reticulum, is low parent
And property；It is double compatibilities and MGT5 is positioned at mitochondria, MGT7 is expressed in root, yet there are no report from corn
MGT10 genes.
The content of the invention
It is an object of the invention to provide unitransport magnesium ion gene ZmMGT10 under the conditions of the low magnesium of corn.
What another object of the present invention was to provide unitransport magnesium ion gene ZmMGT10 under the conditions of the low magnesium of corn should
With.
Unitransport magnesium ion gene ZmMGT10 under the conditions of the low magnesium of corn of the invention, its nucleotide sequence is such as
SEQ ID NO：Shown in 1.
SEQ ID NO：1
TATGGGGAGGTTATCGGGAAGCGGGTCCAGGAAGCCGCCTCCCTTCCTCTCGCCCTCCTCATCATTCTC
CTCCTCGTCGTACTCCAAGCGCTCCCGCACTGTTCGGCGCCTCCCGTCGCTGCCCAGGCCGCCTCTCGCGCCGCCGG
CGCCGCACCCCGCTGGGAGGACGAGGAGGAGGAAGGCACCCACCCGGCTGTGGATGAGGATGGATCGGTGGGGCAGG
TGCGAGGTGTTCATGACTAACGGGGCCTTCGTCGCGGAACGCTCCGGGGTGCACGCGCGCGACCTGCGCATCGTTGG
GCCCCTTCTCTCTCGCTGCCCCGGCATCCTCGCTCGAGAGAAGGCCATGGTAATCAATCTAGAGTTCATAAGAGCTA
TTGTAACTGCGGACGAAGTCCTGCTGCTGGAACCTCTTGCTCAGGAGGTTATCCCTTTCATCGATAAATTGAGGCGG
CATTTTCCATTGAAGAGCCTGGAGGTTGATGTTGGGGCCACACAAGTGGGTAATGTGAATGGCAAGCATGCTAAAAC
TGGTGCAGAGTGTGAGCTCCCCCTCCCCTTTGAGTTTCAGGTGTTGGAGCTCGCCCTAGAAGCTGTATGCTTGTCAT
TTCATTCAAGCCTATCTGATCTGAATAGGCACACCATCTTTGTGATGGATGAGTTGACTAAGAATGTGAGCACCAGG
AATCTTGAACGTGTTCGAAGTCTGAAAAGAAATCTAACCTCCCTGCTCGCTGGTGTGCAAAAGGTCAGAGATGAAGT
AGAGCATCTTTTGGATCATAATGAGAATATGGCACAACTGCACCTATCCAGGAAGCAAATAAAATGTCCGCAGGATG
AAATTCTACTGGCTTCTGCTGCTTTAAATAGCAATCTTCCTTCAAAAACAAAGCTGGGTACACCAAATTCTGTTGTT
AACCAAGCCATGGGCATTGCTATGACTGCGCCACTGGCCGACAATGTAGGAGACCTAGAGATATTACTTGAATCTTA
TTTCATGCAGCTGGATGGAATTCGCAACAGAATTATGATGGTCCGAGGATATATTGTTGACACAGAAGACTACATCA
ACATACAACTTGACAACCAACGCAATGAACTCATTCAGTTCCATCTTGTACTGATCATTGTATCATTTGGCATAGCT
ATGAACACATTGATAGCTGGAGCGTTTGCCATGAACATGCCTCACAATGGGGAGATGAAGAAGTTTGTAGGCCCGTT
TTGGCCATTTGTTGGGGCCACATCATCTTTCTGCTTGTTGGTCAGCGTTGTTTTACTGGGATATGCAAGGGGGAACA
GGCTACTTGGCAGTTGA
The invention provides ZmMGT10 under low magnesium density mediated plant root to Mg2+Absorption strengthening plant to low magnesium
The resistance of stress.
Specific embodiment of the invention, there is provided comprising unitransport magnesium ion under the conditions of the low magnesium of above-mentioned corn
The recombinant expression carrier of gene ZmMGT10.
Specific embodiment of the invention, there is provided comprising unitransport magnesium ion under the conditions of the low magnesium of above-mentioned corn
The recombinant cell lines of gene ZmMGT10.
Specific embodiment of the invention, there is provided unitransport magnesium ion gene under the conditions of the low magnesium of above-mentioned corn
The application of ZmMGT10, is particularly useful for strengthening the application of the low magnesium stress of plant resistant.
Unitransport magnesium ion gene ZmMGT10 under the conditions of the low magnesium of corn of the invention, it is special under low magnesium density
Opposite sex expression, and low magnesium have impact on the normal growth of plant, therefore ZmMGT10 genes have the low magnesium stress of enhancing plant resistant
Ability.
Description of the drawings
Fig. 1 shows the expression pattern of ZmMGT10 genes, wherein, ZmMGT10 supplies (+Mg) in magnesium and magnesium lacks (- Mg) and exists
Expression pattern in root, stem and leaf；The B.ZmMGT10 expression responses that to external world magnesium lacks.
Fig. 2 shows and shows that ZmMGT10 has complementary functions the upgrowth situation of MM281 mutant bacteria strains.
Fig. 3 shows that wild type material and the low magnesium of transgenic line coerce phenotype, wherein, A. wild types material and transgenosis material
Growth phenotype of the material under the conditions of normal and low magnesium；B. the master of wild type material and transgenic line under the conditions of normal and low magnesium
Root length；C. the biomass of wild type material and transgenic line under the conditions of normal and low magnesium；D. wild type material and base is turned
Because of chlorophyll concentration of the material under the conditions of normal and low magnesium.
Fig. 4 shows different external sources Mg2+The Mg of wild section bar material and transgenic line in root and the tip under process2+Content, its
In, Mg in A. roots2+Mg in the content B. tip2+Content.
Fig. 5 shows the Mg of wild type and transfer-gen plant2+Absorb, wherein, the time dependent wild types of A. and transgenosis are planted
The Mg of strain2+Absorb；B. the wild type of concentration dependant and turn because of the Mg of plant2+Absorb.
Specific embodiment
Embodiment 1
1st, the clone of corn ZmMGT10 genes
Select full corn seed to sterilize and clean up, then germinate and grow seedlings.Bian is public with Invitrogen
The Trizol reagents of department's production extract RNA, using the first chain reverse transcription reagent box (1st of PrimeScript II of Takara companies
Strand cDNA Synthesis Kit) carry out reverse transcription the first chain cDNA of synthesis.With synthesize the first chain cDNA as template,
CDS sequence (the primer sequences of PCR amplification genes：forward：5’-ATGGGGAGGTTATCGGGAAG-3’；reverse：5’-
TCAACTGCCAAGTAGCCTGTTC-3’).Clone's genes of interest, and sequence verification.
2nd, the expression pattern of corn ZmMGT10 genes
Fig. 1 shows the expression pattern of ZmMGT10 genes, wherein, " A " is under the conditions of ZmMGT10 is+Mg in magnesium supply
Expression pattern, " B " is the expression pattern under magnesium shortage i.e.-Mg is adjusted in root, stem and leaf.As shown in the A of Fig. 1, ZmMGT10 genes
It is main to express in root, not express in stem and leaf or ultralow expression, external world Mg is received in expression of the ZmMGT10 genes in root2+Lack
Weary induced strong.The Mg as shown in the B of Fig. 12+Shortage has raised the expression of ZmMGT10 genes, and the expression of ZmMGT10 is in 24h
Peak value is reached, expression almost compares 6 times of 0h, and the expression of subsequent ZmMGT10 starts to reduce.Additionally, working as Mg2+At shortage
The plant of reason 24h hours recovers Mg again2+After supply 24h, when expressions of the ZmMGT10 in root has been returned nearly to control 0h
Level.Result shows shown in Fig. 1, and ZmMGT10 is a root-specific expressing gene, and its expression has responded the early stage external world
Mg2+Lack.
3rd, ZmMGT10 has magnesium ion turn-over capacity
In order to determine whether ZmMGT10 albumen has Mg2+Turn-over capacity, constructs prokaryotic expression carrier pTrc99A::
ZmMGT10, and by itself and pTrc99A empty carriers, pTrc99A::AtMGT1 recombinant plasmid vectors proceed to respectively Salmonella typhimurium
In Mg containing variable concentrations in bacterium MM281 mutant strains2+1 × N-minimal solid mediums on carry out function reasonableness, its
Middle CorA, MgtA/MgtB, MgtE gene inactivation, it is impossible to less than 10mM Mg2+Under the conditions of grow.Fig. 2 shows ZmMGT10 work(
The upgrowth situation of energy complementation MM281 mutant bacteria strains.As shown in the A in Fig. 2, as negative control MM281 and turn pTrc99A
The MM281 bacterial strains of empty carrier are less than 10mM Mg2+Culture medium on can not grow, and turn pTrc99A::AtMGT1 is used as the positive
The MM281 bacterial strains of control are in Mg2+Growing state on concentration as little as 0.1mM culture mediums and other high concentrations Mg2+Under the conditions of life
Long situation no significant difference；Turn pTrc99A::ZmMGT10 bacterial strains can be less than 0.1mM Mg2+Under the conditions of recover MM281 bacterial strains
Growth defect, but its recovery capability will substantially be weaker than AtMGT1.For further checking flat-plate experimental result, MM281 monitored, turned
PTrc99A empty carriers, pTrc99A::ZmMGT10 and pTrc99A::The MM281 of AtMGT1 is in Mg containing variable concentrations2+1 × N-
Growing state in minimal fluid nutrient mediums.As a result the growth as shown in the B in Fig. 2, in different strains liquid medium within
Situation is consistent with flat board cultivation results.These results indicate that ZmMGT10 is a magnesium ion transport protein, with transhipment magnesium from
The ability of son.
4th, overexpression ZmMGT10 enhances the tolerance that transgenic arabidopsis lack to magnesium
Screen and turn 35S:After the arabidopsis positive of ZmMGT10 genes, wild type and T1 are carried out for transgenic arabidopsis
Phenotypic Observation experiment under the conditions of low magnesium.Fig. 3 shows that wild type material and the low magnesium of transgenic line coerce phenotype.Will be in MS
The wild type of two weeks is grown on culture medium and the MS culture mediums of kanamycins containing 50mg/L and transgenic arabidopsis seedling is transferred to entirely
Nutrient solution, cultivates 3 days, wherein, pancebrin MgSO containing 2mM4.7H2O, subsequent bi-material is respectively divided into two groups, is containing respectively
2mM MgSO4.7H2O (+Mg) and MgSO containing 0.01mM4.7H2Phenotype is observed after 3 weeks are cultivated in the nutrient solution of O (- Mg).As a result
As shown in the A in Fig. 3, without obvious between regular culture conditions Wildtype Arabidopsis thaliana under plant and transgenic Arabidopsis plants
Phenotypic difference, and under the conditions of low magnesium, the growth of WT lines is slightly weaker than genetically modified plants, and WT lines occur in that the heart
The typical plant magnesium element that leaf turns yellow lacks symptom.Additionally, the plant of the wild type and transgenic line under normal growing conditions
Strain size slightly larger than plant under the conditions of low magnesium size, and the color of the leaf also slightly green color in low magnesium rod part plant leaves.
The main root length of bi-material is further measured, as a result as shown in the B in Fig. 3, under low magnesium growth conditions, WT lines
Main root length be significantly shorter than transfer-gen plant main root it is long；And under normal growing conditions, the main root length of WT lines and turn
The long no significant difference of main root of gene plant.Additionally, the main root length of the bi-material under normal growing conditions is considerably longer than
The main root of bi-material is long under low magnesium growth conditions.Biomass analysis show, under low magnesium growth conditions, WT lines it is fresh
Again significantly lower than the fresh weight of transfer-gen plant；And under normal growing conditions, the fresh weight of WT lines and transfer-gen plant
Fresh weight no significant difference.As shown in the C in Fig. 3, equally, the fresh weight of the bi-material under normal growing conditions obviously higher than
The fresh weight of bi-material under low magnesium growth conditions.Leaf chlorophyll concentration analysis show, under low magnesium growth conditions, wild type is planted
Chlorophyll concentration of the chlorophyll concentration of strain blade significantly lower than rotaring gene plant blade；And under normal growing conditions, it is wild
No significant difference between the chlorophyll concentration of type plant leaf and the chlorophyll concentration of rotaring gene plant blade.Additionally, as in Fig. 3
Shown in D, the leaf chlorophyll concentration of the bi-material under normal growing conditions is above bi-material under low magnesium growth conditions
Leaf chlorophyll concentration.These results indicate that low magnesium have impact on the normal growth of plant, ZmMGT10 genes have strengthens plant
Resist the ability of low magnesium stress.
5th, overexpression ZmMGT10 increases magnesium ion accumulation under the conditions of the low magnesium of transgenic arabidopsis
In order to further explore the ZmMGT10 transgenic Arabidopsis plants under the conditions of low magnesium there is higher energy for growth to be
It is no that there is higher Mg with it2+Content is relevant, have detected bi-material complete stool under normal growing conditions and low magnesium growth conditions,
Upper part, the Mg contents of root.By grow on MS culture mediums and the MS culture mediums of kanamycins containing 50mg/L two weeks wild type and
Transgenic arabidopsis seedling is transferred to pancebrin culture 3 days, pancebrin MgSO containing 2mM4.7H2O, subsequent bi-material is each
It is divided into two groups, respectively in MgSO containing 2mM4.7H2O (+Mg) and MgSO containing 0.01mM4.7H23 are cultivated in the nutrient solution of O (- Mg)
Root and the tip are harvested after week is used for Mg2+Content detection.Fig. 4 shows different external sources Mg2+Wild section bar material and transgenic line under process
Mg in root and the tip2+Content.As shown in figure 4, in 2mM Mg2+Under growth conditions, the root and the tip of wild type and transfer-gen plant
In Mg2+Content no significant difference.However, working as under 0.01mM growth conditions, Mg of all plant in root and the tip2+Content
Significantly lower than the Mg in root and the tip under normal growing conditions2+Content, but transfer-gen plant root and the Mg in the tip2+Content is bright
Aobvious is higher than WT lines.These results indicate that under low magnesium growth conditions, ZmMGT10 transgenic Arabidopsis plants have more
Strong energy for growth accumulates more Mg with it than WT lines2+Relevant, ZmMGT10 has mediated under the conditions of low magnesium root to external world
Mg2+Absorption.
6th, overexpression ZmMGT10 increases absorption of the root to magnesium ion under the low magnesium of transgenic arabidopsis
Due to the Mg in plant2+Mainly transported into plant body from after extraneous absorption by magnesium ion transport protein,
And content of magnesium measurement result shows, transgenic line content of magnesium is apparently higher than wild type material, explanation under low magnesium growth conditions
ZmMGT10 has mediated root Mg to external world under the conditions of low magnesium2+Absorption, transfer-gen plant has higher Mg than WT lines2+
Absorbability.Test WT lines and transgenic line, for Mg2+Intake analysis.For time dependent Mg2+Intake point
Analysis, Jing Mg2+The wild type and transfer-gen plant of Nature enemy is comprising 0.01mM and 2mM MgSO4.7H2Cultivate in O nutrient solutions
10th, 30,60,120,180,240min, harvesting root is used for Mg2+Assay.For the Mg of concentration dependant2+Intake analysis, Jing Mg2 +The wild type and transfer-gen plant of Nature enemy comprising 0,0.01,0.05,0.1,0.5,1,2,3mM MgSO4.7H2O nutrition
2h is cultivated in liquid, harvesting root is used for Mg2+Assay.Fig. 5 shows the Mg of wild type and transfer-gen plant2+Absorb.Time according to
Bad Mg2+Intake analysis result is as shown in figure 5, in 2mM Mg2+Under growth conditions, WT lines and transfer-gen plant have
Similar Mg2+Accumulation pattern, and in 0.01mM Mg2+Under the conditions of, wild type and transfer-gen plant Mg2+Accumulation is significantly lower than
The Mg of plant under the conditions of 2mM2+Accumulation, but the Mg of transfer-gen plant2+Accumulation showed table apparently higher than WT lines
Up to ZmMGT10 arabidopsis root is enhanced under the conditions of low magnesium to Mg2+Absorption.The Mg of concentration dependant2+Intake analysis result such as Fig. 5
It is shown, under the conditions of low magnesium density, the Mg of transfer-gen plant2+Uptake ratio apparently higher than WT lines, but in high magnesium density bar
Under part, the Mg of bi-material2+Uptake ratio no significant difference, show ZmMGT10 be under low magnesium density mediated plant root to Mg2+
Absorption.All these results show that ZmMGT10 is by the mediated plant root under low magnesium density to Mg2+Absorption strengthening plant
The resistance that thing is coerced low magnesium.
<110>Sichuan Agricultural University
<120>Unitransport magnesium ion gene ZmMGT10 and its application under the conditions of the low magnesium of corn
<160> 1
<210> 1
<211> 1318
<212> DNA
<213>Streptomycete
<400> 1
tatggggagg ttatcgggaa gcgggtccag gaagccgcct cccttcctct cgccctcctc 60
atcattctcc tcctcgtcgt actccaagcg ctcccgcact gttcggcgcc tcccgtcgct 120
gcccaggccg cctctcgcgc cgccggcgcc gcaccccgct gggaggacga ggaggaggaa 180
ggcacccacc cggctgtgga tgaggatgga tcggtggggc aggtgcgagg tgttcatgac 240
taacggggcc ttcgtcgcgg aacgctccgg ggtgcacgcg cgcgacctgc gcatcgttgg 300
gccccttctc tctcgctgcc ccggcatcct cgctcgagag aaggccatgg taatcaatct 360
agagttcata agagctattg taactgcgga cgaagtcctg ctgctggaac ctcttgctca 420
ggaggttatc cctttcatcg ataaattgag gcggcatttt ccattgaaga gcctggaggt 480
tgatgttggg gccacacaag tgggtaatgt gaatggcaag catgctaaaa ctggtgcaga 540
gtgtgagctc cccctcccct ttgagtttca ggtgttggag ctcgccctag aagctgtatg 600
cttgtcattt cattcaagcc tatctgatct gaataggcac accatctttg tgatggatga 660
gttgactaag aatgtgagca ccaggaatct tgaacgtgtt cgaagtctga aaagaaatct 720
aacctccctg ctcgctggtg tgcaaaaggt cagagatgaa gtagagcatc ttttggatca 780
taatgagaat atggcacaac tgcacctatc caggaagcaa ataaaatgtc cgcaggatga 840
aattctactg gcttctgctg ctttaaatag caatcttcct tcaaaaacaa agctgggtac 900
accaaattct gttgttaacc aagccatggg cattgctatg actgcgccac tggccgacaa 960
tgtaggagac ctagagatat tacttgaatc ttatttcatg cagctggatg gaattcgcaa 1020
cagaattatg atggtccgag gatatattgt tgacacagaa gactacatca acatacaact 1080
tgacaaccaa cgcaatgaac tcattcagtt ccatcttgta ctgatcattg tatcatttgg 1140
catagctatg aacacattga tagctggagc gtttgccatg aacatgcctc acaatgggga 1200
gatgaagaag tttgtaggcc cgttttggcc atttgttggg gccacatcat ctttctgctt 1260
gttggtcagc gttgttttac tgggatatgc aagggggaac aggctacttg gcagttga 1318
Claims (5)
1. unitransport magnesium ion gene ZmMGT10 under the conditions of the low magnesium of corn, it is characterised in that its nucleotide sequence such as SEQ
ID NO：Shown in 1.
2. comprising under the conditions of the low magnesium of corn described in claim 1 unitransport magnesium ion gene ZmMGT10 it is recombinant expressed
Carrier.
3. comprising the recombinant cell of unitransport magnesium ion gene ZmMGT10 under the conditions of the low magnesium of corn described in claim 1
System.
4. the application of unitransport magnesium ion gene ZmMGT10 under the conditions of the low magnesium of corn described in claim 1.
5. unitransport magnesium ion gene ZmMGT10 is supported for strengthening plant under the conditions of the low magnesium of corn described in claim 1
The application of anti-low magnesium stress.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611214392.7A CN106636133A (en) | 2016-12-26 | 2016-12-26 | Corn specific transport magnesium ion gene ZmMGT10 under low-magnesium condition and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611214392.7A CN106636133A (en) | 2016-12-26 | 2016-12-26 | Corn specific transport magnesium ion gene ZmMGT10 under low-magnesium condition and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106636133A true CN106636133A (en) | 2017-05-10 |
Family
ID=58827883
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201611214392.7A Withdrawn CN106636133A (en) | 2016-12-26 | 2016-12-26 | Corn specific transport magnesium ion gene ZmMGT10 under low-magnesium condition and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106636133A (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101442902A (en) * | 2004-12-21 | 2009-05-27 | 孟山都技术有限公司 | Transgenic plants with enhanced agronomic traits |
| CN102199600A (en) * | 2010-03-26 | 2011-09-28 | 中国科学院上海生命科学研究院 | Gene for adjusting vein color and application thereof |
| CN102943088A (en) * | 2012-10-23 | 2013-02-27 | 天津耀宇生物技术有限公司 | Silkworm membrane magnesium transport protein Bm-MMgT expression and purification method |
| CN104293817A (en) * | 2013-07-15 | 2015-01-21 | 重庆大学 | Construction methods and uses of recombinant plasmid for producing succinic acid, and genetic engineering bacterium |
| WO2016023844A1 (en) * | 2014-08-11 | 2016-02-18 | Evolva Sa | Production of steviol glycosides in recombinant hosts |
-
2016
- 2016-12-26 CN CN201611214392.7A patent/CN106636133A/en not_active Withdrawn
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101442902A (en) * | 2004-12-21 | 2009-05-27 | 孟山都技术有限公司 | Transgenic plants with enhanced agronomic traits |
| CN102199600A (en) * | 2010-03-26 | 2011-09-28 | 中国科学院上海生命科学研究院 | Gene for adjusting vein color and application thereof |
| CN102943088A (en) * | 2012-10-23 | 2013-02-27 | 天津耀宇生物技术有限公司 | Silkworm membrane magnesium transport protein Bm-MMgT expression and purification method |
| CN104293817A (en) * | 2013-07-15 | 2015-01-21 | 重庆大学 | Construction methods and uses of recombinant plasmid for producing succinic acid, and genetic engineering bacterium |
| WO2016023844A1 (en) * | 2014-08-11 | 2016-02-18 | Evolva Sa | Production of steviol glycosides in recombinant hosts |
Non-Patent Citations (3)
| Title |
|---|
| HONGYOU LI ET AL.: "Identification, and Functional and Expression Analyses of the CorA/MRS2/MGT-Type Magnesium Transporter Family in Maize", 《PLANT & CELL PHYSIOLOGY》 * |
| NONE: "ACCESSION NO：XM_008652605，PREDICTED: Zea mays putative magnesium transporter MRS2-H (LOC103631689), transcript variant X2, mRNA", 《GENBANK》 * |
| 熊英杰 等: "缺镁胁迫对玉米幼苗生长和离子平衡的影响", 《井冈山大学学报（自然科学版）》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102498125A (en) | Regulation of zinc deficiency and tolerance in plants | |
| CN109694872A (en) | The method of controlling gene expression | |
| CN105420248A (en) | Anthocyanin controlling gene PyMYB10.2 and application thereof | |
| CN104592373B (en) | MYB28 albumen and its encoding gene are in regulation and control plant to the application in ABA tolerances | |
| CN107827964A (en) | A kind of transcription factor PwNAC2 related to plant stress tolerance and its encoding gene and application | |
| CN102532287B (en) | Stress-resistant protein PpLEA3-17 of bryophyte as well as encoding gene and application thereof | |
| CN1769463A (en) | Method for promoting salt and drought tolerance of maize and wheat by combining betA,NHX1,PPase gene and transgene technology | |
| CN101096681A (en) | Improving salt tolerance capacity by employing rice protein kinase gene OsCIPK15 | |
| Brumbley et al. | Sugarcane | |
| CN104830899A (en) | Cultivation method of strong salt-tolerant and drought-resistant sugarbeet | |
| CN109879944A (en) | One kind EAR1 albumen relevant to plant drought resistance and its encoding gene and application | |
| CN105367644A (en) | Plant stress tolerance associated transcription factor, encoding gene of plant stress tolerance associated transcription factor, and application of encoding gene | |
| CN113322261B (en) | Application of soybean ABC transporter gene GmALS3 in breeding of low-phosphorus-resistant and aluminum-toxicity-resistant plants | |
| CN105837671B (en) | Obtained from the flavonols modulin MsMYB22 and its encoding gene of functional form apple and application | |
| CN102732528A (en) | Application of OXHS 4 gene in controlling drought resistance of paddy rice | |
| CN107652360A (en) | The application of ABI5 albumen and its encoding gene in vegetable seeds oxidative stress resistance is regulated and controled | |
| CN101948870B (en) | Method for reducing branch quantity of plant and improving chlorophyll and anthocyanin contents of plant | |
| Li et al. | Analysis of physiological characteristics of abscisic acid sensitivity and salt resistance in Arabidopsis ANAC mutants (ANAC019, ANAC072 and ANAC055) | |
| CN105802931A (en) | CRK4 protein and application of coded gene thereof in regulating and controlling growth of plant stems and leaves | |
| CN107266543B (en) | Stress-resistance associated protein IbRAP2-12, and coding gene and application thereof | |
| CN106636133A (en) | Corn specific transport magnesium ion gene ZmMGT10 under low-magnesium condition and application thereof | |
| CN107630021A (en) | The albumen and application of asparagus resistant gene of salt AoSOS2 and its coding | |
| CN105713078B (en) | Application of the drought resistant correlative protein in regulation plant drought resistance | |
| CN104861051B (en) | Plant development associated protein AtUBP15 and its encoding gene and application | |
| El-Hendawy et al. | Adaptive traits associated with tolerance to flash flooding during emergence and early seedling growth stages in rice |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WW01 | Invention patent application withdrawn after publication |
Application publication date: 20170510 |
|
| WW01 | Invention patent application withdrawn after publication |