CN110833560B - Application of 2,4, 6-tri-O-galloyl-D-glucose in decocting of Chinese herbal medicines in preparation of antitumor medicines - Google Patents
Application of 2,4, 6-tri-O-galloyl-D-glucose in decocting of Chinese herbal medicines in preparation of antitumor medicines Download PDFInfo
- Publication number
- CN110833560B CN110833560B CN201910822290.0A CN201910822290A CN110833560B CN 110833560 B CN110833560 B CN 110833560B CN 201910822290 A CN201910822290 A CN 201910822290A CN 110833560 B CN110833560 B CN 110833560B
- Authority
- CN
- China
- Prior art keywords
- glucose
- tri
- galloyl
- medicines
- decocting
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7024—Esters of saccharides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Medicinal Chemistry (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- General Health & Medical Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Molecular Biology (AREA)
- Epidemiology (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines Containing Plant Substances (AREA)
Abstract
The invention provides application of 2,4, 6-tri-O-galloyl-D-glucose in decocting of Chinese herbal medicines in preparation of antitumor medicines, and belongs to the technical field of microbial fermentation. 2,4, 6-tri-O-galloyl-D-glucose has anti-tumor activity and provides technical support for developing new anti-tumor drugs.
Description
The invention discloses a preparation method and application of an aspergillus niger strain with the application number of CN201611257588.4 and a new component generated by fermenting a plurality of medicines, and is applied by divisional application of a patent with the application date of 2016, 12, and 30
Technical Field
The invention belongs to the technical field of microbial fermentation, and particularly relates to application of 2,4, 6-tri-O-galloyl-D-glucose in decocting of Chinese herbal medicines in preparation of antitumor medicines.
Background
Bai Yao Jiang is originally recorded in Dan xi Xin Fa (Dan xi Xin Fa), and is a block made of gallnut and tea leaves through fermentation. The nature and taste are sour, sweet and mild. Has effects of moistening lung, eliminating phlegm, promoting fluid production, and quenching thirst. It is clinically used for treating chronic cough with excessive phlegm, pharyngalgia, hematochezia, chronic dysentery with diarrhea, rectocele, aphtha, ulcerative gingivitis, carbuncle, swelling, sore and ulcer. At present, the multi-herb decocting is mostly fermented by adopting the solid state fermentation of the compound bacteria, and the solid state fermentation has the defects that the parameters of the fermentation process are difficult to determine, the process control is difficult, the thallus growth, the fermentation and the distribution of metabolites in the fermentation system are not uniform, so that the product stability is poor, the repeatability is low, the inconvenience is brought to the fermentation process of the multi-herb decocting, and the quality of the multi-herb decocting is unstable. The content of tannin is reduced after gallnut is fermented into a Chinese gall decoction, the content of gallic acid is increased, a dominant strain is bred and the application of the dominant strain in the Chinese gall decoction fermentation is researched, the raised chemical components after fermentation are extracted and separated, the structure is identified, the antitumor activity of the components is researched, the quality of the Chinese gall decoction can be better controlled, a basis is provided for clinical medication of the Chinese gall decoction, and the safety and effectiveness of clinical medication of the Chinese gall decoction are guaranteed.
Disclosure of Invention
In view of the above situation, the present invention aims to provide an aspergillus niger strain and a preparation method and application of a new component generated by fermenting a Chinese herbal medicine decoction thereof, which can effectively solve the problems of poor product stability, low repeatability, inconvenience for the fermentation process of the Chinese herbal medicine decoction, and unstable Chinese herbal medicine decoction quality caused by the defects of difficult measurement of fermentation process parameters, difficult process control, uneven distribution of thalli growth, fermentation and metabolites in a fermentation system in solid fermentation.
The technical scheme for solving the problem is that the Aspergillus niger strain of the invention is classified and named as Aspergillus sp BYJ.H-1, is preserved in China center for type culture Collection in 2016, 7, 5 days, and has the preservation number as follows: m2016376, preservation Address: wuhan university collection, Wuhan university Collection, eight Wuhan Wen Wuchang district, Wuhan City, Hubei province.
The preparation method comprises the following steps: collecting fresh Chinese gall leaven, respectively using Bengal red, a potato glucose agar (PDA) culture medium and 3 culture media of yeast extract by adopting a dilution coating plate method, culturing at a constant temperature of 28 ℃, totally separating 6 strains of 2 genera, and separating and screening Aspergillus niger BYJ.H-1 which enables the content of gallic acid in the Chinese gall leaven to be highest through appearance state and liquid phase analysis of the fermented Chinese gall leaven; the hundred-medicine decoction is as follows: cleaning Galla chinensis, drying at 80 deg.C for 4h, pulverizing, sieving with 80 mesh sieve, decocting coarse powder of folium Camelliae sinensis 1g in 10-20mL boiling water for 15min, standing at 23-27 deg.C, filtering to remove tea residue to obtain tea juice, mixing tea residue, 3mL tea juice and 10g Galla chinensis powder, sealing with eight layers of wet gauze, sterilizing at 115 deg.C for 30min, and cooling;
the Bengal red culture medium is prepared from: peptone 5g, glucose 10g, potassium dihydrogen phosphate 1g, magnesium sulfate (MgSO) 4 ·7H 2 O)0.5g, agar 20g, 1/3000 Bengal solution 100mL, distilled water 1000mL and chloramphenicol 0.1 g;
the potato glucose agar culture medium is prepared from the following components: 200g of potato, 20g of glucose, 15-20g of agar and 1000ml of tap water;
the yeast extract culture medium is prepared from the following components in parts by weight: 5g of yeast extract, 10g of cane sugar and 14g of agar powder are put into 1000ml of distilled water, decocted until boiling, and the volume is complemented.
The preparation method of the novel component generated by fermenting the aspergillus niger strains and decocting the Chinese medicines comprises the following steps:
1) preparing a new component of 2,4, 6-tri-O-galloyl-D-glucose: cleaning Galla chinensis, drying at 80 deg.C for 4-10h, pulverizing, sieving with 80 mesh sieve, decocting coarse powder of folium Camelliae sinensis 1g in 20mL boiling water for 15min, standing at 23-27 deg.C, filtering to remove tea residue to obtain tea juice 5-10mL, mixing tea residue, 3mL tea juice and 10g Galla chinensis powder, sealing with eight layers of wet gauze, sterilizing at 115 deg.C for 30min, and cooling to obtain soft materials; activating Aspergillus niger strain on potato glucose agar culture medium for 3 days, sterilizing 50mL distilled water in 200mL conical flask at 121 deg.C for 30min, cooling, scraping 2-4 ring spores with sterilized bamboo stick in sterilized distilled water to obtain 10 8 Shaking for 2h at 180r/min, adding spore suspension 5-8% of the weight of Galla chinensis powder into the processed Baiyao decocted soft material, stirring well, fermenting at 35-40 deg.C and 85% humidity for 60-66h, and drying to obtain new component 2,4, 6-tri-O-galloyl-D-glucose, wherein the potato glucose agar culture medium comprises: peeling potato (200 g), cutting into pieces, boiling, mashing,filtering, adding 20g of glucose and 15g of agar powder into the filtrate, boiling, and adding distilled water to 1000 mL;
2) separating and purifying a new component 2,4, 6-tri-O-galloyl-D-glucose: taking the obtained 2,4, 6-tri-O-galloyl-D-glucose fine powder, performing methanol extraction for 3 times in a water bath at 70 ℃, filtering, concentrating the filtrate to be dry, adding water for dissolving, filtering, loading the filtrate on a macroporous resin column, and then eluting by a methanol-water system, wherein the specific steps are as follows: the elution is carried out by gradient elution with water, 10% methanol (V/V), 20% methanol (V/V), 30% methanol (V/V) and 50% methanol (V/V), respectively, and the obtained 10% methanol eluent is subjected to high-pressure preparation of a liquid phase column with 20cm diameter of C18, 5L is injected, and the mobile phase acetonitrile is used: eluting and separating 0.2% formic acid at a detection wavelength of 280nm and a flow rate of 600ml/min to obtain different components, and respectively analyzing and detecting; the fraction containing 2,4, 6-tri-O-galloyl-D-glucose was subjected to high-pressure preparative liquid phase column using C18 having a diameter of 10cm, in a sample amount of 1.25L, as mobile phase acetonitrile: further eluting and separating with 0.2% formic acid 13:87 at detection wavelength of 280nm and flow rate of 250ml/min, detecting and mixing the obtained components, concentrating, crystallizing, and drying at 50 deg.C under reduced pressure to obtain purified 2,4, 6-tri-O-galloyl-D-glucose.
The 2,4, 6-tri-O-galloyl-D-glucose is a new compound discovered for the first time, a preparation solution is separated and purified relative to the content increasing components of Aspergillus niger BYJ.H-1 fermented Chinese gall decoction by adopting a macroporous resin column, the structure of the compound is identified by a nuclear magnetic resonance apparatus and a high-resolution mass spectrometer to obtain the 2,4, 6-tri-O-galloyl-D-glucose, the compound has two configurations of alpha and beta, and 2 cancer cells of lung adenocarcinoma A549 cells and human large cell lung cancer NCI-H460 cells prove that the 2,4, 6-tri-O-galloyl-D-glucose has anti-tumor activity.
The method greatly improves the conversion rate of the aspergillus niger CCTCC M2016376 fermented Chinese gall herb decocted tannin, provides specific process technical parameters, provides a basis for the quality control and the standardized production of the Chinese gall herb decocted, proves that the 2,4, 6-tri-O-galloyl-D-glucose has anti-tumor activity by using a cell model, and provides a technical guarantee for developing new anti-tumor drugs.
Drawings
FIG. 1 shows a phylogenetic tree of Aspergillus niger CCTCC M2016376 of the present invention.
FIG. 2 is a morphological photograph of Aspergillus niger CCTCC M2016376 of the present invention.
FIG. 3 is a photomicrograph of Aspergillus niger CCTCC M2016376 of the present invention.
FIG. 4 is a 2,4, 6-tri-O-galloyl-D-glucose 71H-NMR (acetone-D6) spectrum according to the present invention.
FIG. 5 shows the 13C-NMR (acetone-D6) spectrum of 2,4, 6-tri-O-galloyl-D-glucose according to the invention.
FIG. 6 shows the DEPT135 spectrum of 2,4, 6-tri-O-galloyl-D-glucose according to the present invention.
FIG. 7 shows the spectrum of 2,4, 6-tri-O-galloyl-D-glucose 1H-1H COSY (acetone-D6) according to the present invention.
FIG. 8 shows the HSQC (acetone-D6) spectrum of 2,4, 6-tri-O-galloyl-D-glucose according to the present invention.
FIG. 9 shows the spectrum of 2,4, 6-tri-O-galloyl-D-glucose HMBC (acetone-D6) according to the present invention.
FIG. 10 is the high resolution mass spectrogram of 2,4, 6-tri-O-galloyl-D-glucose in accordance with the present invention.
FIG. 11 is a morphogram of A549 and NCI-H460 cells of the invention.
Detailed Description
The following examples further illustrate the embodiments of the present invention in detail.
Example 1
The method for separating and screening the aspergillus niger strains comprises the following steps:
collecting fresh Chinese gall leaven, respectively using Bengal, potato glucose agar culture medium and 3 culture media of yeast extract by adopting dilution coating plate method, culturing at constant temperature of 28 ℃, totally separating 6 strains of 2 genera, respectively activating the separated strains (Aspergillus strains HM1, HM2, HM3, HM5, HM7 and yeast YJ1) on PDA for 3d, sterilizing in 200ml conical flask at 121 ℃ for 30min by taking 50ml of distilled water, cooling, scraping 2-4 ring spores by using sterilized bamboo stick, and preparing into 10 pieces of distilled water 8 Shaking at a speed of 180r/min for 2 hr to obtain spore suspension of more than one ml, sucking spore suspension of 5ml, adding into the decoction, stirring with sterilized glass rod, and wetting at 30 deg.C and 85%Fermenting for 60h, taking out, drying, and measuring gallic acid content;
the hundred-medicine decoction is as follows: cleaning Galla chinensis, drying at 80 deg.C for 4h, pulverizing, sieving with 80 mesh sieve, decocting 1g coarse powder of tea in 10mL boiling water for 15min, cooling to 25 deg.C, filtering to remove tea residue, collecting tea residue, 3mL tea juice, mixing with 10g Galla chinensis powder, sealing with eight layers of wet gauze, sterilizing at 115 deg.C for 30min, and cooling; the results are shown in the following table:
TABLE 1 description of appearance and gallic acid content of each strain fermented decoction
Note: blank control: sterilizing soft materials by decocting at 115 deg.C for 30min, and fermenting at 30 deg.C for 60 hr
Example 2
In the specific implementation of the invention, the preparation method of the new component generated by fermenting the aspergillus niger strain with the Chinese herbal medicines comprises the following steps:
1) preparing a new component of 2,4, 6-tri-O-galloyl-D-glucose: cleaning a Chinese gall medicinal material, drying at 80 ℃ for 4h, crushing, sieving with a 80-mesh sieve, taking 1g of coarse tea powder, decocting in 20mL of boiling water for 15min, standing to 23-27 ℃, filtering tea residues to obtain 8mL of tea juice, uniformly mixing the tea residues, 3mL of tea juice and 10g of the Chinese gall powder, sealing with eight layers of wet gauze, sterilizing at 115 ℃ for 30min, and cooling to obtain a Chinese gall decocted soft material for later use; activating Aspergillus niger strain on potato glucose agar culture medium for 3 days, sterilizing 50mL distilled water in 200mL conical flask at 121 deg.C for 30min, cooling, scraping 2-4 ring spores with sterilized bamboo stick in sterilized distilled water to obtain 10 8 Shaking for 2 hr at a speed of 180r/min, adding spore suspension 5% of Galla chinensis powder into the processed Chinese gall decoction soft material, stirring, fermenting at 40 deg.C and 85% humidity for 60 hr, and drying to obtain new component 2,4, 6-tri-O-Galla Turcicaacyl-D-glucose, detected that the content of gallic acid reaches 30.22%;
2) separating and purifying a new component 2,4, 6-tri-O-galloyl-D-glucose: taking the obtained 2,4, 6-tri-O-galloyl-D-glucose fine powder, performing water bath at 70 ℃, extracting with methanol for 3 times, filtering, concentrating the filtrate to dryness, adding water to dissolve, filtering, loading the filtrate on an AB-8 macroporous resin column, and eluting with a methanol-water system, wherein the specific steps are as follows: gradient elution is carried out by using water, 10% methanol (V/V), 20% methanol, 30% methanol and 50% methanol respectively, the obtained 10% methanol eluent is used for preparing a liquid phase column by using C18 high pressure with the diameter of 20cm, 5L is injected, and the mobile phase acetonitrile is used: eluting and separating 0.2% formic acid at a detection wavelength of 280nm and a flow rate of 600ml/min to obtain different components, and respectively analyzing and detecting; the fraction containing 2,4, 6-tri-O-galloyl-D-glucose was applied to a C18 high pressure 10cm diameter column, in a sample volume of 1.25L, as mobile phase acetonitrile: and (3) further eluting and separating 0.2% formic acid at a detection wavelength of 280nm and a flow rate of 250ml/min, detecting and combining the obtained components, concentrating and crystallizing, and drying under reduced pressure at 50 ℃ to obtain the purified 2,4, 6-tri-O-galloyl-D-glucose.
Example 3
In the specific implementation of the invention, the preparation method of the new component generated by fermenting the aspergillus niger strain with the Chinese herbal medicines comprises the following steps:
1) preparing a new component of 2,4, 6-tri-O-galloyl-D-glucose: cleaning Galla chinensis, drying at 80 deg.C for 8h, pulverizing, sieving with 80 mesh sieve, decocting coarse powder of folium Camelliae sinensis 1g in 20mL boiling water for 15min, standing to 25 deg.C, filtering to remove tea residue to obtain tea juice, mixing tea residue, 3mL tea juice and 10g Galla chinensis powder, sealing with eight layers of wet gauze, sterilizing at 115 deg.C for 30min, cooling to obtain soft materials for decocting; activating Aspergillus niger strain on potato glucose agar culture medium for 3 days, sterilizing 50mL distilled water in 200mL conical flask at 121 deg.C for 30min, cooling, scraping 2-4 ring spores with sterilized bamboo stick in sterilized distilled water to obtain 10 8 Shaking for 2 hr at a speed of 180r/min, adding spore suspension 6% of Galla chinensis powder into the processed soft materials, stirring, fermenting at 38 deg.C and 85% humidity for 62 hr, and dryingTo obtain new component 2,4, 6-tri-O-galloyl-D-glucose;
2) separating and purifying a new component 2,4, 6-tri-O-galloyl-D-glucose: taking the obtained 2,4, 6-tri-O-galloyl-D-glucose fine powder, carrying out water bath at 70 ℃, extracting with methanol for 3 times, filtering, concentrating the filtrate to dryness, adding water to dissolve, filtering, loading the filtrate on a macroporous resin column, and then eluting with a methanol-water system, wherein the specific steps are as follows: gradient elution is carried out by using water, 10% methanol (V/V), 20% methanol, 30% methanol and 50% methanol respectively, the obtained 10% methanol eluent is used for preparing a liquid phase column by using C18 high pressure with the diameter of 20cm, 5L is injected, and the mobile phase acetonitrile is used: eluting and separating 0.2% formic acid at a detection wavelength of 280nm and a flow rate of 600ml/min to obtain different components, and respectively analyzing and detecting; the fraction containing 2,4, 6-tri-O-galloyl-D-glucose was subjected to high-pressure preparative liquid phase column using C18 having a diameter of 10cm, in a sample amount of 1.25L, as mobile phase acetonitrile: and (3) further eluting and separating 0.2% formic acid at a detection wavelength of 280nm and a flow rate of 250ml/min, detecting and combining the obtained components, concentrating and crystallizing, and drying under reduced pressure at 50 ℃ to obtain the purified 2,4, 6-tri-O-galloyl-D-glucose.
The invention carries out classification and identification on aspergillus niger strains, and carries out anti-tumor activity research on new compounds, and relevant experimental data are as follows:
identification of Aspergillus niger CCTCC M2016376
In order to further determine the taxonomic status of the CCTCC M2016376, the invention adopts the traditional classification method and the molecular biology classification method to classify and identify the strain.
1 Medium for morphological Observation
Potato dextrose agar medium (PDA solid medium): peeling potato 200g, cutting into pieces, boiling until the potato is mashed, filtering, adding glucose 20g and agar powder 15g into the filtrate, boiling, adding distilled water to 1000mL, subpackaging in conical bottles, and sterilizing.
Bengal red medium: 35g of Bengal culture medium, 1000mL of distilled water is added and decocted until boiling, and the water is replenished to 1000 mL. Subpackaging in conical bottles for sterilization.
Sandpak medium (SDA medium): 10g of peptone, 40g of glucose, 14-15g of nutrient agar and 1000mL of distilled water.
The above culture medium is sterilized in autoclave at 121 deg.C for 20min for use.
2 primer
The method adopts a fungus universal primer to be synthesized by Shanghai biological engineering Co., Ltd. The sequences are respectively: ITS1 (5'-TCCGTAGGTGAACCTG CGG-3') and ITS 4 (5'-TCCTCCGCTTATTGATATGC-3') amplify the 5.8S-ITS segment.
3 test method
3.1 morphological Observation
3.1.1 colony morphology Observation
Taking a small amount of spores by using an inoculating needle, respectively inoculating the spores on a PDA culture medium, an SDA culture medium and a Bengal culture medium by adopting a three-point inoculation method, then placing the spores in a constant-temperature incubator at 28 ℃ for culture, observing and describing the colony morphology and the growth condition of strains in the culture medium, and taking photographic records (shown in figure 2).
3.1.2 microstructure Observation
Inoculating fungi to be identified at the junction of the cover glass and the culture medium by adopting an insert culture method, enabling hyphae to be attached to the cover glass in the growth process, culturing in a constant-temperature incubator at 28 ℃, pulling out the cover glass with sterile forceps every day from the next day, dyeing with lactic acid-cotton blue dye solution, and observing the fungus structure under a microscope (as shown in figure 3).
3.2 molecular biological identification of Aspergillus niger CCTCC M2016376
3.2.1 extraction of Aspergillus niger CCTCC M2016376 genomic DNA
Activating the frozen and stored experimental strain on solid PDA at 28 ℃ for 3d, inoculating the activated strain in a liquid PDA culture medium, performing shake flask culture at 28 ℃ for 48h, extracting DNA according to the specification of a biological kit after checking no pollution, detecting the extraction quality of the DNA by 2% agarose gel electrophoresis, and storing the extracted DNA at-20 ℃ for later use.
3.2.2 amplification of the Aspergillus niger CCTCC M2016376 Gene
The genomic DNA prepared as described above was used as a template for PCR amplification, and the 18S rDNA gene fragment in the fungal genomic DNA was amplified using primers ITS1 (5'-TCCGTAGGTGAACCTG CGG-3') and ITS 4 (5'-TCCTCCGCTTATTGATATGC-3').
The 50 μ L PCR reaction system was: 3 μ L of Mix25 μ L, DNA template, 20 μ L of primer ITS1(10 μmol. L-1), 4 μ L, ITS (10 μmol. L-1), 4 μ L, ddRnase water
The PCR reaction conditions are as follows: pre-denaturation at 94 ℃ for 4 min; denaturation at 94 ℃ for 30s, annealing at 55 ℃ for 30s, extension at 72 ℃ for 30s, and 30 cycles; total extension 72 ℃ for 8 min. After the reaction was completed, the detection was carried out by 2% agarose gel electrophoresis. And (4) carrying out sequence determination on qualified PCR products.
3.2.3 alignment analysis of sequencing results
The sequencing result sequence is compared with the strain sequence which has been published effectively in the GenBank database through BLAST, the 18S rDNA gene sequence of the strain which has been published effectively and has higher similarity is downloaded, the MEGA5.03 software is used for constructing the phylogenetic tree of the sequence (as shown in figure 1), and the taxonomic position of the strain is determined.
4 results of the test
4.1 morphological observations of CCTCC M2016376
The Aspergillus niger strain CCTCC M2016376 grows faster in spore brown or light brown on PDA, is laid on the surface of the whole colony, is thicker and heavier, has white and powdery edges, and has light yellow pigment on the back;
the colony on the SDA is oval or quasi-round, the center of the colony is white, the peripheral brown or light brown spores are dense, the edge is sparse, the pilus is yellowish white and has wrinkle-like texture, the center of the colony on the back is provided with yellow pigment, and the diameter is about 61 mm;
the colony is yellow on the Bengal red and is round or similar to a round, the light brown spores are not uniformly distributed, radial textures are arranged on the periphery of the colony, the colony edge is light yellow in surface and has the radial textures, the back is red yellow, and the diameter is about 28 mm.
Observing the hypha of the aspergillus niger strain CCTCC M2016376 under a mirror, wherein the hypha has a plurality of branches, conidiophores are attached to podocytes and have wart-shaped bulges, the podocytes are hypertrophic and transparent, the top sac is spherical, the two layers of small stalks are partially fertile, and the conidiophores are spherical.
4.2 molecular biological identification of CCTCC M2016376
4.2.1 CCTCC M2016376 18SrDNA sequence determination results
The sequencing result shows that the fragment consists of 559 bases, and the 18S rDNA sequence of the Aspergillus niger CCTCC M2016376 is obtained as follows: GATCGACGCGGGTCTTTGGGCCACCTCCCATCCGTGTCTATTGTACCCTGTTGCTTCGGCGGGCCCGCCGCTTGTCGGCCGCCGGGGGGGCGCCTCTGCCCCCCGGGCCCGTGCCCGCCGGAGACCCCAACACGAACACTGTCTGAAAGCGTGCAGTCTGAGTTGATTGAATGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGTCGCCGTCCCCCTCTCCGGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACATGCTCTGTAGGATTGGCCGGCGCCTGCCGACGTTTTCCAACCATTCTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCC GCTGAACTTAAGCATATCAAAAA are provided.
4.2.2 homologous evolutionary Tree construction
Through BLAST comparison, a sequence which is close to the similarity of the Aspergillus niger 18S rDNA gene sequence to be detected is downloaded in a GenBank database, and MEGA5.0 software is used for carrying out multiple sequence comparison on the Aspergillus niger 18S rDNA gene sequence to construct a phylogenetic tree. And (3) determining the content of the di-2, 4, 6-tri-O-galloyl-D-glucose.
The detection shows that the content of gallic acid in the 2,4, 6-tri-O-galloyl-D-glucose prepared by the preparation method reaches 30.22%.
Performing nuclear magnetic resonance and mass spectrum detection on tri-2, 4, 6-tri-O-galloyl-D-glucose
10mg of white powder was taken out, dissolved in deuterated acetone and detected by nuclear magnetic resonance, to obtain 1H-NMR (acetone-d6), 13C-NMR (acetone-d6), DEPT135, 1H-1H COSY (acetone-d6), HSQC (acetone-d6) and HMBC (acetone-d6) spectra (as shown in the attached FIGS. 4-9). An appropriate amount of white powder was weighed, dissolved in methanol, and the molecular weight was determined by high resolution mass spectrometry (see FIG. 10).
Research on antitumor activity of tetra-2, 4, 6-tri-O-galloyl-D-glucose
Precisely weighing 15.91mg of 2,4, 6-tri-O-galloyl-D-glucose, adding DMSO (dimethyl sulfoxide) to dissolve, preparing a mother solution of 1mmol/L, diluting with complete culture solution to 100umol/L, 300umol/L, 500umol/L, 700umol/L and 900umol/L (containing 1% DMSO), and filtering for sterilization.
MTT (thiazole blue) powder (about 100 mg) was finely weighed, dissolved in 20mL PBS (phosphate buffered saline), and sterilized by filtration.
After digestion of NCI-H460 and A549 cells in good growth state, morphology of A549 and NCI-H460 cells is shown in FIG. 11, and single cell suspension is prepared by RPMI-1640 culture medium containing 10% fetal calf serum and 100U/mL streptomycin mixed solution, and the single cell suspension is prepared at 1X 10 5 Each ml -1 Cells were seeded in 96-well plates at 200ul per well, 37 ℃ in 5% CO 2 Culturing for 24H in a cell culture box, sucking and removing old culture solution, adding 200uL of prepared liquid medicine into each well, enabling each concentration to be 5 wells in parallel, after culturing for 24H, 48H, 72H and 96H, adding 20uL of MTT solution (5mg/ml) into each well, continuing culturing for 4H, then removing supernatant, adding 150uL of DMSO into each well, shaking for 5min to completely dissolve formazan crystals, measuring OD (optical density) values of each well by using a microplate reader with a 492nm wavelength, taking the average value of the average absorbance OD values of each well of each group as OD of each group, and calculating the inhibition rate of the 2,4, 6-tri-O-galloyl-D-glucose liquid medicine on NCI-H460 and A549 cells according to the following formula: inhibition (IR%) (1-dose OD mean/blank OD mean) × 100%.
Experimental results show that the 2,4, 6-tri-O-galloyl-D-glucose concentration is 700umol/L48H, and the inhibition effect on the cell growth of A549 and NCI-H460 is strongest.
In conclusion, the aspergillus niger BYJ.H-1 with the highest gallic acid content in the Chinese gall herb decoction is separated and screened, so that the conversion rate of aspergillus niger CCTCC M2016376 fermented Chinese gall tannin is greatly improved, specific process technical parameters are provided, a basis is provided for the quality control and the standardized production of the Chinese gall decoction, a new compound 2,4, 6-tri-O-galloyl-D-glucose is found for the first time, a cell model is utilized to prove that the 2,4, 6-tri-O-galloyl-D-glucose has anti-tumor activity, a basis is provided for developing a new anti-tumor agent, and the method has practical clinical significance and is suitable for large-scale popularization and application.
Sequence listing
<110> university of traditional Chinese medicine in Henan
Application of 2,4, 6-tri-O-galloyl-D-glucose in hundred-herb decoction in preparation of antitumor drugs
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 559
<212> DNA
<213> Aspergillus niger (Aspergillus niger)
<400> 1
gatcgacgcg ggtctttggg ccacctccca tccgtgtcta ttgtaccctg ttgcttcggc 60
gggcccgccg cttgtcggcc gccggggggg cgcctctgcc ccccgggccc gtgcccgccg 120
gagaccccaa cacgaacact gtctgaaagc gtgcagtctg agttgattga atgcaatcag 180
ttaaaacttt caacaatgga tctcttggtt ccggcatcga tgaagaacgc agcgaaatgc 240
gataactaat gtgaattgca gaattcagtg aatcatcgag tctttgaacg cacattgcgc 300
cccctggtat tccggggggc atgcctgtcc gagcgtcatt gctgccctca agcccggctt 360
gtgtgttggg tcgccgtccc cctctccggg gggacgggcc cgaaaggcag cggcggcacc 420
gcgtccgatc ctcgagcgta tggggctttg tcacatgctc tgtaggattg gccggcgcct 480
gccgacgttt tccaaccatt ctttccaggt tgacctcgga tcaggtaggg atacccgctg 540
aacttaagca tatcaaaaa 559
Claims (1)
1. Application of 2,4, 6-tri-O-galloyl-D-glucose in decocting Chinese herbal medicines in preparing anti-lung cancer medicines.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910822290.0A CN110833560B (en) | 2016-12-30 | 2016-12-30 | Application of 2,4, 6-tri-O-galloyl-D-glucose in decocting of Chinese herbal medicines in preparation of antitumor medicines |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611257588.4A CN106635840B (en) | 2016-12-30 | 2016-12-30 | A kind of Aspergillus niger strain and its fermented Chinese gall herb and tea leaves that ferment generate the preparation method and application of new component |
| CN201910822290.0A CN110833560B (en) | 2016-12-30 | 2016-12-30 | Application of 2,4, 6-tri-O-galloyl-D-glucose in decocting of Chinese herbal medicines in preparation of antitumor medicines |
Related Parent Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201611257588.4A Division CN106635840B (en) | 2016-12-30 | 2016-12-30 | A kind of Aspergillus niger strain and its fermented Chinese gall herb and tea leaves that ferment generate the preparation method and application of new component |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110833560A CN110833560A (en) | 2020-02-25 |
| CN110833560B true CN110833560B (en) | 2022-09-16 |
Family
ID=58838920
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910822290.0A Active CN110833560B (en) | 2016-12-30 | 2016-12-30 | Application of 2,4, 6-tri-O-galloyl-D-glucose in decocting of Chinese herbal medicines in preparation of antitumor medicines |
| CN201611257588.4A Active CN106635840B (en) | 2016-12-30 | 2016-12-30 | A kind of Aspergillus niger strain and its fermented Chinese gall herb and tea leaves that ferment generate the preparation method and application of new component |
Family Applications After (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201611257588.4A Active CN106635840B (en) | 2016-12-30 | 2016-12-30 | A kind of Aspergillus niger strain and its fermented Chinese gall herb and tea leaves that ferment generate the preparation method and application of new component |
Country Status (1)
| Country | Link |
|---|---|
| CN (2) | CN110833560B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108181416B (en) * | 2017-12-15 | 2020-12-08 | 中国农业科学院茶叶研究所 | Method for measuring 1, 2, 6-tri-galloyl-beta-D-glucose in tea and application thereof |
| CN116850231B (en) * | 2023-06-25 | 2024-03-29 | 河南中医药大学 | Method for processing radix rehmanniae with Bulbus Lilii |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2007415C1 (en) * | 1991-10-11 | 1994-02-15 | Институт органической химии АН Республики Кыргызстан | METHYL - 2,4,6 - TRI - O - ACETYL - 3 - DEOXY - 3,3-C - DICYANO - α - D - GLUCOHEXAPYRANOSIDE SHOWING ANTITUMOR ACTIVITY |
| US5712123A (en) * | 1994-10-07 | 1998-01-27 | Board Of Trustees Of The University Of Illinois | Mixture having antitumor activities |
| CN101152192A (en) * | 2007-09-28 | 2008-04-02 | 南方医科大学 | Application of 1,3-2-O-gallnut acyl 1-4,6-(S)-HHDP-beta-D-glucopyranose in preparing antineoplastic medicament |
| RU2418062C1 (en) * | 2009-12-25 | 2011-05-10 | Лариса Михайловна Краснопольская | Method for production of remedy with antineoplastic activity and remedy with antineoplastic activity |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101121738B (en) * | 2007-09-06 | 2010-05-19 | 南方医科大学 | 1,3-O-di-galloyl-6-O-(S)-decapetalous caesalpinia acyl-beta-D-glucopyranose and application thereof |
| CN101152193B (en) * | 2007-09-28 | 2010-07-21 | 南方医科大学 | Application of 1,3,4-3-O-gallnut acyl-6-O-coffee acyl-beta-D-glucopyranose in preparing antineoplastic medicament |
| US20100034762A1 (en) * | 2008-08-06 | 2010-02-11 | Muhammed Majeed | Novel enrichment methods for gallic acid esters including 1-O-galloy1-bata-D-glucose and mucic acid gallates medicaments, therapeutic applications and methods of treatment thereof |
| CN101683350B (en) * | 2008-09-24 | 2012-06-13 | 中国人民解放军军事医学科学院毒物药物研究所 | Preparation method and application of galloyl glucose compounds |
| CN103893392B (en) * | 2012-12-25 | 2018-01-16 | 杭州桐君堂生物科技有限公司 | A kind of method of gallic acid content in raising fermented Chinese gall herb and tea leaves |
-
2016
- 2016-12-30 CN CN201910822290.0A patent/CN110833560B/en active Active
- 2016-12-30 CN CN201611257588.4A patent/CN106635840B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2007415C1 (en) * | 1991-10-11 | 1994-02-15 | Институт органической химии АН Республики Кыргызстан | METHYL - 2,4,6 - TRI - O - ACETYL - 3 - DEOXY - 3,3-C - DICYANO - α - D - GLUCOHEXAPYRANOSIDE SHOWING ANTITUMOR ACTIVITY |
| US5712123A (en) * | 1994-10-07 | 1998-01-27 | Board Of Trustees Of The University Of Illinois | Mixture having antitumor activities |
| CN101152192A (en) * | 2007-09-28 | 2008-04-02 | 南方医科大学 | Application of 1,3-2-O-gallnut acyl 1-4,6-(S)-HHDP-beta-D-glucopyranose in preparing antineoplastic medicament |
| RU2418062C1 (en) * | 2009-12-25 | 2011-05-10 | Лариса Михайловна Краснопольская | Method for production of remedy with antineoplastic activity and remedy with antineoplastic activity |
Non-Patent Citations (3)
| Title |
|---|
| Isolation and Identification of Compounds from Penthorum chinense Pursh with Antioxidant and Antihepatocarcinoma Properties;Qun Lu et al.,;《J. Agric. Food Chem.》;20121017;第60卷;第11097-11103页 * |
| 民族药诃子药理活性研究进展;张秀娟等;《中国中药杂志》;20160229;第41卷(第04期);第619-623页 * |
| 调节细胞自噬的中药有效成分研究进展;佳娜提•达吾列提;《中草药》;20140831;第46卷(第16期);第2283-2292页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110833560A (en) | 2020-02-25 |
| CN106635840B (en) | 2019-10-15 |
| CN106635840A (en) | 2017-05-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101177665B (en) | Industrial method for culturing north winter worm summer herb with high-content of cordycepin | |
| CN108865895B (en) | Paecilomyces hepiali ZJB18001 and application thereof | |
| CN102559828B (en) | Method for preparing astragaloside IV by converting total saponins of astragalus by microorganisms | |
| CN110833560B (en) | Application of 2,4, 6-tri-O-galloyl-D-glucose in decocting of Chinese herbal medicines in preparation of antitumor medicines | |
| CN104357332B (en) | Aspergillus niger JH-2 and application to biotransformation and synthesis of asiatic acid | |
| CN106086147A (en) | Fungal elicitor is utilized to induce the method extracting betulic acid from Inonqqus obliquus | |
| CN107723248A (en) | It is a kind of to assist raw penicillium fungi and the application in steroid saponin is prepared in the tuber of dwarf lilyturf | |
| CN103667072B (en) | A kind of Huperzia serrata endogenetic epiphyte and the application at preparation 8 α, 15 α-epoxidation selagine thereof | |
| CN106119333A (en) | A kind of method utilizing fatty acid-induced to extract betulic acid from Inonqqus obliquus | |
| CN110590769B (en) | Pair of quinazolinone alkaloid enantiomers, preparation method and application thereof | |
| CN116790386A (en) | Penicillium sp.YMS6 strain and application thereof | |
| CN116103161A (en) | Plant endophytic fungus for producing eupatorium and application thereof | |
| CN104278070A (en) | Method for improving content of ergosterol in liquid fermentation products of phellinus igniarius | |
| CN103146614A (en) | Camptotheca endophytic bacterium LY214 for producing camptothecin and application thereof | |
| CN102943103B (en) | Penicillium fungus M1 and application thereof to increase of saponins yield in fermentation process of ginseng or Americginseng | |
| CN104087647B (en) | A kind of solid medium C-Y-2 for fermented ginseng flower | |
| CN107723246B (en) | Endophytic penicillium oxalicum of ophiopogon japonicas and application of endophytic penicillium oxalicum of ophiopogon japonicas in preparation of steroid saponin | |
| CN111620819B (en) | Separation and purification method and application of two compounds in musa basjoo root | |
| CN116159114B (en) | Fermentation preparation process of astragalus, dendrobium and fructus forsythiae resolving beverage and product | |
| CN114989986B (en) | Wild Phellinus linteus rich in various active ingredients and culture method and application thereof | |
| CN107739717A (en) | It is a kind of to assist raw Schizophyllum fungi and the application in steroid saponin is prepared in the tuber of dwarf lilyturf | |
| CN109971652B (en) | Tibetan pineapple endophytic fungus oncogenes X117 and preparation method and application of fermentation product thereof | |
| CN110894472B (en) | Endophytic penicillium strain of Hubei ophiopogon japonicus and application thereof | |
| CN108913731B (en) | Pyran compound with immunosuppressive activity and preparation method and application thereof | |
| KR20110059090A (en) | Use of leifsonia sp. gal45 for preparation of protopanaxatriol |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |