CN110004066A - A kind of mystery Ganoderma Varieties By Uv Induced and its artificial cultivation method and application - Google Patents
A kind of mystery Ganoderma Varieties By Uv Induced and its artificial cultivation method and application Download PDFInfo
- Publication number
- CN110004066A CN110004066A CN201910286067.9A CN201910286067A CN110004066A CN 110004066 A CN110004066 A CN 110004066A CN 201910286067 A CN201910286067 A CN 201910286067A CN 110004066 A CN110004066 A CN 110004066A
- Authority
- CN
- China
- Prior art keywords
- ganoderma
- production
- induced
- culture
- varieties
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01G—HORTICULTURE; CULTIVATION OF VEGETABLES, FLOWERS, RICE, FRUIT, VINES, HOPS OR SEAWEED; FORESTRY; WATERING
- A01G18/00—Cultivation of mushrooms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
- C12N1/145—Fungal isolates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/645—Fungi ; Processes using fungi
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Biotechnology (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Botany (AREA)
- Virology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Environmental Sciences (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines Containing Plant Substances (AREA)
Abstract
The present invention relates to a kind of rare medicinal fungus novel bacterial and its artificial cultivation method and application more particularly to a kind of mysterious Ganoderma Varieties By Uv Induced and its artificial cultivation method and applications.Mysterious Ganoderma Varieties By Uv Induced of the invention picks up from Tanzania, is identified as mysterious Ganoderma Varieties By Uv Induced, is named as mysterious ganoderma lucidum (Ganoderma enigmaticum) HMGIM-I160004, and deposit number is CCTCC NO:M 2019093.In conclusion the present invention provides a kind of new mysterious Ganoderma Varieties By Uv Induced and its artificial cultivation method, domestication conversion ratio is good, average mushroom bag yield is 60.88 grams, and head tide biological transformation ratio is 18% or more, cultivation high temperature resistant, and its external inhibition tumor effect is obvious, has development prospect.
Description
Technical field
The present invention relates to a kind of rare medicinal fungus novel bacterial and its artificial cultivation method and application more particularly to a kind of mysteries
Ganoderma Varieties By Uv Induced and its artificial cultivation method and application.
Background technique
Currently, the industry development of edible and medical fungi is swift and violent, counted according to edible fungi of china association, China's edible and medical fungi in 2017
Yield reaches 37,120,000 tons, and 3.21% was increased than 2016, and the output value is 2721.92 hundred million yuan, and China accounts for 75% or more the whole world, from
Industry personnel are more than 20,000,000 people.Mushroom industry is come in planting industry in addition to the 5th after grain, dish, fruit, oil, is more than
Tealeaves and silkworm and mulberry.
In today that edible and medical fungi industry flourishes, more and more rare edible and medical fungi kinds progress into people's
The visual field, many original rare kinds are gradually tamed, such as dictyophora phalloidea, Agrocybe chaxingu, from pleat umbrella, hickory chick.But also have large quantities of
Wild edible and medical fungi do not studied due to failing by human knowledge.It was found that at present, there are about more than 300 ten thousand kinds in the world
Fungal species, only 1% species are realized, wherein known about 14000 kinds of macro fungi, the edible mushroom that the country has confirmed that
There are 1789 kinds, 798 kinds of medicinal fungus, and tamed in the middle only less than 100 kinds of wild edible and medical fungi by the mankind, scale is planted
The kind of training more only has more than 30 kinds.Research of the mankind apart from macro fungi will be walked with using there are also quite long road.
With gradually rising for people's living standard, the requirement for quality of the life is higher, and macro fungi is due to its richness
Containing various composition with nutrition and function, including fungi polysaccharide, triterpenes, sterol etc., have for human health non-
Normal good effect, is increasingly subject to the attention of people.
Ganoderma lucidum (Ganoderma) has long medicinal history in China, is commonly used by people for tracheitis, hepatitis, high blood for a long time
The adjuvant treatment of the illnesss such as pressure, tumour, immunity disorder.Modern pharmacology and clinical study results also indicates that ganoderma lucidum contains suppression
The active constituent that tumour processed and adjusting are immunized, but its application for not obtaining reality in this respect.It is built from DONK (1948)
Since vertical Ganodermataceae (Ganodermataceae), the reported Ganodermataceae macro fungi in the whole world more than totally 200 at present, China
Ganoderma lucidum on the books has 103 kinds, wherein 14 kinds are utilized by people.
Currently, widely used kind includes red sesame (Ganoderma lucidum), purple sesame (Ganoderma at home
Sinense) etc., many other types of Ganoderma also have the effect of similar, worth further research.According to state food medicine
Product supervision and management general bureau (CFDA) website statistics, by March, 2017, the country register Ganoderma lucidum listed as 669 kinds, with
Capsule, tablet, pulvis, based on tea bag, main component is still based on ganoderma lucidum polysaccharide, triterpene.
Summary of the invention
Against the above deficiency, the present invention provides a kind of wild rare medicinal fungus kind mystery ganoderma lucidum Ganoderma
The cultural method and application of enigmaticum novel bacterial and its domestication.
The present invention reaches above-mentioned purpose by following scheme:
In a first aspect, mysterious Ganoderma Varieties By Uv Induced of the invention picks up from Tanzania, it is identified as mysterious Ganoderma Varieties By Uv Induced, and
And tissue separation obtains original strain, is named as mysterious ganoderma lucidum (Ganoderma enigmaticum) HMGIM-I160004, in
It is preserved in China typical culture collection center (abbreviation CCTCC, address are as follows: Wuhan, China) on 2 18th, 2019, preservation is compiled
Number be CCTCC NO:M 2019093.
Second aspect, the present invention provide the cultural method of mystery Ganoderma Varieties By Uv Induced CCTCC NO:M 2019093 a kind of, packet
Parent species, production production parent species, production production kind, cultivation culture and management of producing mushroom are made after including tissue separation strain, with weight hundred
Divide than meter, the culture material includes 38% cotton seed hulls, 50% sawdust, 10% wheat bran and 2%CaCO3, the moisture of the culture material
For 60%-65%.
In the third aspect, the present invention provides a kind of mystery Ganoderma Varieties By Uv Induced CCTCC NO:M 2019093 or its extract
Using for treating or preventing tumour.
In fourth aspect, the present invention provides a kind of mystery Ganoderma Varieties By Uv Induced CCTCC NO:M 2019093 or its extract
Using, be used to prepare treat or prevent tumour drug.
At the 5th aspect, the present invention provides a kind of drug for treating or preventing tumour, including mysterious Ganoderma Varieties By Uv Induced CCTCC
NO:M 2019093 or its extract and carrier.
In conclusion the present invention provides a kind of new mysterious Ganoderma Varieties By Uv Induced and its artificial cultivation method, conversion ratio is tamed
Good, average mushroom bag yield is 60.88 grams, and head tide biological transformation ratio is 18% or more, cultivation high temperature resistant, and it is external
Inhibit tumor effect obvious, there is development prospect.
Detailed description of the invention
Fig. 1 is mysterious 2019093 figure of lucidum strain CCTCC NO:M in the field of embodiment 1.
Fig. 2 is the ITS sequence of the amplification of embodiment 1.
Fig. 3 is the ganoderma lucidum fruitbody figure of the domestication of embodiment 2.
Fig. 4 is the ganoderma lucidum fruitbody figure of the domestication of embodiment 2.
Fig. 5 is the micro-structure diagram of the ganoderma lucidum fruitbody of the domestication of embodiment 2.
Fig. 6 is the micro-structure diagram of the ganoderma lucidum fruitbody of the domestication of embodiment 2.
Specific embodiment
Below in conjunction with specific embodiment, invention is further explained.
In a first aspect, mysterious Ganoderma Varieties By Uv Induced of the invention picks up from Tanzania, it is identified as mysterious Ganoderma Varieties By Uv Induced, and
And tissue separation obtains original strain, is named as mysterious ganoderma lucidum (Ganoderma enigmaticum) HMGIM-I160004, in
It is preserved in China typical culture collection center (abbreviation CCTCC, address are as follows: Wuhan, China) on 2 18th, 2019, preservation is compiled
Number be CCTCC NO:M 2019093).
In April, 2016 Rudewa Ward, Kilosa District of the Wang Lusheng near Tanzania capital,
Morogoro Region is collected a ganoderma lucidum sample (coordinate: 6 ° 37 ' 28 " of south latitude, 37 ° 9 ' 1 " of east longitude), micro- through Guangdong Province
Biological study institute edible mushroom research and development center scientific research personnel carries out tissue isolation and obtains its PDA pure culture, is surveyed by ITS
Sequence compares, and discovery is up to 99% with Ganoderma enigmaticum similitude, and combining form is identified, the fungus specimen is macro
It sees feature and microscopic features and Ganoderma enigmaticum description is consistent, qualification result Ganoderma
enigmaticum.The name of the kind is from the mysterious discovery that it is in the different individual of many performances, so name
For mysterious ganoderma lucidum.
The character of mysterious Ganoderma Varieties By Uv Induced CCTCC NO:M 2019093 is as follows:
Mysterious ganoderma lucidum Ganoderma enigmaticum belongs to Ganodermataceae, Ganoderma, morphological appearance and common Ganoderma its
His kind is similar, but be covered on its cap butyrous it is soft imporosity tissue, basidiospore be ellipse, size 8-11 ×
3.5–6μ m(av.9.2×4.5μm).When culture, mysterious ganoderma lucidum Ganoderma enigmaticum is easy to from the following aspect
It can be distinguished with G. austroafricanum and G.destructans, its 2%MEA (maltose training under the conditions of 30 DEG C
Support base) under can grow.On DNA level, the result of its ITS and LSU all show that it is different from other Ganoderma kinds, tool
There is uniqueness.
Basidiocarps is perennial, there is a spherical cap of handle, 10-11 × 10-13 × 15-16cm, is covered with butyrous on cap
Soft imporosity tissue, and extend to hymenium.The tissue gos deep into 12-30mm to hymenium from surface and is formed, on side
Edge thickens.Hymenophore white, cream to light brown, stem column, Dan Sheng have paint sample gloss, micro- red to dark brown, there is ditch.
Hymenophore edge is thick, and yellowish-brown is blunt, lobate in fluctuating.Every square millimeter of bacterium hole 3-5, round, slightly random and elongation,
135–292×92–181μm(av.193.3×137.7μm);Wide 48-121 μm (av.82.2 μm) of diaphragm;Meat bacteria organization is soft, soft
Stopper has ring Min to wooden, and uniformly, dark brown is deeper close to tube color.Tube grows 0.5-1.5mm, dark brown.Three be bacterium
Silk system;Generative hyphae is not easy to observe, transparent, thin-walled, 2-3.5 μm of diameter, there is clamp connection;
Skeletal hyphae branch, light brown when young is in dark-brown after mature, and 3.5-7.5 μm of diameter;Binding hyphae is transparent, point
Branch, end attenuate, and thick 1-2.5 μm.Epidermal tissue is formed by vertical palisade cylindrical body close-packed arrays, heavy wall, starchiness, and 20-46
× 5.5–9μm.Load is not observed.Basidiospore elliposoidal, endosporium brown, sclerine is transparent, and inner wall has a spinule, 8-11 ×
3.5–6 μm(av.9.2×4.5μm).Dark is trained when growing state of its mycelia in 2%MEA culture medium upper surface shows 30 DEG C
It supports, 9 millimeters, 10 DEG C when 32 millimeters, 15 DEG C when the maximum speed of growth is up to 73 millimeters, 20 DEG C at 75 millimeters, 25 DEG C in 7 days
Shi Wufa growth.Bacterium colony growth is round, and edge is open and flat, white or cream-colored under all cultivation temperatures, felted.Mycelium and training
Feeding base is tightly combined, and chlamydospore has no.
Second aspect, the present invention provide the cultural method of mystery Ganoderma Varieties By Uv Induced CCTCC NO:M 2019093 a kind of, packet
Parent species, production production parent species, production production kind, cultivation culture and management of producing mushroom are made after including tissue separation strain, with weight hundred
Divide than meter, the culture material includes 38-40% cotton seed hulls, 48-50% sawdust, 8-10% wheat bran and 1-2%CaCO3, the cultivation
The moisture of training material is 60%-65%.
Preferably, by weight percentage, the culture material include 38% cotton seed hulls, 50% sawdust, 10% wheat bran and
2%CaCO3。
Preferably, the cultivation management includes: that production kind is forwarded in culture material, 26-28 DEG C of constant temperature, shading culture,
Humidity 50%-60% pays attention to ventilation in mycelia growth course, keeps gas concentration lwevel 4000ppm hereinafter, mycelia covers with bacterium
Bag comes to the ripening period, and continues to be placed at 26-28 DEG C of shading, carries out Aging storage.
Preferably, the management of producing mushroom includes: control temperature between 26 DEG C -30 DEG C, stronger ventilation amount, by bacterium bag lid
Remove, relative air humidity is adjusted to 90% or more, and through 5-7 days, mycelia started to twist together and formed faint yellow former base, kept opposite
Humidity controls between 26 DEG C -30 DEG C of space temperature, and relative air humidity makes CO in 80%-90%, stronger ventilation amount2Concentration
It is maintained at 350~1500ppm, daily diffused light 9 hours, fructification is mature, and white edge disappears, picking.
Preferably, the tissue separation strain includes: the wild naematoloma fasciculare fructification of acquisition back in aseptic condition
It behind lower alcohol wipe surface, tears, the inside meat bacteria organization of 0.2-0.5mm × 0.2-0.5mm is accessed in a manner of sterile working, is set
The constant temperature dark culture in 25 DEG C, the strain separated after mycelia covers with inclined-plane.
Preferably, the tissue isolation medium is comprehensive PDA culture medium.
It is further preferred that by weight percentage, the comprehensive PDA culture medium includes potato 20%, glucose
2%, agar 2%, potassium dihydrogen phosphate 0.3%, magnesium sulfate 0.15%, vitamin B1 are micro.
Preferably, the production parent species include: that isolated strain transfer to mother culture media is placed in 25 DEG C of constant temperature and is secretly trained
It supports, the picking of Tip Splitting is carried out when mycelia grows and bacterium not yet grows, obtains parent species.
Preferably, the mother culture media is rose bengal medium.
It is further preferred that by weight percentage, the rose bengal medium includes: peptone 0.5%, glucose
1%, potassium dihydrogen phosphate 0.1%, magnesium sulfate (MgSO4·7H2O) 0.05%, agar 2%, 1/3000 rose-bengal solution 10%,
Chloramphenicol 0.01%, remaining is water.
Preferably, the production production parent species include: that parent species are forwarded to production mother culture media, and it is dark to be placed in 25 DEG C of constant temperature
Culture covers with inclined-plane to mycelia and obtains production parent species.
Preferably, the production mother culture media is to add rich comprehensive PDA.
It is further preferred that by weight percentage, described plus rich comprehensive PDA include: potato 20%, glucose 2%,
Peptone 1%, agar 2%, potassium dihydrogen phosphate 0.3%, magnesium sulfate 0.15%, vitamin B1 are micro, remaining is water.
Preferably, production production kind include: into production kind culture medium sterile access produce parent species, when inoculation, ensures
It produces in parent species material block embedment original seed material, is placed in 25 DEG C of constant temperature dark cultures, production kind is obtained after mycelia eats full material.
Preferably, by weight percentage, the production kind culture medium includes: 98-99% sorghum and 1-2% calcium carbonate.
Cultural method conversion ratio of the invention is preferable, and cultivation heat-resisting quantity is good, and mycelium grows speed under the conditions of 30 DEG C
Degree is best, shows high high-temperature stability.
In the third aspect, the present invention provides a kind of mystery Ganoderma Varieties By Uv Induced CCTCC NO:M 2019093 or its extract
Using for treating or preventing tumour.
Preferably, the extract is that the ethyl acetate of 2019093 fructification of mystery Ganoderma Varieties By Uv Induced CCTCC NO:M mentions
Take object.
It is further preferred that the ethyl acetate of 2019093 fructification of mystery Ganoderma Varieties By Uv Induced CCTCC NO:M extracts
Object is the extract of 100 μ g/ml.
Preferably, the tumour includes tumour cell liver tumour, brain tumor, tumor of breast.
In fourth aspect, the present invention provides a kind of mystery Ganoderma Varieties By Uv Induced CCTCC NO:M 2019093 or its extract
Using, be used to prepare treat or prevent tumour drug.
Preferably, the extract is that the ethyl acetate of 2019093 fructification of mystery Ganoderma Varieties By Uv Induced CCTCC NO:M mentions
Take object.
It is further preferred that the ethyl acetate of 2019093 fructification of mystery Ganoderma Varieties By Uv Induced CCTCC NO:M extracts
Object is the extract of 100 μ g/ml.
Preferably, the tumour includes tumour cell liver tumour, brain tumor, tumor of breast.
At the 5th aspect, a kind of drug treating or preventing tumour, including mysterious Ganoderma Varieties By Uv Induced CCTCC NO:M
2019093 or its extract and carrier.
Preferably, the extract is that the ethyl acetate of 2019093 fructification of mystery Ganoderma Varieties By Uv Induced CCTCC NO:M mentions
Take object.
It is further preferred that the ethyl acetate of 2019093 fructification of mystery Ganoderma Varieties By Uv Induced CCTCC NO:M extracts
Object is the extract of 100 μ g/ml.
Preferably, the tumour includes tumour cell liver tumour, brain tumor, tumor of breast.
The carrier is any pharmaceutical carrier or filler etc..
Embodiment 1
Mysterious ganoderma lucidum Ganoderma enigmaticum
In April, 2016 Rudewa Ward, Kilosa District of the Wang Lusheng near Tanzania capital,
Morogoro Region collects a ganoderma lucidum sample (coordinate: 6 ° 37 ' 28 " of south latitude, 37 ° 9 ' 1 " of east longitude), as shown in Figure 1.
Tissue isolation, which is carried out, through Guangdong Microbes Inst edible mushroom research and development center scientific research personnel obtains its PDA pure culture
Object collects mycelia by Liquid Culture, and (40 DEG C) of low temperature drying using liquid nitrogen grinding, utilize Ezup pillar fungal genomic DNA
Extraction agent box, carries out the extraction of DNA genome, and -20 DEG C of refrigerations of obtained DNA solution are spare.Pass through fungi ribosomes gene
Spacer region universal primer ITS1/ITS4 (ITS1:TCCGTAGGTGAACCTGCGG, ITS4:TCCTCCGCTTATTGATATGC, by
Sangon Biotech (Shanghai) Co., Ltd. synthesis) carry out material ITS-PCR experiment, expand in Biometra PCR
It is carried out on instrument, PCR reaction solution forms (totally 50 μ l) are as follows:
TaKaRaTaq(5units/μl) 0.25μl
10×PCR Buffer 5μl
4 μ l of dNTP Mixture (each 2.5mM)
2 μ l of DNA profiling
Primer 1 (ITS1) (10 μm of olL-1) 5 μ l
Primer 2 (ITS4) (10 μm of olL-1) 5 μ l
28.75 μ l of sterile purified water
Reaction condition are as follows: 94 DEG C of reaction 5min;94 DEG C of reaction 1min, 55 DEG C of reaction 1min, 72 DEG C of reaction 1min, 30 are followed
Ring;The direct inspection of 72 DEG C of reaction 10min.PCR products carries out bidirectional sequencing, is completed by Hua Da gene.Its ITS sequence is to see Fig. 2
It is shown.
Sequencing result carries out sequence B last in GenBank, and discovery is up to Ganoderma enigmaticum similitude
99%, combining form identification, the fungus specimen gross feature and microscopic features and Ganoderma enigmaticum describe one
It causes, qualification result is Ganoderma enigmaticum.The name of the kind is the individual different in many performances from it
In mysterious discovery, so being named as mysterious ganoderma lucidum.
Embodiment 2
One, culture medium (by weight percentage):
1, isolation medium (comprehensive PDA) is organized:
Potato 20%, glucose 2%, agar 2%, potassium dihydrogen phosphate 0.3%, magnesium sulfate 0.15%, vitamin B1 are micro-
Amount, remaining is water.
2, mother culture media (rose bengal medium):
Peptone 0.5%, glucose 1%, potassium dihydrogen phosphate 0.1%, magnesium sulfate (MgSO4·7H2O) 0.05%, agar
2%, 1/3000 rose-bengal solution 10%, chloramphenicol 0.01%, remaining is water.
3, mother culture media (adding rich comprehensive PDA) is produced:
Potato 20%, glucose 2%, peptone 1%, agar 2%, potassium dihydrogen phosphate 0.3%, magnesium sulfate 0.15%,
Vitamin B1 is micro, remaining is water.
4, production kind culture medium:
98-99% sorghum, 1-2% calcium carbonate.
5, culture material:
38% cotton seed hulls, 50% sawdust, 10% wheat bran, 2%CaCO3, moisture 60%-65%, pH nature of culture material.
Two, method:
1, tissue separation strain:
Tissue isolation medium is made, test tube is dispensed, in 0.11MPa atmospheric pressure, 121 DEG C of high temperature and pressure moist heat sterilizations
30min takes out cooling and is put into inclined-plane.The wild naematoloma fasciculare fructification of acquisition back aseptically uses 75% wipes of alcohol
It after wiping surface, tears, the inside meat bacteria organization of 0.2-0.5mm × 0.2-0.5mm is accessed in a manner of sterile working.It is placed in 25 DEG C of trainings
Support constant temperature dark culture in case, after mycelia covers with inclined-plane after the strain that is separated can then transfer, the time covered with is big
Generally between -15 days 10 days.
2, parent species are made:
Mother culture media is made by formula, test tube is dispensed, in 0.11MPa atmospheric pressure, 121 DEG C of high temperature and pressure moist heat sterilizations
30min transfers for isolated strain.Be placed in constant temperature dark culture in 25 DEG C of incubators, to mycelia growth and bacterium not yet
Picking and the switching that Tip Splitting is carried out when growth, obtain parent species.
3, production production parent species:
Production production mother culture media, dispenses test tube, in 0.11MPa atmospheric pressure, 121 DEG C of high temperature and pressure moist heat sterilizations
30min takes out cooling sterile working and accesses parent species.Be placed in constant temperature dark culture in 25 DEG C of incubators, after mycelia covers with inclined-plane after
Obtaining production parent species can then transfer.The time that production parent species cover with is probably between -20 days 15 days.
4, production production kind
The sorghum for weighing required ratio, it is wet overnight through bubble, it is mixed into calcium carbonate in proportion, is fitted into 250ml conical flask, rolls over
It closes per bottled siccative 100-150g, obtains production kind culture medium.It is sealed with silica gel plug.In 0.147MPa atmospheric pressure, 128 DEG C of high temperature
Culture medium is shaken loose rear sterile working access production parent species after taking-up is cooling by high pressure moist heat sterilization 90min.Ensure to produce when inoculation
In parent species material block embedment production kind material.It is placed in constant temperature dark culture in 25 DEG C of incubators, (20 days or so) then after mycelia eats full material
It can be used as production kind to use in access cultivating bag.
5, cultivation culture
The compost of ratio needed for claiming the culture material of domestication is sufficiently mixed and adds water (water content 55-65%), dress
Enter 17cm × 35cm transparent polypropylene strain bag resistant to high temperature.Equivalent every packed siccative 400-420g.Small wood is used after installing material
It burrows in Bag Material, hole is deep to a bag bottom, then covers upper plastic hoop in sack, buckles the cultivation that matched lid makes to get one
Train material bag.In 0.147MPa atmospheric pressure, 128 DEG C of high temperature and pressure moist heat sterilization 90min, sterile working access production after cooling is taken out
Kind.Ensure in kind of material block embedment culture material when inoculation.It is kept away in 28 DEG C, the culturing room of relative air humidity 60-70% after inoculation
Optical culture.(18 days or so) can then enter after-ripening management after mycelia eats full material, to plant in the long purseful of mycelia in cultivation material bag
After training material, continue shading After-mature cultivation 20 days, so that it may enter the management of producing mushroom stage.
6, management of producing mushroom (including former base is formed, sporophore growth)
Temperature is controlled at 28-30 DEG C, and stronger ventilation amount, keeps space carbon dioxide content 1% hereinafter, air is opposite
Humidity is adjusted to 90% or more, after 5-7 days, removes cap, cultivating bag vertical setting of types placement (between bag and bag should there are gaps),
Mycelia starts to twist together and formed faint yellow rice La shape former base at this time.
After former base grows to 0.5cm, continue to control temperature between 28-30 DEG C, relative air humidity 85-90%, daily
Illumination 9 hours, intensity of illumination 300-500lx, and 350~1500ppm of the carbon dioxide concentration in air is kept, keep air wet
Profit.Through 40 days or so, ganoderma lucidum full maturity, end of dusting.During this period, daily Xiang Yougu sprays water mist 1-2 times, until son
Physical size is basically unchanged, and white edge disappears, and is illustrated that fructification has become mature, is harvested at this time.From former base is grown to fructification maturation
About pass through 40 days.As shown in Figure 3 and Figure 4.
Three, fruiting situation
1, fruiting phase: the kind fruiting phase is 88 days, head damp mushroom fruiting phase 40 days.
2, yield: each every damp 51.86-66.9 grams of fruiting of mushroom bag, average bag yield is 60.88 grams, head tide bioconversion
Rate is 17.39% or so.
3, fructification character: fructification is irregular, and edge is lobate in fluctuating.Color is light brown to brown.To its carry out
Micro- sem observation, as shown in Figure 5 and Figure 6.
Embodiment 3
To embodiment 2 cultivate mysterious 2019093 fructification of Ganoderma Varieties By Uv Induced CCTCC NO:M carry out ganoderma lucidum crude polysaccharide and
Ganodenic acid detection.Wherein total triterpene uses olive acid system, and ganoderic acid A in the middle uses high-efficient liquid phase technique and surveyed
It is fixed.
One, the detection of ganoderma lucidum crude polysaccharide
The extraction of Thick many candies is carried out according to the measuring method of Thick many candies content in NY/T1676-2008 edible mushroom.Method is such as
Under:
1, the production of glucose standard curve
The standard glucose 50mg for accurately weighing 105 DEG C of dry constant weights, sets in 500ml volumetric flask, adds distilled water dissolution simultaneously
It is diluted to scale.Glucose standards solution 0.00ml, 0.20ml, 0.40ml, 0.60ml, 0.80ml, 1.00ml are drawn, is placed in
In color-comparison tube, respectively plus distilled water to volume be 1.0ml, then plus 5% phenol test solution 1.5ml, shake up, the concentrated sulfuric acid be added dropwise rapidly
7.0ml places 30min after shaking up, be then settled to 10ml with deionized water, it is cooling after again under 488nm wavelength condition, with reagent
Blank zeroing, measures A488nm value respectively.It must be than drawing glucose standard curve by concentration and light absorption value.
2, in sample polysaccharide extraction
Accurately weighing 0.5-1g or so crushed sample (the mysterious Ganoderma Varieties By Uv Induced CCTCC NO:M of 20mm aperture sieve
2019093 fructifications), 10ml distilled water is added, shakes up rear boiling water bath 2 hours, adds water to 10ml after cooling, 4000r/min from
Supernatant is removed after heart 15min, sediment is dissolved in water, water-bath 1 hour in boiling water, and 4000r/min is centrifuged 15min.Equally go
Supernatant, sediment add water 5ml washing, and 4000r/min is centrifuged 15min, and supernatant mixing three times is settled to 25ml, correct amount
Take 1.0ml that dehydrated alcohol 5ml is added, precipitates overnight after shaking uniformly, 4000r/min is centrifuged 15min, discards supernatant liquid, it is heavy to take
Starch adds dehydrated alcohol 5ml again, operates repeatedly secondary, and sediment is settled to 10ml (also visual sediment with deionized water dissolving
Amount depending on).
3, sample measures
1ml lysate is drawn in 10ml colorimetric cylinder, adds phenol 1.5ml, concentrated sulfuric acid 7.0ml to react half an hour after shaking up, so
After be settled to 10ml, it is cooling after under 488nm wavelength condition, returned to zero with reagent blank, measure A488nm value respectively.With glucose
Standard specimen compares, and finds out total starches content.
4, it calculates
C --- from the quality for checking in glucose in article colorimetric liquid on standard curve, mg
N --- it is extension rate
W --- example weight
It is calculated, the Thick many candies content of mysterious 2019093 fructification of Ganoderma Varieties By Uv Induced CCTCC NO:M is 0.97%.
The content is higher than the average value of Common ganoderma lucidum sample.
Two, the measurement (olive acid system) of ganodenic acid
By " health food functional component and significant ingredient ", China Medical Science Press, 2007, chapter 12
(3) method, determination step are as follows:
1, the preparation of oleanolic acid titer
Precision weighs 10mg oleanolic acid, using dehydrated alcohol as solvent, is configured to the neat pier that 50ml concentration is 0.2mg/ml
Tartaric acid ethanol solution.
2, vanillic aldehyde-glacial acetic acid solution preparation
The accurate volumetric flask for quickly weighing vanillic aldehyde 0.552g. and dissolving and pour at once rapidly 10ml with appropriate glacial acetic acid
In, it is diluted to scale with glacial acetic acid rapidly, in case the same day is used.
3, the drafting of standard curve
Precision draw oleanolic acid titer 0.1,0.2,0.4,0.6,0.8ml be respectively placed in tool plug test tube, heating is waved
Solvent is removed, the 5% vanillic aldehyde-glacial acetic acid liquid and 1.6ml perchloric acid of 0.4ml brand-new is added, is heated in 70 winged waters bath with thermostatic control
15min, flowing water are cooled to room temperature, then plus people's 4ml ethyl acetate dilution, shake up, 560nm at measurement.
4, the extraction of sample
It takes sample powder (mysterious 2019093 fructification of Ganoderma Varieties By Uv Induced CCTCC NO:M) 20g (crossing 10 meshes), first
75% ethanol solution 300ml of secondary addition (1:15, weight/volume) flows back 2h in 80 DEG C of waters bath with thermostatic control, filtering.Second plus people
75% ethanol solution 200ml (I:10, weight/volume) flows back 1.5h in 80 DEG C of waters bath with thermostatic control, collection total filtrate twice.
5, the preparation of sample to be tested
Above-mentioned 0.5ml filtrate is accurately taken, is diluted, is configured to test sample with 3ml dehydrated alcohol.
6, sample measures
Accurately take above-mentioned 0.3ml the sample solution to be tested, solution is flung in heating, then plus people's 0.4ml brand-new 5% vanillic aldehyde-ice vinegar
Acid solution and 1.6ml perchloric acid, 70 DEG C of perseverances mix water-bath in heat 15mm, flowing water is cooled to room temperature, then plus people's 4ml ethyl acetate it is dilute
It releases, shakes up, wherein reagent blank calculates olive according to standard specimen standard curve using distilled water as reference liquid for measurement at 560nm
Acid content.
It is computed, total triterpene contents contained by mysterious 2019093 fructification of Ganoderma Varieties By Uv Induced CCTCC NO:M are 1.4%.It should
Content is higher than the average value of Common ganoderma lucidum sample.
Three, the measurement of ganoderic acid A
Ganoderma lucidum fruitbody sample (mysterious 2019093 fructification of Ganoderma Varieties By Uv Induced CCTCC NO:M) smashes it through 40 meshes,
Accurately weighed sample 2.000g (because ganoderma fiber is more, can not all be sieved, therefore crude fibre and fine powder respectively weigh
1.000g).75ml dehydrated alcohol is added, being heated to reflux 45min, (electric jacket knob is turned round to middle position, and ethyl alcohol is easy bumping, note
Whether ethyl alcohol volatilizees meaning condensation nozzle).It filters after letting cool, is filtered after washing filter residue with 10mL dehydrated alcohol, merging filtrate is washed altogether
It washs 2 times.Concentrate is settled to 25mL volumetric flask using vacuum rotary evaporator ethyl alcohol by 60 DEG C of water-baths.3mL solution is drawn,
It is filtered with 0.22 μm of syringe-driven filter, discards initial 1.5mL filtrate, residual filtrate is loaded on liquid phase bottle.Remaining extracting solution dress
In 15ml centrifuge tube, it is stored in 4 DEG C.
Ganoderic acid A detection is carried out by HPLC (JY/T024-1996), ganoderic acid A standard items come from the general think of biotechnology in Chengdu
Company, testing result are calculated: mysterious ganoderma lucidum Ganoderma mbrekobenum fructification ganoderic acid A content is
0.0003%, the ganoderic acid A content of Common ganoderma lucidum is usually 0.02% or more.It can be seen that the ganoderic acid A content of the kind is extremely low.
Embodiment 4
Inhibit tumour cell function
1, the preparation of ethyl acetate extract
Mysterious 2019093 fructification of Ganoderma Varieties By Uv Induced CCTCC NO:M that the cultivation of embodiment 2 obtains, uses acetic acid after crushing
Ethyl ester impregnates, ultrasonic extraction after 10 hours, ultrasonic 100min, extracts secondary, merging Secondary Organic phase.The organic phase that will be gathered
After being filtered, obtained liquid will be filtered and rotated with Rotary Evaporators to dripless state, low-temperature preservation (4 DEG C) is spare.Together
When carried out with the organic phase that identical extracting method is extracted with other wild edible and medical fungi rice mediums (25 DEG C, dark culture 45 days)
Parallel laboratory test comparison.
2, tumor cell culture
Tumour cell HepG2 (people is carried out with the DMEM culture solution containing penicillin, streptomysin and 10% fetal calf serum (FBS)
Liver cancer), U87 (human brain cancer) and MB231 (human breast carcinoma) culture.By the DMEM cell suspension inoculation containing 10%FBS in 96 holes
In tissue culturing plate, cell concentration is 2 × 104cells/ml.Culture is placed in 37 DEG C, 5%CO2Incubator for tissue culture in cultivate 4
Hour is stand-by.
3, inhibit tumour cell experiment
(1) sample preparation
Ethyl acetate extract is dissolved with DMSO, is configured to the mother liquor that concentration is 50mg/ml, with containing 10% tire after filtering
Mother liquor is diluted to the sample solution of 8,15,31,63,125ug/ml by the DMEM culture solution of cow's serum (FBS) respectively.In addition it prepares
Concentration is the sample solution of 100ug/ml.
(2) it is loaded
The cell culture fluid in 96 orifice plates is carefully sucked, it is respectively 8,15,31,63,125ug/ml and 100 that final concentration, which is added,
The sample solution of ug/ml.Three multiple holes of every sample.It is arranged zeroing hole (culture medium) simultaneously, control wells (cell, same concentrations
Drug dissolving medium, culture solution).
(3) it cultivates
It is placed in 37 DEG C, 5%CO2It is cultivated 44 hours in incubator for tissue culture.
(4) inhibiting cancer cell ability measures
After culture 44 hours, apoptosis of tumor cells is detected using mtt assay, 10ul MTT liquid (5mg/ is added in every hole
Ml, solvent PBS), continue in 37 DEG C, 5%CO2It is cultivated 4 hours in incubator for tissue culture, sucks liquid in hole, every hole is added
150ul DMSO, with ultraviolet specrophotometer at OD490nm vibration mensuration light absorption value.Sample is tested in triplicate.
(5) data are analyzed
It is counted using the dedicated statistical software of SPSS.21, using paired t-test, P < 0.05 has significant difference.
4, experimental result
It is counted using the dedicated statistical software of SPSS.21, to the inhibiting rate of HepG2, the results are shown in Table 1.
Table 1: inhibiting rate of each sample extract to HepG2
As it can be seen from table 1 mysterious Ganodenna Lucidum P.E is 99.6% to the inhibiting rate of HepG2 under 100 μ g/ml concentration,
Further, it is respectively 5.28ug/ml, 4.29ug/ that sample mystery Ganodenna Lucidum P.E, which inhibits the IC50 of HepG2, U87 and MB231,
Ml and 5.0ug/ml.This display, has extracorporeal suppression tumor cell effect strongly.The control experiment carried out simultaneously
In, effect of the extract of other most of wild mushrooms without inhibiting tumour cell.
From the point of view of composition detection and Function detection result, mysterious ganoderma lucidum is the new varieties not yet to conduct a research, tool
There is ethyl acetate extract to inhibit tumor effect obviously characteristic in vitro, is the strain with development prospect.
The above, preferable specific embodiment only of the invention, but scope of protection of the present invention is not limited thereto,
Anyone skilled in the art in the technical scope disclosed by the present invention, according to the technique and scheme of the present invention and its
Design is subject to equivalent substitution or change, should be covered by the scope of protection of the present invention.
Claims (10)
1. a kind of mystery Ganoderma Varieties By Uv Induced, which is characterized in that the mystery Ganoderma Varieties By Uv Induced is mysterious ganoderma lucidum (Ganoderma
Enigmaticum) HMGIM-I160004, deposit number are CCTCC NO:M 2019093.
2. a kind of cultural method of mystery Ganoderma Varieties By Uv Induced CCTCC NO:M 2019093, which is characterized in that separated including tissue
Parent species, production production parent species, production production kind, cultivation culture and management of producing mushroom are made after strain, it is by weight percentage, described
Culture material includes 38-40% cotton seed hulls, 48-50% sawdust, 8-10% wheat bran and 1-2%CaCO3, the moisture of the culture material
For 60%-65%.
3. cultural method according to claim 2, which is characterized in that by weight percentage, the culture material includes
38% cotton seed hulls, 50% sawdust, 10% wheat bran and 2%CaCO3。
4. cultural method according to claim 2, which is characterized in that the cultivation management includes: to be forwarded to production kind
In culture material, 26-28 DEG C of constant temperature, shading culture, humidity 50%-60% pay attention to ventilation in mycelia growth course, keep titanium dioxide
Concentration of carbon 4000ppm continues to be placed at 26-28 DEG C of shading, carries out management of producing mushroom hereinafter, mycelia covers with bacterium bag comes to the ripening period.
5. cultural method according to claim 2 or 4, which is characterized in that the management of producing mushroom includes: control temperature 26
Between DEG C -30 DEG C, stronger ventilation amount removes bacterium bag lid, and relative air humidity is adjusted to 90% or more, through 5-7 days, mycelia
Start to twist together and formed faint yellow former base, keep relative humidity, controls between 26 DEG C -30 DEG C of space temperature, air is relatively wet
For degree in 80%-90%, stronger ventilation amount makes CO2Concentration is maintained at 350~1500ppm, daily diffused light 9 hours, fructification at
Ripe, white edge disappears, picking.
6. cultural method according to claim 2, which is characterized in that the tissue separation strain includes: what acquisition was returned
Wild naematoloma fasciculare fructification aseptically behind alcohol wipe surface, is torn, 0.2- is accessed in a manner of sterile working
The inside meat bacteria organization of 0.5mm × 0.2-0.5mm is placed in constant temperature dark culture in 25 DEG C, is separated after mycelia covers with inclined-plane
Strain;Or
The production parent species include: that isolated strain transfer to mother culture media is placed in 25 DEG C of constant temperature dark cultures, raw to mycelia
Long and bacterium carries out the picking of Tip Splitting when not yet growing, obtain parent species;Or
The production production parent species include: that parent species are forwarded to production mother culture media, 25 DEG C of constant temperature dark cultures are placed in, to mycelia
It covers with inclined-plane and obtains production parent species;Or
Production production kind includes: the sterile access production parent species into production kind culture medium, and when inoculation ensures production parent species material
Block is embedded in original seed material, is placed in 25 DEG C of constant temperature dark cultures, and production kind is obtained after mycelia eats full material.
7. cultural method according to claim 6, which is characterized in that the tissue isolation medium is comprehensive PDA culture
Base;Or, the mother culture media is rose bengal medium;Or, the production mother culture media is to add rich comprehensive PDA;Or, with
Weight percent meter, the production kind culture medium includes: 98-99% sorghum and 1-2% calcium carbonate.
8. the application of a kind of mystery Ganoderma Varieties By Uv Induced CCTCC NO:M 2019093 or its extract, which is characterized in that for making
The standby drug for treating or preventing tumour.
9. application according to claim 8, which is characterized in that the extract is mystery Ganoderma Varieties By Uv Induced CCTCC NO:M
The ethyl acetate extract of 2019093 fructifications;Preferably, 2019093 son of mystery Ganoderma Varieties By Uv Induced CCTCC NO:M is real
The ethyl acetate extract of body is the extract of 100 μ g/ml.
10. application according to claim 8 or claim 9, which is characterized in that the tumour includes tumour cell liver tumour, brain
Tumour, tumor of breast.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201910286067.9A CN110004066B (en) | 2019-04-10 | 2019-04-10 | Novel mysterious ganoderma lucidum strain as well as artificial cultivation method and application thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201910286067.9A CN110004066B (en) | 2019-04-10 | 2019-04-10 | Novel mysterious ganoderma lucidum strain as well as artificial cultivation method and application thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN110004066A true CN110004066A (en) | 2019-07-12 |
CN110004066B CN110004066B (en) | 2022-05-27 |
Family
ID=67170903
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201910286067.9A Active CN110004066B (en) | 2019-04-10 | 2019-04-10 | Novel mysterious ganoderma lucidum strain as well as artificial cultivation method and application thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN110004066B (en) |
Cited By (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN112662566A (en) * | 2020-12-15 | 2021-04-16 | 广东省科学院微生物研究所(广东省微生物分析检测中心) | Ganoderma lucidum spore-less variety with high yield of polysaccharide and artificial cultivation method thereof |
CN113249227A (en) * | 2021-05-11 | 2021-08-13 | 聊城大学 | Novel lucid ganoderma strain and cultivation application thereof based on medicinal residue fungus bag |
CN113684138A (en) * | 2021-08-27 | 2021-11-23 | 广东省科学院微生物研究所(广东省微生物分析检测中心) | Novel Hertzia hertzeri strain and artificial cultivation method thereof |
CN115530013A (en) * | 2022-10-18 | 2022-12-30 | 广东粤微食用菌技术有限公司 | Production method of ganoderma leucocontextum liquid strain |
CN116548431A (en) * | 2023-05-11 | 2023-08-08 | 贵州省疾病预防控制中心 | Method for preparing large fungus original state specimen by A-B mixed crystal dropping glue |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101550442A (en) * | 2008-12-12 | 2009-10-07 | 上海市农业科学院 | India glossy ganoderma 128 bacterial strain or fruiting body specific molecular marker and obtainment method and application |
CN104673932A (en) * | 2015-04-01 | 2015-06-03 | 广东省微生物研究所 | Characteristic nucleotide sequence as well as nucleic acid molecular probe and method for identifying ganoderma leucocontextum |
-
2019
- 2019-04-10 CN CN201910286067.9A patent/CN110004066B/en active Active
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101550442A (en) * | 2008-12-12 | 2009-10-07 | 上海市农业科学院 | India glossy ganoderma 128 bacterial strain or fruiting body specific molecular marker and obtainment method and application |
CN104673932A (en) * | 2015-04-01 | 2015-06-03 | 广东省微生物研究所 | Characteristic nucleotide sequence as well as nucleic acid molecular probe and method for identifying ganoderma leucocontextum |
Non-Patent Citations (6)
Cited By (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN112662566A (en) * | 2020-12-15 | 2021-04-16 | 广东省科学院微生物研究所(广东省微生物分析检测中心) | Ganoderma lucidum spore-less variety with high yield of polysaccharide and artificial cultivation method thereof |
CN113249227A (en) * | 2021-05-11 | 2021-08-13 | 聊城大学 | Novel lucid ganoderma strain and cultivation application thereof based on medicinal residue fungus bag |
CN113684138A (en) * | 2021-08-27 | 2021-11-23 | 广东省科学院微生物研究所(广东省微生物分析检测中心) | Novel Hertzia hertzeri strain and artificial cultivation method thereof |
CN113684138B (en) * | 2021-08-27 | 2023-01-24 | 广东省科学院微生物研究所(广东省微生物分析检测中心) | Novel Hertzia hertzeri strain and artificial cultivation method thereof |
CN115530013A (en) * | 2022-10-18 | 2022-12-30 | 广东粤微食用菌技术有限公司 | Production method of ganoderma leucocontextum liquid strain |
CN116548431A (en) * | 2023-05-11 | 2023-08-08 | 贵州省疾病预防控制中心 | Method for preparing large fungus original state specimen by A-B mixed crystal dropping glue |
Also Published As
Publication number | Publication date |
---|---|
CN110004066B (en) | 2022-05-27 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN110004066A (en) | A kind of mystery Ganoderma Varieties By Uv Induced and its artificial cultivation method and application | |
CN107475130B (en) | Thin handle Isaria novel bacterial and its cultural method and purposes | |
US9284585B2 (en) | Method for increasing yield of total flavonoids in Ganoderma lucidum mycelium | |
CN102242069B (en) | Paecilomycescicadae (Miq.)Samson and application thereof | |
TW200819041A (en) | Method for cultivating Antrodia camphorate | |
CN108208016B (en) | Application of the volatile materials that streptomyces fimicarius generates in control of plant disease | |
CN107151632A (en) | Hirsutella hepiali Chen et Shen filament and its fermentation technique | |
CN106978353B (en) | Te Shi Xylaria sp. fungus and its cultural method | |
CN110004065A (en) | A kind of reddish brown Ganoderma Varieties By Uv Induced and its artificial cultivation method and application | |
CN106318826A (en) | Preparation method for phellinus linteus healthcare wine | |
CN103314771B (en) | New strain of ganoderma tsugae Murr. and cultivation method of strain | |
CN109082382A (en) | Cordyceps sinensis Hirsutella sinensis ZJB18002 and its application | |
CN109370914A (en) | A kind of cordyceps sinensis mycelium powder and its production method | |
CN105969652B (en) | Simulating plant suspension cell is metabolized the co-culture device exchanged with its endogenetic fungus | |
CN107156638A (en) | A kind of preparation method of Antilipemic monascus powder | |
CN109618809A (en) | Naematoloma fasciculare novel bacterial and its artificial cultivation method and application | |
CN112574893A (en) | Phellinus baumii, and preparation method and application of fermentation product thereof | |
CN105062898B (en) | A kind of peacilomyce hepiahi bacterium strain that coremium is produced on silkworm chrysalis and its cultural method | |
CN101824459B (en) | Method for promoting accumulation of triterpene in betula platyphylla suk. suspension cell by utilizing endophytic fungi elicitor | |
CN101880691B (en) | Preparation method for brewing function red yeast rice with low-yield citrinin | |
CN110447457A (en) | A kind of pycnoporus samguineus new strains and its artificial cultivation method and purposes | |
CN105713841B (en) | A kind of fusarium oxysporum and its application in the sprouting pretreatment of bitter buckwheat Wheat Seeds | |
CN109468232A (en) | One plant of production feruloyl esterase thanks watt bulk bacteria and its application in white wine yeast | |
CN107771613A (en) | A kind of naked umbrella novel bacterial of yellow pleat and its cultural method and purposes | |
TW201024320A (en) | Novel culturing method for Antrodia camphorata mycelium |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |