CN106635840B - A kind of Aspergillus niger strain and its fermented Chinese gall herb and tea leaves that ferment generate the preparation method and application of new component - Google Patents
A kind of Aspergillus niger strain and its fermented Chinese gall herb and tea leaves that ferment generate the preparation method and application of new component Download PDFInfo
- Publication number
- CN106635840B CN106635840B CN201611257588.4A CN201611257588A CN106635840B CN 106635840 B CN106635840 B CN 106635840B CN 201611257588 A CN201611257588 A CN 201611257588A CN 106635840 B CN106635840 B CN 106635840B
- Authority
- CN
- China
- Prior art keywords
- glucose
- tri
- chinese gall
- tea leaves
- tea
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7024—Esters of saccharides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
Abstract
The present invention relates to preparation methods and application that Aspergillus niger strain and its fermentation fermented Chinese gall herb and tea leaves generate new component, solid fermentation can be effectively solved to be difficult to measure with Fermentation Process of Parameter, process control difficulties, the problem of fermented Chinese gall herb and tea leaves unstable quality, its solve technical solution be, utilize deposit number are as follows: the conversion ratio of the Aspergillus niger strain fermentation fermented Chinese gall herb and tea leaves tannin of CCTCC NO:M2016376 greatly improves, and provide specific technical data, foundation is provided for the quality control and standardization production of fermented Chinese gall herb and tea leaves, new component 2 is proved using cell model, 4, tri--O- nutgall acyl of 6--D-Glucose has anti-tumor activity, antineoplastic to develop new provides technical guarantee.
Description
Technical field
The present invention relates to technical field of microbial fermentation, and in particular to a kind of aspergillus niger and its fermentation fermented Chinese gall herb and tea leaves generate newly at
The preparation method and application divided.
Background technique
Fermented Chinese gall herb and tea leaves are Chinese gall with the fermented manufactured block such as tealeaves first recorded in " danxi's experiential therapy ".Nature and flavor acid is sweet,
It is flat.With moistening lung for removing phlegm, the effect of promoting the production of body fluid to quench thirst.Clinic is chiefly used in treating chronic cough abundant expectoration, pharyngalgia, hematochezia, proctoptosis with chronic dysentery, mouth
Sore, noma, carbuncle swells sore.Fermentation fermented Chinese gall herb and tea leaves mostly use compound bacteria solid state fermentation at present, due to compound bacteria bacterium during the fermentation
Kind variation it is unclear, and there is solid fermentation Fermentation Process of Parameter to be difficult to measure, process control difficulties, thalli growth, fermentation
And metabolite the deficiencies of being unevenly distributed in fermentation system, lead to that product stability is poor, repeatability is lower, gives fermented Chinese gall herb and tea leaves
Fermentation process make troubles, make fermented Chinese gall herb and tea leaves unstable quality.Content of tannin is reduced after Chinese gall fermentation becomes fermented Chinese gall herb and tea leaves, is not eaten
Sub- acid content increases, and one plant of dominant strain of breeding simultaneously studies its application in fermented Chinese gall herb and tea leaves fermentation, and will raisedization after fermentation
Component extraction separation, Structural Identification are learned, and the ingredient anti-tumor activity is studied, can preferably control the matter of fermented Chinese gall herb and tea leaves
Amount, provides foundation for fermented Chinese gall herb and tea leaves clinical application, guarantees that its clinical application is safe and effective.
Summary of the invention
For above situation, for the defect for solving the prior art, the purpose of the present invention is just to provide a kind of Aspergillus niger strain
And its fermentation fermented Chinese gall herb and tea leaves generate the preparation method and application of new component, and it is difficult with Fermentation Process of Parameter can effectively to solve solid fermentation
With measurement, process control difficulties, the deficiencies of thalli growth, fermentation and metabolite are unevenly distributed in fermentation system, cause
The problem of product stability is poor, repeatability is lower, makes troubles to the fermentation process of fermented Chinese gall herb and tea leaves, fermented Chinese gall herb and tea leaves unstable quality.
The technical solution that the present invention solves is Aspergillus niger strain of the present invention, and classification naming is aspergillus
(Aspergillus sp.) BYJ.H-1, is preserved in China typical culture collection center on July 5th, 2016, and preservation is compiled
Number are as follows: CCTCC NO:M2016376, preservation address: Bayi Road No. 299 Wuhan Universitys in Wuhan City, Hubei Province Wuchang District are in the school, military
Chinese university collection.
Preparation method are as follows: collect fresh fermented Chinese gall herb and tea leaves, using dilution spread flat band method, use rose-bengal, potato respectively
3 kinds of culture mediums of glucose agar medium (PDA) and yeast extract, 28 DEG C of constant temperature incubations isolate 6 plants of strains of 2 categories, lead to
Everfermentation fermented Chinese gall herb and tea leaves apparent condition, liquid phase analysis, separation and screening are sent as an envoy to the highest aspergillus niger of gallic acid content in fermented Chinese gall herb and tea leaves
BYJ.H-1；The fermented Chinese gall herb and tea leaves are: Chinese gall medicinal material being cleaned, 80 DEG C of dry 4h, are crushed, crossed 80 meshes, take coarse tea leaf powder 1g
15min is decocted in 10-20mL boiling water, is put to 23-27 DEG C, tea grounds is filtered off, obtains tea juice, take tea grounds, 3mL tea juice and 10g above-mentioned
Gallnut extract mixes, with wetting eight layers of gauze sealing in 115 DEG C of sterilizing 30min, cool to get；
The rose bengal medium is by peptone 5g, glucose 10g, potassium dihydrogen phosphate 1g, magnesium sulfate
(MgSO4·7H2O) 0.5g, agar 20g, 1/3000 rose-bengal solution 100mL, distilled water 1000mL and chloramphenicol 0.1g system
At；
The potato dextrose agar be by: potato 200g, glucose 20g, agar 15-20g and from
Water 1000ml is made；
The yeast extract medium be by: yeast extract 5g, sucrose 10g, agar powder 14g in 1000ml distilled water, decoct
It boils to boiling, supplies volume.
Aspergillus niger strain fermentation fermented Chinese gall herb and tea leaves generate the preparation method of new component, comprising the following steps:
1) preparation of 4,6- tri--O- nutgall acyls-D-Glucose: new component 2 Chinese gall medicinal material are cleaned, 80 DEG C of dryings
4-10h is crushed, and is crossed 80 meshes, is taken coarse tea leaf powder 1g to decoct 15min in 20mL boiling water, put to 23-27 DEG C, is filtered off tea grounds, is obtained
Tea juice 5-10mL takes tea grounds, 3mL tea juice and the above-mentioned gallnut extract of 10g to mix, and is sterilized with eight layers of gauze sealing of wetting in 115 DEG C
30min is cooled, and obtains fermented Chinese gall herb and tea leaves softwood, spare；By Aspergillus niger strain in activating 3d on potato dextrose agar, take
50mL distilled water 121 DEG C of sterilizing 30min in 200mL conical flask, cool, and scrape 2-4 ring spore in sterilizing with the bamboo stick of sterilizing
10 are made in distilled water8The spore bacteria suspension of a/mL or more, 180r/min shake 2h, take the spore of gallnut extract weight 5-8%
Bacteria suspension is added in the fermented Chinese gall herb and tea leaves softwood handled well, after mixing evenly in 35-40 DEG C, 85% humidity fermentation 60-66h, dries,
Up to 2,4,6- tri--O- nutgall acyl of new component-D-Glucose, the potato dextrose agar is by Ma Ling
Potato removes the peel 200g stripping and slicing, boils to one and smashes i.e. rotten, filtering, filtrate adds glucose 20g, agar powder 15g to boil to boiling again, supply steaming
Distilled water is made to 1000mL；
2) tri--O- nutgall acyl of new component 2,4,6--D-Glucose isolates and purifies: taking 2,4,6- obtained above tri--
O- nutgall acyl-D-Glucose fine powder, 70 DEG C of water-baths, methanol extract 3 times, and filtering, filtrate is concentrated to dryness, is dissolved in water, and filter,
Macroporous resin column on filtrate, then methanol-water system elutions, specifically: first using water, 10% methanol (V/V), 20% methanol respectively
(V/V), 30% methanol (V/V), 50% methanol (V/V) gradient elution, 10% meoh eluate that will be obtained use diameter 20cm
C18 high pressure prepare liquid phase column, sample introduction 5L uses mobile phase acetonitrile: 0.2% formic acid=13:87, Detection wavelength 280nm, flow velocity
600ml/min carries out elution separation, obtains different component, respectively analysis detection；Tri--O- nutgall acyl-D- of 2,4,6- will be contained
The component of glucose prepares liquid phase column, sample volume 1.25L, by mobile phase acetonitrile: 0.2% first using the C18 high pressure of diameter 10cm
Acid=13:87, Detection wavelength 280nm, flow velocity 250ml/min further elute separation, and obtained component is carried out combining data detection,
Condensing crystallizing, 50 DEG C are dried under reduced pressure, and obtain 2,4,6- tri--O- nutgall acyl of purifying-D-Glucose.
2,4,6- tri--O- nutgall acyls-D-Glucose in the present invention is the noval chemical compound found for the first time, by using big
Hole resin column, preparation solution is isolated and purified with respect to aspergillus niger BYJ.H-1 fermentation fermented Chinese gall herb and tea leaves content increasing component, total using nuclear-magnetism
Vibration Meter and high-resolution mass spectrometer identify compound structure, obtain 2,4,6- tri--O- nutgall acyls-D-Glucose, the change
Closing object, there are two kinds of configurations of α and β, are demonstrate,proved using 2 kinds of cancer cells of Lung Adenocarcinoma A 549 Cell and human large cell lung cancer NCI-H460 cell
Bright tri--O- nutgall acyl of 2,4,6--D-Glucose has anti-tumor activity.
The present invention is greatly improved using the conversion ratio of the fermentation fermented Chinese gall herb and tea leaves tannin of aspergillus niger CCTCC M 2016376, and is provided
Specific technical data is provided foundation for the quality control and standardization production of fermented Chinese gall herb and tea leaves, is proved using cell model
2,4,6- tri--O- nutgall acyls-D-Glucose has anti-tumor activity, and the antineoplastic to develop new provides technical guarantee.
Detailed description of the invention
Fig. 1 is the phylogenetic tree of aspergillus niger CCTCC M 2016376 of the present invention.
Fig. 2 is the morphology photo of aspergillus niger CCTCC M 2016376 of the present invention.
Fig. 3 is the microphoto of aspergillus niger CCTCC M 2016376 of the present invention.
Fig. 4 is tri--O- nutgall acyl of 2,4,6--D-Glucose 7 of the present invention1H-NMR(acetone-d6) spectrum.
Fig. 5 is tri--O- nutgall acyl of 2,4,6--D-Glucose of the present invention13C-NMR(acetone-d6) spectrum.
Fig. 6 is tri--O- nutgall acyl of 2,4,6- of the present invention-D-Glucose DEPT135 spectrum.
Fig. 7 is tri--O- nutgall acyl of 2,4,6--D-Glucose of the present invention1H-1H COSY(acetone-d6) spectrum.
Fig. 8 is tri--O- nutgall acyl of 2,4,6--D-Glucose HSQC (acetone-d of the present invention6) spectrum.
Fig. 9 is tri--O- nutgall acyl of 2,4,6--D-Glucose HMBC (acetone-d of the present invention6) spectrum.
Figure 10 is tri--O- nutgall acyl of 2,4,6--D-Glucose high resolution mass spectrum figure of the present invention.
Figure 11 is A549 and NCI-H460 cellular morphology figure of the present invention.
Specific embodiment
Specific embodiments of the present invention will be described in further detail with reference to embodiments.
Aspergillus niger strain separating screening method:
Fresh fermented Chinese gall herb and tea leaves are collected, using dilution spread flat band method, use rose-bengal, potato dextrose agar culture respectively
3 kinds of culture mediums of base and yeast extract, 28 DEG C of constant temperature incubations isolate 6 plants of strains of 2 categories, by isolated strain (aspergillus bacterium
Strain HM1, HM2, HM3, HM5, HM7, saccharomycete YJ1) respectively at activating 3d on PDA, take 50ml distilled water in 200ml conical flask
121 DEG C of sterilizing 30min, cool, and scrape 2-4 ring spore in the distilled water of sterilizing with the bamboo stick of sterilizing and are made 108A/ml's or more
Spore bacteria suspension, 180r/min shake 2h, draw spore bacteria suspension 5ml and are added in fermented Chinese gall herb and tea leaves, are stirred with the glass bar of sterilizing equal
It is even to take out, dry in 30 DEG C, 85% humidity fermentation 60h, survey gallic acid content；
The fermented Chinese gall herb and tea leaves are: Chinese gall medicinal material being cleaned, 80 DEG C of dry 4h, are crushed, crossed 80 meshes, take coarse tea leaf powder 1g
It is placed in 10mL boiling water and decocts 15min, put to 25 DEG C, filter off tea grounds, tea juice volume is 8mL, is taken on tea grounds, 3ml tea juice and 10g
Gallnut extract mixing is stated, with eight layers of gauze sealing of wetting in 115 DEG C of sterilizing 30min, is cooled, it is spare；As a result it see the table below:
The appearance character of each strain fermentation fermented Chinese gall herb and tea leaves of table 1 describes and gallic acid content
Note: blank control: fermented Chinese gall herb and tea leaves softwood 115 DEG C of sterilizings 30min, 30 DEG C of fermentation 60h
In the specific implementation, Aspergillus niger strain fermentation fermented Chinese gall herb and tea leaves generate the preparation method of new component to the present invention, including following
Step:
1) preparation of 4,6- tri--O- nutgall acyls-D-Glucose: new component 2 Chinese gall medicinal material are cleaned, 80 DEG C of dryings
4h is crushed, and is crossed 80 meshes, is taken coarse tea leaf powder 1g to decoct 15min in 20mL boiling water, put to 23-27 DEG C, is filtered off tea grounds, is obtained tea
Juice 8mL takes tea grounds, 3mL tea juice and the above-mentioned gallnut extract of 10g to mix, is sealed with eight layers of gauze of wetting in 115 DEG C of sterilizing 30min,
It cools, obtains fermented Chinese gall herb and tea leaves softwood, it is spare；By Aspergillus niger strain in activating 3d on potato dextrose agar, 50mL is taken to steam
Distilled water 121 DEG C of sterilizing 30min in 200mL conical flask, cool, and scrape 2-4 ring spore in the distilled water of sterilizing with the bamboo stick of sterilizing
In be made 108The spore bacteria suspension of a/mL or more, 180r/min shake 2h, the spore bacteria suspension of gallnut extract weight 5% are taken to add
Enter in the fermented Chinese gall herb and tea leaves softwood handled well, after mixing evenly in 40 DEG C, 85% humidity fermentation 60h, dry to get new component 2,4,
Tri--O- nutgall acyl of 6--D-Glucose, through detecting, the content of gallic acid reaches 30.22%；
2) tri--O- nutgall acyl of new component 2,4,6--D-Glucose isolates and purifies: taking 2,4,6- obtained above tri--
O- nutgall acyl-D-Glucose fine powder, 70 DEG C of water-baths, methanol extract 3 times, and filtering, filtrate is concentrated to dryness, is dissolved in water, and filter,
AB-8 macroporous resin column on filtrate, methanol-water system elutions, specifically: first using water, 10% methanol (V/V), 20% first respectively
Alcohol, 30% methanol, 50% methanol elution gradient, 10% meoh eluate that will be obtained are prepared using the C18 high pressure of diameter 20cm
Liquid phase column, sample introduction 5L use mobile phase acetonitrile: 0.2% formic acid=13:87, Detection wavelength 280nm, flow velocity 600ml/min into
Row elution separation, obtains different component, respectively analysis detection；Tri--O- nutgall acyl of 2,4,6--D-Glucose is used by containing
Component prepares liquid phase column, sample volume 1.25L, by mobile phase acetonitrile: 0.2% formic acid=13:87 using the C18 high pressure of diameter 10cm
Detection wavelength 280nm, flow velocity 250ml/min further elute separation, by obtained component carry out combining data detection, condensing crystallizing,
50 DEG C are dried under reduced pressure, and obtain 2,4,6- tri--O- nutgall acyl of purifying-D-Glucose.
Embodiment 3
In the specific implementation, Aspergillus niger strain fermentation fermented Chinese gall herb and tea leaves generate the preparation method of new component to the present invention, including following
Step:
1) preparation of 4,6- tri--O- nutgall acyls-D-Glucose: new component 2 Chinese gall medicinal material are cleaned, 80 DEG C of dryings
8h is crushed, and is crossed 80 meshes, is taken coarse tea leaf powder 1g to decoct 15min in 20mL boiling water, put to 25 DEG C, is filtered off tea grounds, is obtained tea juice,
It takes tea grounds, 3mL tea juice and the above-mentioned gallnut extract of 10g to mix, with eight layers of gauze sealing of wetting in 115 DEG C of sterilizing 30min, cools,
Fermented Chinese gall herb and tea leaves softwood is obtained, it is spare；By Aspergillus niger strain in activating 3d on potato dextrose agar, take 50mL distilled water in
121 DEG C of sterilizing 30min, cool in 200mL conical flask, scrape 2-4 ring spore in the distilled water of sterilizing with the bamboo stick of sterilizing and are made
108The spore bacteria suspension of a/mL or more, 180r/min shake 2h, the spore bacteria suspension addition of gallnut extract weight 6% are taken to handle
In good fermented Chinese gall herb and tea leaves softwood, ferment 62h in the humidity of 38 DEG C, 85% after mixing evenly, it is dry to get new component 2,4,6- tri--
O- nutgall acyl-D-Glucose；
2) tri--O- nutgall acyl of new component 2,4,6--D-Glucose isolates and purifies: taking 2,4,6- obtained above tri--
O- nutgall acyl-D-Glucose fine powder, 70 DEG C of water-baths, methanol extract 3 times, and filtering, filtrate is concentrated to dryness, is dissolved in water, and filter,
Macroporous resin column on filtrate, then methanol-water system elutions, specifically: first using water, 10% methanol (V/V), 20% first respectively
Alcohol, 30% methanol, 50% methanol elution gradient, 10% meoh eluate that will be obtained are prepared using the C18 high pressure of diameter 20cm
Liquid phase column, sample introduction 5L use mobile phase acetonitrile: 0.2% formic acid=13:87, Detection wavelength 280nm, flow velocity 600ml/min into
Row elution separation, obtains different component, respectively analysis detection；Tri--O- nutgall acyl of 2,4,6--D-Glucose component will be contained
Liquid phase column, sample volume 1.25L, by mobile phase acetonitrile: 0.2% formic acid=13:87 detection are prepared using the C18 high pressure of diameter 10cm
Wavelength 280nm, flow velocity 250ml/min further elute separation, by obtained component carry out combining data detection, condensing crystallizing, 50 DEG C
It is dried under reduced pressure, obtains 2,4,6- tri--O- nutgall acyl of purifying-D-Glucose.
The present invention is classified identification to Aspergillus niger strain, and has carried out antitumor activity, phase to noval chemical compound
It is as follows to close experimental data:
One, the identification of aspergillus niger CCTCC M 2016376
For the taxonomy for further determining that CCTCC M 2016376, the present invention uses conventional sorting methods and molecule
Biological classification method is classified identification to the bacterial strain.
1 morphologic observation culture medium
Potato dextrose agar (PDA solid medium): peeling potatoes 200g stripping and slicing is boiled to one and is smash i.e.
Rotten, filtering, filtrate adds glucose 20g, agar powder 15g to boil to boiling again, supplies distilled water to 1000mL, be sub-packed in conical flask
In, it is subject to sterilization.
Rose bengal medium: rose bengal medium 35g adds distilled water 1000mL to decoct to boiling, supplies moisture extremely
1000mL.It is sub-packed in conical flask, it is subject to sterilization.
Sand protects weak culture medium (SDA culture medium): peptone 10g, glucose 40g, nutrient agar 14-15g, distilled water
1000mL。
The above culture is spare based on 121 DEG C of sterilizing 20min in autoclave sterilizer.
2 primers
It is synthesized using fungi universal primer by Shanghai Sheng Gong bioengineering Co., Ltd.Its sequence is respectively as follows: ITS 1 (5 '-
TCCGTAGGTGAACCTG CGG-3 ') and ITS 4 (5 '-TCCTCCGCTTATTGATATGC-3 ') to 5.8S-ITS section carry out
Amplification
3 test methods
3.1 morphological observation
3.1.1 colony morphological observation
A small amount of spore is taken with transfer needle, is inoculated in PDA culture medium, SDA culture medium and Meng respectively using 3 inocalation methods
Add and draw on red culture medium, is subsequently placed in 28 DEG C of constant incubators and cultivates, observe and describe strain colonial morphology in the medium
With growing state, and film recording (as shown in Figure 2) is done.
3.1.2 displaing microstructure observing
It need to identify that fungi is inoculated in coverslip and culture medium intersection using inserted sheet cultivation, make in mycelia growth course
It can be attached on coverslip, be placed in 28 DEG C of constant incubators and cultivate, be chosen coverslip with aseptic nipper daily from next day,
After lactic acid-cotton orchid dye liquor dyeing, it is placed in microscopically observation fungi structure (as shown in Figure 3).
The molecular biology identification of 3.2 aspergillus niger CCTCC M 2016376
3.2.1 the extraction of 2016376 genomic DNA of aspergillus niger CCTCC M
By the experimental strain of freezen protective in the upper 28 DEG C of activation 3d of solid PDA, activated strains are inoculated in liquid PDA culture
In base, 28 DEG C of shaking flask culture 48h after inspection is pollution-free, extract DNA, 2% Ago-Gel according to raw work kit specification
Electrophoresis detection DNA extracts quality, and DNA-20 DEG C of extraction is saved backup.
3.2.2 the amplification of 2016376 gene of aspergillus niger CCTCC M
Using the genomic DNA of above-mentioned preparation as the template of PCR amplification, with primer I TS 1 (5 '-
TCCGTAGGTGAACCTG CGG-3 ') and ITS 4 (5 '-TCCTCCGCTTATTGATATGC-3 ') in fungal genomic DNA
18S rDNA genetic fragment expanded.
The PCR reaction system of 50 μ L are as follows: Mix25 μ L, 3 μ L of DNA profiling, primer I TS 1 (10 μm of olL-1) μ L, ITS
(10 μm of olL-1) 4 μ L, 20 μ L of ddRnase water
PCR reaction condition are as follows: 94 DEG C of 4min of initial denaturation；94 DEG C of 30s are denaturalized, anneal 55 DEG C of 30s, extend 72 DEG C of 30s, 30 times
Circulation；72 DEG C of 8min of overall elongation.It is detected after the reaction was completed with 2% agarose gel electrophoresis.Qualified PCR product carries out sequence
Column measurement.
3.2.3 the comparison analysis of sequencing result
Sequencing result sequence is compared by BLAST with the strain sequence of the effective publication in GenBank database,
The 18S rDNA gene order for downloading the higher bacterial strain of effective publication of similarity, with MEGA5.03 software to sequence into the system of building
The row structure (as shown in Figure 1) for developing tree, determines the taxonomy of bacterial strain.
4 test results
The morphological observations of 4.1CCTCC M 2016376
Aspergillus niger strain CCTCC M 2016376 grows very fast spore brown or light brown on PDA, entire bacterium of tiling
Surface is fallen, more thick and heavy, edge white powder, it is light yellow that, which there is pigment at the back side,；
Bacterium colony is oval on SDA or similar round, and bacterium colony center white, surrounding brown or light brown spore are intensive,
Edge is sparse, pili yellow-white, there is gauffer sample texture, and there is yellow pigment generation at back side bacterium colony center, transparent, diameter about 61mm；
The round or similar round on rose-bengal, bacterium colony are in yellow, and light brown spore is unevenly distributed, and surrounding has radial
Texture, colony edge bacterium colony surface is light yellow, has radial texture, back side reddish yellow, diameter about 28mm.
2016376 mycelia of microscopic observation Aspergillus niger strain CCTCC M has every, multi-branched, conidiophore it is raw thin in foot
On born of the same parents, has verruca, sertoli cell hypertrophy is transparent, and top capsule is spherical, and the double-deck stigma, part is fertile, and conidium is spherical.
The molecular biology identification result of 4.2CCTCC M 2016376
4.2.1CCTCC the 18SrDNA sequencing results of M 2016376
The sequencing result segment obtains the 18S rDNA sequence of aspergillus niger CCTCC M 2016376 by 559 base compositions
Are as follows: GATCGACGCGGGTCTTTGGGCCACCTCCCATCCGTGTCTATTGTACCCTGTTGCTT CGGCGGGCCCGCCGCTT
GTCGGCCGCCGGGGGGGCGCCTCTGCCCCCCGGGCCCGTGCCCGCCGGAGACCCCAACACGAACACTGTCTGAAAG
CGTGCAGTCTGAGTTGATTGAATGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAG
AACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCC
CCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGTCGCCGT
CCCCCTCTCCGGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCA
CATGCTCTGTAGGATTGGCCGGCGCCTGCCGACGTTTTCCAACCATTCTTTCCAGGTTGACCTCGGATCAGGTAGG
The homologous chadogram building of GATACCCGCTGAACTTAAGCATATCAAAAA4.2.2
It is compared by BLAST, downloading and aspergillus niger 18S rDNA gene order similarity to be measured in GenBank database
Closer sequence carries out Multiple sequence alignments to aspergillus niger 18S rDNA gene order with MEGA5.0 software, constructs systematic growth
Tree.The measurement of two 2,4,6-, tri--O- nutgall acyl-D-Glucose content
By prepared by preparation method of the present invention 2,4,6- tri--O- nutgall acyls-D-Glucose, through detecting, gallic acid
Content reaches 30.22%.
Three 2,4,6-, tri--O- nutgall acyl-D-Glucose carries out nuclear magnetic resonance and Mass Spectrometer Method
Extracting waste powder 10mg, deuterated acetone dissolution, magnetic resonance detection obtain1H-NMR(acetone-d6),13C-
NMR(acetone-d6), DEPT135,1H-1H COSY(acetone-d6), HSQC (acetone-d6), HMBC (acetone-
d6) spectrum (as shown in attached drawing 4-9).It is appropriate to weigh white powder, methanol dissolution, high resolution mass spectrum detection molecules amount is (such as Figure 10 institute
Show).
Four 2,4,6-, tri--O- nutgall acyl-D-Glucose antitumor activity
Precision weighs 2,4,6- tri--O- nutgall acyls-D-Glucose 15.91mg, and addition DMSO (dimethyl sulfoxide) makes molten
Solution, be configured to the mother liquor of 1mmol/L, with complete culture solution be diluted to 100umol/L, 300umol/L, 500umol/L,
Medical fluid (containing 1%DMSO) filtration sterilization of 700umol/L, 900umol/L.
Precision weighs MTT (thiazolyl blue) powder about 100mg and is dissolved in 20mLPBS (phosphate buffered saline solution), filtration sterilization.
After the good NCI-H460 and A549 cell dissociation of growth conditions, A549 and NCI-H460 cellular morphology figure is as schemed
Shown in 11, it is outstanding that individual cells are made into the RPMI-1640 culture medium containing 10% fetal calf serum, 100U/mL mycillin mixed liquor
Liquid, with 1 × 105A ml-1For cell inoculation in 96 well culture plates, every hole 200ul is placed in 37 DEG C, 5%CO2In cell incubator
Culture for 24 hours, inhale and abandon old culture solution, every hole is added prepared medical fluid 200uL, parallel 5 hole of each concentration, culture for 24 hours, 48h,
After 72h, 96h, 20ulMTT liquid (5mg/ml) is added in every hole, continues to abandon supernatant after cultivating 4h, 150ulDMSO, oscillation is added in every hole
5min makes first a ceremonial jade-ladle, used in libation crystallization dissolution completely, each hole OD value is surveyed with microplate reader 492nm wavelength, with every group of each hole mean light absorbency OD value
Average value as each group OD, calculate as follows 2,4,6- tri--O- nutgall acyls-D-Glucose medical fluid to NCI-H460 and
The inhibiting rate of A549 cell: inhibiting rate (IR%)=(1- administration group OD mean value/blank control group OD mean value) × 100%.
The experimental results showed that 2,4,6- tri--O- nutgall acyls-D-Glucose concentration be 700umol/L48h to A549 and
NCI-H460 cell growth inhibition is most strong.
To sum up, the present invention is sent as an envoy to the highest aspergillus niger BYJ.H-1 of gallic acid content in fermented Chinese gall herb and tea leaves by separation and screening,
So that aspergillus niger CCTCC M 2016376 ferments, the conversion ratio of fermented Chinese gall herb and tea leaves tannin is greatly improved, and provides specific technique skill
Art parameter provides foundation for the quality control and standardization production of fermented Chinese gall herb and tea leaves, and 2,4, the 6- tri--O- of noval chemical compound found for the first time does not have
Infanticide acyl-D-Glucose, demonstrating 2,4,6- tri--O- nutgall acyls-D-Glucose using cell model has anti-tumor activity,
Antineoplastic to develop new provides foundation, has actual clinical meaning, is suitble to large-scale promotion and application.
SEQUENCE LISTING
<110>Henan university of TCM
<120>a kind of Aspergillus niger strain and its fermentation fermented Chinese gall herb and tea leaves generate the preparation method and application of new component
<130> 1
<160> 1
<170> PatentIn version 3.3
<210> 1
<211> 559
<212> DNA
<213>aspergillus niger
<400> 1
gatcgacgcg ggtctttggg ccacctccca tccgtgtcta ttgtaccctg ttgcttcggc 60
gggcccgccg cttgtcggcc gccggggggg cgcctctgcc ccccgggccc gtgcccgccg 120
gagaccccaa cacgaacact gtctgaaagc gtgcagtctg agttgattga atgcaatcag 180
ttaaaacttt caacaatgga tctcttggtt ccggcatcga tgaagaacgc agcgaaatgc 240
gataactaat gtgaattgca gaattcagtg aatcatcgag tctttgaacg cacattgcgc 300
cccctggtat tccggggggc atgcctgtcc gagcgtcatt gctgccctca agcccggctt 360
gtgtgttggg tcgccgtccc cctctccggg gggacgggcc cgaaaggcag cggcggcacc 420
gcgtccgatc ctcgagcgta tggggctttg tcacatgctc tgtaggattg gccggcgcct 480
gccgacgttt tccaaccatt ctttccaggt tgacctcgga tcaggtaggg atacccgctg 540
aacttaagca tatcaaaaa 559
Claims (2)
1. a kind of Aspergillus niger strain generates the application of 2,4,6- tri--O- nutgall acyls-D-Glucose, feature in fermentation fermented Chinese gall herb and tea leaves
Be, the Aspergillus niger strain classification naming be aspergillus (Aspergillus sp) BYJ.H-1 has been preserved in Chinese Typical Representative training
Support object collection, deposit number are as follows: CCTCC NO:M2016376；
The Aspergillus niger strain generates tri--O- nutgall acyl of 2,4,6--D-Glucose the preparation method comprises the following steps: 1) in fermentation fermented Chinese gall herb and tea leaves
The preparation of 2,4,6- tri--O- nutgall acyls-D-Glucose: Chinese gall medicinal material is cleaned, 80 DEG C of dry 4-10h, is crushed, and 80 mesh are crossed
Sieve, takes coarse tea leaf powder 1g to decoct 15 min in 20 mL boiling water, puts to 23-27 DEG C, filters off tea grounds, obtains tea juice 5-10mL, take tea
Slag, 3mL tea juice and the above-mentioned gallnut extract of 10g mix, and with eight layers of gauze sealing of wetting in 115 DEG C of 30 min of sterilizing, cool, obtain hundred
Medicine decocts softwood, spare；By Aspergillus niger strain in activating 3d on potato dextrose agar, take 50mL distilled water in
121 DEG C of sterilizing 30min, cool in 200mL conical flask, scrape 2-4 ring spore in the distilled water of sterilizing with the bamboo stick of sterilizing and are made
The spore bacteria suspension of 108/mL or more, 180r/min shake 2h, take at the spore bacteria suspension addition of gallnut extract weight 5-8%
In the fermented Chinese gall herb and tea leaves softwood managed, after mixing evenly in 35-40 DEG C, 85% humidity fermentation 60-66h, drying is to get 2,4,6- tri--
O- nutgall acyl-D-Glucose, the potato dextrose agar be by peeling potatoes 200 g strippings and slicings, boil to
One smashes i.e. rotten, and filtering, filtrate adds glucose 20g, agar powder 15g to boil to boiling again, supplies distilled water and is made to 1000mL；
2) tri--O- nutgall acyl of 2,4,6--D-Glucose isolates and purifies: the tri--O- galla turcica of 2,4,6- for taking step 1) to obtain
Acyl-D-Glucose fine powder, 70 DEG C of water-baths, methanol extract 3 times, and filtering, filtrate is concentrated to dryness, is dissolved in water, and filter, big on filtrate
Hole resin column, then methanol-water system elutions, specifically: first using water, 10% methanol, 20% methanol, 30% methanol, 50% first respectively
Alcohol gradient elution, 10% meoh eluate that will be obtained prepare liquid phase column using the C18 high pressure of diameter 20cm, and sample introduction 5L is used
Mobile phase acetonitrile: 0.2% formic acid=13:87, Detection wavelength 280nm, flow velocity 600ml/min carry out elution separation, obtain different groups
Point, difference analysis detection；The C18 high pressure of diameter 10cm will be used containing tri--O- nutgall acyl of 2,4,6--D-Glucose component
Prepare liquid phase column, sample volume 1.25L, by mobile phase acetonitrile: 0.2% formic acid=13:87, Detection wavelength 280nm, flow velocity 250ml/
Min further elutes separation, obtained component is carried out combining data detection, condensing crystallizing, 50 DEG C are dried under reduced pressure, and obtain purifying 2,4,6-
Three-O- nutgall acyls-D-Glucose.
2. application according to claim 1, which is characterized in that 1) 2,4,6- tri--O- nutgall acyls-D-Glucose system
It is standby: Chinese gall medicinal material to be cleaned, 80 DEG C of dry 4h, crushed, crossed 80 meshes, coarse tea leaf powder 1g is taken to decoct 15 in 20 mL boiling water
Min is put to 23-27 DEG C, is filtered off tea grounds, is obtained tea juice 8mL, takes tea grounds, 3mL tea juice and the above-mentioned gallnut extract of 10g to mix, with wetting
Eight layers of gauze sealing cool in 115 DEG C of 30 min of sterilizing, obtain fermented Chinese gall herb and tea leaves softwood, spare；By Aspergillus niger strain in potato grape
3d is activated on sugared agar medium, 50mL distilled water 121 DEG C of sterilizing 30min in 200mL conical flask is taken, cools, with sterilizing
Bamboo stick scrapes the spore bacteria suspension that 108/mL or more is made in 2-4 ring spore in the distilled water of sterilizing, and 180r/min shakes 2h, takes
The spore bacteria suspension of gallnut extract weight 5% is added in the fermented Chinese gall herb and tea leaves softwood handled well, after mixing evenly in 40 DEG C, 85% humidity
Ferment 60h, and dry to get 2,4,6- tri--O- nutgall acyls-D-Glucose, through detecting, the content of gallic acid reaches
30.22%；
2) tri--O- nutgall acyl of 2,4,6--D-Glucose isolates and purifies: the tri--O- galla turcica of 2,4,6- for taking step 1) to obtain
Acyl-D-Glucose fine powder, 70 DEG C of water-baths, methanol extract 3 times, and filtering, filtrate is concentrated to dryness, is dissolved in water, and filter, on filtrate
AB-8 macroporous resin column, methanol-water system elutions, specifically: first using water, 10% methanol, 20% methanol, 30% methanol, 50% respectively
Methanol elution gradient, 10% meoh eluate that will be obtained prepare liquid phase column using the C18 high pressure of diameter 20cm, and sample introduction 5L makes
Elution separation is carried out, difference is obtained with mobile phase acetonitrile: 0.2% formic acid=13:87, Detection wavelength 280nm, flow velocity 600ml/min
Component, difference analysis detection；The C18 high of diameter 10cm will be used containing tri--O- nutgall acyl of 2,4,6--D-Glucose component
Suppress standby liquid phase column, sample volume 1.25L, by mobile phase acetonitrile: 0.2% formic acid=13:87 Detection wavelength 280nm, flow velocity 250ml/
Min further elutes separation, obtained component is carried out combining data detection, condensing crystallizing, 50 DEG C are dried under reduced pressure, and obtain purifying 2,4,6-
Three-O- nutgall acyls-D-Glucose.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611257588.4A CN106635840B (en) | 2016-12-30 | 2016-12-30 | A kind of Aspergillus niger strain and its fermented Chinese gall herb and tea leaves that ferment generate the preparation method and application of new component |
| CN201910822290.0A CN110833560B (en) | 2016-12-30 | 2016-12-30 | Application of 2,4, 6-tri-O-galloyl-D-glucose in decocting of Chinese herbal medicines in preparation of antitumor medicines |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611257588.4A CN106635840B (en) | 2016-12-30 | 2016-12-30 | A kind of Aspergillus niger strain and its fermented Chinese gall herb and tea leaves that ferment generate the preparation method and application of new component |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910822290.0A Division CN110833560B (en) | 2016-12-30 | 2016-12-30 | Application of 2,4, 6-tri-O-galloyl-D-glucose in decocting of Chinese herbal medicines in preparation of antitumor medicines |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106635840A CN106635840A (en) | 2017-05-10 |
| CN106635840B true CN106635840B (en) | 2019-10-15 |
Family
ID=58838920
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910822290.0A Active CN110833560B (en) | 2016-12-30 | 2016-12-30 | Application of 2,4, 6-tri-O-galloyl-D-glucose in decocting of Chinese herbal medicines in preparation of antitumor medicines |
| CN201611257588.4A Active CN106635840B (en) | 2016-12-30 | 2016-12-30 | A kind of Aspergillus niger strain and its fermented Chinese gall herb and tea leaves that ferment generate the preparation method and application of new component |
Family Applications Before (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910822290.0A Active CN110833560B (en) | 2016-12-30 | 2016-12-30 | Application of 2,4, 6-tri-O-galloyl-D-glucose in decocting of Chinese herbal medicines in preparation of antitumor medicines |
Country Status (1)
| Country | Link |
|---|---|
| CN (2) | CN110833560B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108181416B (en) * | 2017-12-15 | 2020-12-08 | 中国农业科学院茶叶研究所 | Method for measuring 1, 2, 6-tri-galloyl-beta-D-glucose in tea and application thereof |
| CN116850231B (en) * | 2023-06-25 | 2024-03-29 | 河南中医药大学 | Method for processing radix rehmanniae with Bulbus Lilii |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103893392A (en) * | 2012-12-25 | 2014-07-02 | 杭州桐君堂生物科技有限公司 | Method for improving gallic acid content of Chinese gall leaven |
Family Cites Families (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2007415C1 (en) * | 1991-10-11 | 1994-02-15 | Институт органической химии АН Республики Кыргызстан | METHYL - 2,4,6 - TRI - O - ACETYL - 3 - DEOXY - 3,3-C - DICYANO - α - D - GLUCOHEXAPYRANOSIDE SHOWING ANTITUMOR ACTIVITY |
| EP0710484A3 (en) * | 1994-10-07 | 1996-10-23 | Univ Illinois | Mixture of alpha-D-glucopyranosyl-(1-6)-glucopyranose as antitumor agent |
| CN101121738B (en) * | 2007-09-06 | 2010-05-19 | 南方医科大学 | 1,3-O-di-galloyl-6-O-(S)-decapetalous caesalpinia acyl-beta-D-glucopyranose and application thereof |
| CN101152193B (en) * | 2007-09-28 | 2010-07-21 | 南方医科大学 | Application of 1,3,4-3-O-gallnut acyl-6-O-coffee acyl-beta-D-glucopyranose in preparing antineoplastic medicament |
| CN101152192B (en) * | 2007-09-28 | 2010-07-21 | 南方医科大学 | Application of 1,3-2-O-gallnut acyl 1-4,6-(S)-HHDP-beta-D-glucopyranose in preparing antineoplastic medicament |
| US20100034762A1 (en) * | 2008-08-06 | 2010-02-11 | Muhammed Majeed | Novel enrichment methods for gallic acid esters including 1-O-galloy1-bata-D-glucose and mucic acid gallates medicaments, therapeutic applications and methods of treatment thereof |
| CN101683350B (en) * | 2008-09-24 | 2012-06-13 | 中国人民解放军军事医学科学院毒物药物研究所 | Preparation method and application of galloyl glucose compounds |
| RU2418062C1 (en) * | 2009-12-25 | 2011-05-10 | Лариса Михайловна Краснопольская | Method for production of remedy with antineoplastic activity and remedy with antineoplastic activity |
-
2016
- 2016-12-30 CN CN201910822290.0A patent/CN110833560B/en active Active
- 2016-12-30 CN CN201611257588.4A patent/CN106635840B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103893392A (en) * | 2012-12-25 | 2014-07-02 | 杭州桐君堂生物科技有限公司 | Method for improving gallic acid content of Chinese gall leaven |
Non-Patent Citations (4)
| Title |
|---|
| 大戟属植物芳香化合物及药理活性;王莉 等;《中成药》;20140930(第9期);第1944-1952页 * |
| 没食子酰葡萄糖类化合物及其生物活性与初步合成;李长伟 等;《2012年中国药学大会暨第十二届中国药师周论文集》;20121119;第1-2页 * |
| 白哉多酚类化学成分的研究* (II);俞文胜 等;《中药材》;19950630;第18卷;第298页右栏第1段，表1） * |
| 百药煎发醉过程中关键菌株的确定;韩小敏等;《2009全国中药创新与研究论坛论文集》;20090822;摘要，第124页第1段至第127页最后1段 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110833560B (en) | 2022-09-16 |
| CN106635840A (en) | 2017-05-10 |
| CN110833560A (en) | 2020-02-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105494715B (en) | A kind of technique of inocalation method production dark green tea | |
| CN102559828B (en) | Method for preparing astragaloside IV by converting total saponins of astragalus by microorganisms | |
| CN108865895A (en) | Paecilomyces hepiali chen ZJB18001 and its application | |
| CN110004066A (en) | A kind of mystery Ganoderma Varieties By Uv Induced and its artificial cultivation method and application | |
| CN106635840B (en) | A kind of Aspergillus niger strain and its fermented Chinese gall herb and tea leaves that ferment generate the preparation method and application of new component | |
| CN104087645B (en) | A kind of solid fermentation flower of Panax ginseng and preparation method | |
| CN106047713A (en) | Talaromyces pinophilum strain Li-93 and application thereof | |
| CN101928671B (en) | Alternaria spp and method thereof for preparing ginsenoside Rg3 from fermented ginseng stem-leaf total saponin | |
| CN110004065A (en) | A kind of reddish brown Ganoderma Varieties By Uv Induced and its artificial cultivation method and application | |
| CN103865841B (en) | A kind of bacillus aceticus and the fruit vinegar utilizing apricot skin slag solid state fermentation to prepare thereof | |
| CN104372034B (en) | A kind of method that hairy roots of giant knotweed produces resveratrol and expansion culture | |
| CN103130906A (en) | Extracting method of alpine area russula lutea (huds.) Fr. hypha polysaccharide | |
| CN107099464A (en) | A kind of sclerotium aspergillus and its method for preparing penicillic acid | |
| CN105755091A (en) | Method for increasing chlorella oil yield through co-culture of rice Pantoea agglomerans and chlorella | |
| CN109234175A (en) | The Fusarium oxysporum DCLZJ-4 bacterial strain and application thereof of one plant of production chonglou saponin | |
| CN106282032B (en) | Penicillium citrinum LB and the application in phillygenol is prepared in bioconversion forsythin | |
| CN116103161A (en) | Plant endophytic fungus for producing eupatorium and application thereof | |
| CN109161488A (en) | One plant height produces Irpex lacteus strain and its cultural method of cordycepin | |
| CN103834577A (en) | Phlegmariurus phlegmaria mingchegensis mycorrhizal fungi, method for production of huperzine A from the same, and application | |
| CN104087647B (en) | A kind of solid medium C-Y-2 for fermented ginseng flower | |
| CN105238697B (en) | The technique of one plant of tree peony endogenetic fungus and bacterium production Paeonol | |
| CN103820331A (en) | Fujian and Zhejiang phlegmariurus endophytic fungi as well as method and application of Fujian and Zhejiang phlegmariurus endophytic fungi for producing huperzine-A | |
| CN108624509A (en) | The circulation utilization method of solid medium in a kind of artificial incubation of cicada fungus | |
| CN102943103B (en) | Penicillium fungus M1 and application thereof to increase of saponins yield in fermentation process of ginseng or Americginseng | |
| CN109468359A (en) | A kind of ginsenoside Rk6Preparation method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20191203 Address after: 625000 qianqianba formation, Qingjiang village, Siyan Township, Lushan County, Ya'an City, Sichuan Province Patentee after: Ya'an Xun Kang Pharmaceutical Co., Ltd. Address before: 450008 Jinshui Road, Zhengzhou, Henan, No. 1 Patentee before: Henan University of traditional Chinese Medicine |
|
| TR01 | Transfer of patent right |