CN106591228B - A kind of preparation method of human pluripotent stem cells that are while resisting cell ageing and vicious transformation - Google Patents

A kind of preparation method of human pluripotent stem cells that are while resisting cell ageing and vicious transformation Download PDF

Info

Publication number
CN106591228B
CN106591228B CN201611192461.9A CN201611192461A CN106591228B CN 106591228 B CN106591228 B CN 106591228B CN 201611192461 A CN201611192461 A CN 201611192461A CN 106591228 B CN106591228 B CN 106591228B
Authority
CN
China
Prior art keywords
nrf2
cell
stem cell
msc
amplification type
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201611192461.9A
Other languages
Chinese (zh)
Other versions
CN106591228A (en
Inventor
刘光慧
曲静
杨济平
铃木敬一郎
任若通
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Institute of Biophysics of CAS
Original Assignee
Institute of Biophysics of CAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institute of Biophysics of CAS filed Critical Institute of Biophysics of CAS
Priority to CN201611192461.9A priority Critical patent/CN106591228B/en
Priority to PCT/CN2017/080393 priority patent/WO2018113145A1/en
Priority to JP2018549154A priority patent/JP2020501501A/en
Publication of CN106591228A publication Critical patent/CN106591228A/en
Application granted granted Critical
Publication of CN106591228B publication Critical patent/CN106591228B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0652—Cells of skeletal and connective tissues; Mesenchyme
    • C12N5/0662—Stem cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/28—Bone marrow; Haematopoietic stem cells; Mesenchymal stem cells of any origin, e.g. adipose-derived stem cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/48—Reproductive organs
    • A61K35/54—Ovaries; Ova; Ovules; Embryos; Foetal cells; Germ cells
    • A61K35/545—Embryonic stem cells; Pluripotent stem cells; Induced pluripotent stem cells; Uncharacterised stem cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2506/00—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
    • C12N2506/02—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from embryonic cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2506/00—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
    • C12N2506/45—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from artificially induced pluripotent stem cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/10011—Adenoviridae
    • C12N2710/10311—Mastadenovirus, e.g. human or simian adenoviruses
    • C12N2710/10341—Use of virus, viral particle or viral elements as a vector
    • C12N2710/10343—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Cell Biology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Genetics & Genomics (AREA)
  • Biotechnology (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Virology (AREA)
  • General Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Public Health (AREA)
  • Microbiology (AREA)
  • Reproductive Health (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Plant Pathology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Gynecology & Obstetrics (AREA)
  • Hematology (AREA)
  • Rheumatology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

The invention discloses a kind of preparation methods of the mescenchymal stem cell of NRF2 genes amplification type for resisting cell ageing and vicious transformation simultaneously.The present invention utilizes gene editing technology successful modification anti contravariance related gene for the first time, only the controllable active activation of endogenous adversity gene is just realized in single encoding loci modification, obtain the genes amplification type mescenchymal stem cell of adverse-resistant characteristic raising, and it genes amplification type stem cell is demonstrated by internal experiment in vitro can resist adverse circumstance and cell ageing, have the function of more preferably tissue repair and resist the ability of pernicious tumor formation conversion.Method of the invention solves validity and the big crucial and bottleneck problem of safety two in cellular transplantation therapy simultaneously.

Description

A kind of preparation of human pluripotent stem cells that are while resisting cell ageing and vicious transformation Method
Technical field
The invention belongs to field of biotechnology, and it is dry thin to be related to people's multipotency that is a kind of while resisting cell ageing and vicious transformation The preparation method of born of the same parents.
Background technique
Cellular transplantation therapy is the developing direction of regenerative medicine field most prospect and potentiality in recent years.Cell transplantation is intended to Supplement substitutes in vivo because of the cell for originally having exhausted or having lost normal function caused by the factors such as disease or aging, the cell of transplanting It survives in vivo and plays normal function, recovery organization homeostasis, and then realize tissue repair and regeneration.Although cell transplantation is controlled Treatment gives expression to splendid therapeutic effect in terms of such as Bone Marrow Stem Cells Transplantation in Treating, but it is widely answered With the challenge for still facing many problems.Currently, the principal element of limitation cellular transplantation therapy concentrates on validity and safety two Aspect.
Can the validity of cellular transplantation therapy be mainly reflected in the quality before graft transplantation and survive after entering in vivo It integrates and plays regeneration function.On the one hand, there is certain " service life " in incubation in vitro in graft, is embodied in and holds It is continuous that cell senescence (cellular senescence) state is quickly entered after limited continuous passage by duplication pressure influence, Stop proliferation and loses function.On the other hand, the position of cell transplantation is generally located in disease or the tissue microenvironment of aging, In inflammatory factor, unwanted metabolic products etc. can damage external source graft.It is serious that above two aspect can all cause cell to occur Functionality decline causes to transplant inefficiency.The safety of cellular transplantation therapy is concentrated mainly on the tumorigenesis wind after long-term engraftment Danger.Cellular transplant is persistently under pressure stress in sick body, and genome may become extremely unstable, if in oncogene or suppression cancer It mutates on gene, cancer may be developed into, form security risk.
How the efficiency of cellular transplantation therapy, as far as possible reduction tumorigenesis risk are improved by specific intervention means always Since be all that regenerative medicine being capable of widely applied crucial problem.However, not yet developing simple and effective side so far Method overcomes this technical bottleneck.The current trial for improving cell transplantation effect, which is concentrated mainly on, improves transplantation site microenvironment and increasing Strong two aspect of graft " degeneration-resistant " characteristic.Many researchs in the sick body microenvironment of unfavorable cells play normal function by supplementing The mode of external source " nutrition and protective factors " improves transplantation effect, but this method is only capable of improving transplanting environment in a short time, moves Plant the poor prognosis outstanding problems such as recurrence.In contrast to this, improve " internal cause " of graft by ad hoc approach, i.e. enhancing transplanting material Expect that itself intrinsic resistance adverse circumstance ability come the improvement for realizing transplantation effect is more direct and long-acting means.Have at present few Number imports resistance relevant protein, specific signal in regulating cell research shows that can use slow virus or retroviral vector Access or gene expression enhance resistance of the cell to adverse circumstance, and then realize the promotion of cellular transplantation therapy effect.Although a series of Preclinical study demonstrates the feasibility for improving the intrinsic adverse-resistant characteristic of cell, but the gene regulation that integrated viral vectors mediates must So there are the random integration of genome, gene mutation increased risk, safety causes anxiety, this largely reduced its answering clinically With value.
The development of gene target editing technique has greatly pushed the progress of cellular transplantation therapy.This technology makes people The genetic code on genome can be accurately edited, it is existing at present largely to correct disease cells using gene target editing technique The case of pathogenic mutation is reported.The gene correction cell for restoring normal function can be used for autotransplantation through amplification in vitro, be Excellent material in cellular transplantation therapy.
Summary of the invention
It is an object of the present invention to provide a kind of NRF2 genes amplification types for resisting cell ageing and vicious transformation simultaneously Mescenchymal stem cell preparation method.
The preparation method of mescenchymal stem cell provided by the invention includes the following steps:
(1) it is glycine by the 82nd glutamic acid mutation of the NRF2 albumen in vitro human pluripotent stem cells, obtains The multipotential stem cell of NRF2 genes amplification type；
(2) induction differentiation is oriented to the multipotential stem cell of the NRF2 genes amplification type, obtains NRF2 genes amplification The mescenchymal stem cell of type.
In the above method, in step (1), the 82nd of the NRF2 albumen by in vitro human pluripotent stem cells Glutamic acid mutation is that the method for glycine is that the 245th base A of NRF2 gene is sported bases G；The NRF2 gene The 245th be the 245th of the gene coding region NRF2.
In the above method, the method that the 245th base A of NRF2 gene is sported bases G is determined for genome Point editor；
The method of the genome fixed point editor can be for ZFN is edited, TALEN is edited, CRISPR/Cas9 is edited or HdADV The fixed point editor of mediation；The method of the genome fixed point editor is specially the fixed point editor that HdADV is mediated.
In an embodiment of the present invention, the fixed point editor that the HdADV is mediated can realize by the following method:
The acquisition of the first step, mutant fragments
It will be in the genetic fragment of human genome NRF2 the 1st and No. 2 introne (intron1-exon2-intron2) of gene 245th nucleotide site of the cDNA sequence of corresponding NRF2 gene sports bases G by the base A of wild type, and keeps Other sequences are constant, the segment after being mutated；
The building of second step, viral expression plasmids
By in AscI the and SpeI restriction enzyme site of the segment insertion pCIHDAdGT8-4 carrier after the mutation, recombinated Plasmid.
Third step, viral expression plasmids and helper plasmid cotransfection incasing cells obtain recombined adhenovirus particle
The recombinant plasmid described in PI-SceI (NEB) digestion, obtains linearization plasmid, and by the linearization plasmid with auxiliary It helps viral AdHPBGF35 to import progress recombined adhenovirus packaging in incasing cells jointly, obtains recombined adhenovirus particle；The packet Dress cell is specially 116 cell of derived cell system of 293 system of human embryonic kidney cell；
4th step, recombined adhenovirus particle infect aim cell
Human pluripotent stem cells are infected with recombined adhenovirus particle, by screening, obtain site on a NRF2 allele The cell correctly edited, is denoted by NRF2AG/+HESC cell；
The linearization plasmid and the helper virus AdHPBGF35 are imported the NRF2 by the 5th step jointlyAG/+ Gene editing is carried out in hESC cell again, and cell after editor is identified, obtains site on two NRF2 allele The cell correctly edited, the as multipotential stem cell of NRF2 genes amplification type.
In the above method, in step (2), the method for the Induction of committed differentiation includes the following steps:
(b1) multipotential stem cell of NRF2 genes amplification type is subjected to embryoid body differentiation, obtains embryoid body；
(b2) embryoid body is cultivated to fibrous cell's appearance；Using secondary culture, sorting wherein CD73, CD90, CD105 is positive cell population, the mescenchymal stem cell of the as described NRF2 genes amplification type.
In the above method, the specific method is as follows for the embryoid body differentiation: preparing equal containing 300-500 cell, size One NRF2AG/AGHESC clone, is cleaned once with room temperature PBS, then with 37 DEG C of digestion 20-30min of Dispase.It is cloned to ESC After forming sphere, it is resuspended, is then added in low adherency culture plate (Corning company, article No. 3471), 37 with CDF12 culture medium DEG C, 5%CO2Embryoid body is formed after CMC model 1-3 days.
Cultivating the embryoid body, the specific method is as follows to fibrous cell's appearance: the embryoid body is inoculated in matrigel It is cultivated in coated 6 orifice plates, continues to cultivate 2 weeks to fibrous cell's appearance.
In the above method, the human pluripotent stem cells are that human embryo stem cell H9 cell line or people induce multi-potent stem cell.
It is a further object to provide the mesenchymas of the NRF2 genes amplification type prepared using the above method Stem cell.
The multipotential stem cell of the NRF2 genes amplification type prepared using the above method also belongs to protection model of the invention It encloses.
It is a still further object of the present invention to provide the mescenchymal stem cell of above-mentioned NRF2 genes amplification type or above-mentioned NRF2 bases Because of the new application of enhanced multipotential stem cell.
The present invention provides the more of the mescenchymal stem cell of above-mentioned NRF2 genes amplification type or above-mentioned NRF2 genes amplification type Can stem cell in following c1)-c5) and in it is any in application:
C1) the product of preparation resistance and/or delaying cell aging；
C2) tumorigenic product is resisted in preparation；
C3) product of pernicious tumor formation conversion is resisted in preparation；
C4 the product of cellular transplantation therapy) is prepared；
C5) the product of preparation regeneration and/or reparation damage blood vessel.
The last one purpose of the invention provides a kind of product.
The active constituent of product provided by the invention is the mescenchymal stem cell of above-mentioned NRF2 genes amplification type；
The function of the product be following m1)-m5) and in it is any:
M1) resistance and/or delaying cell aging；
M2 antitumorgienesis) is supported；
M3 pernicious tumor formation conversion) is resisted；
M4) cellular transplantation therapy；
M5 the regeneration and/or reparation of blood vessel) are damaged.
In above-mentioned application or the said goods,
It is described resistance and/or delaying cell aging be embodied in following d1)-d6) and in it is any:
D1) cell viability enhances under exogenous irritant stimulation；
D2) stronger proliferative capacity is showed in continuous passage incubation in vitro；
D3 the ability enhancing of Toxic Metabolites) is removed；
D4 it) is reduced with the expression of Identifying cellular senescence-associated genes；
D5) there are more complete nuclear structures；
D6) retention time is longer in human or animal body；
Any one of the pernicious tumor formation conversion of resistance is embodied in following e1)-e3):
E1) tumor ability of cell proliferation reduces；
E2 the growth ability that relevant non-anchor dependence) is formed to tumour reduces；
E3 the ability for) forming tumour in vivo reduces；
The cellular transplantation therapy is cell transplantation repairing and treating.
The present invention utilizes gene editing technology successful modification anti contravariance related gene for the first time, and only single encoding loci modification is just real The controllable active activation of existing endogenous adversity gene, obtains the genes amplification type stem cell of adverse-resistant characteristic raising, and by internal Experiment in vitro, which demonstrates genes amplification type stem cell, can resist adverse circumstance and cell ageing, have the function of more preferably tissue repair with And resist the ability of pernicious tumor formation conversion.Method of the invention solves validity and safety two in cellular transplantation therapy simultaneously Big crucial and bottleneck problem.
Detailed description of the invention
Fig. 1 is that present invention produces the multipotential stem cells of adversity gene NRF2 single site editor, and thus derive base Because of enhanced mescenchymal stem cell, the NRF2 activity in this cell obtains sustained activation.Wherein, A is the ideograph of gene editing； B is the sequencing result in the site NRF2 Gene A 245G；C is the form of the multipotential stem cell obtained and exempting from for internal triploblastica differentiation Epidemic disease Fluorescence Identification；D is the expression of stemness gene in multipotential stem cell；E is to break up related with MSC to nothing in obtained MSC The surface marker appraisal of pass；F is content analysis of the NRF2 albumen inside and outside nucleus in MSC；G is the downstream NRF2 target base The mRNA level in-site of cause；H is the protein expression situation of NRF2 and its crucial downstream target gene NQO1 and HO-1.
Fig. 2 is the characteristic that genes amplification type mescenchymal stem cell resists adverse circumstance and cell ageing.Wherein, A is exogenous stimulation The lower cell viability detection of object processing；B is MSC growth curve；C is SA- β-Gal coloration result；D is active o content detection；E is The result of aging correlation marker expression；F is the detection of cell Proliferation correlation marker Ki67；G is the inspection of nuclear membrane integrality It surveys.
Fig. 3 is the characteristic that genes amplification type mescenchymal stem cell resists vicious transformation.Wherein, A is external vicious transformation mould Formula figure；B is the growing state of the non-anchor dependence of MSC after vicious transformation；C is the internal one-tenth knurl ability of MSC after vicious transformation；D is The transverse and longitudinal tangential section of the long tumor part of mouse dyes identification.
Fig. 4 is the example transplanted genes amplification type mescenchymal stem cell and be applied to posterior-limb ischemia model restoration of blood flow.Wherein, A is retention ability of the MSC in muscle microenvironment；B is every posterior-limb ischemia mouse restoration of blood flow situation；C is different time points The representative picture of mouse leg.
Specific embodiment
Experimental method used in following embodiments is conventional method unless otherwise specified.
The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.
Quantitative test in following embodiments, is respectively provided with three repeated experiments, and results are averaged.
1, the culture medium prescription in following embodiments is as follows:
(1) CDF12 culture medium prescription:
DMEM/F12 culture medium (Invitrogen, 11320-033)；
0.1mM nonessential amino acid (Invitrogen, 11140-050)；
1mM GlutaMAX (Invitrogen, 35050-061)；
20% (volumn concentration) Knockout serum substitute (Invitrogen, N10828-028)；
1% (1g/100ml) penicillin/streptomycin (Invitrogen, 15070-063)；
55 μM of beta -mercaptoethanols (Invitrogen, 21985-023)；
10ng/ml people FGF2 (Joint Protein Central).
(2) mescenchymal stem cell (MSC) culture medium prescription:
MEM culture medium (Invitrogen, 12571071)；
10% (volumn concentration) fetal calf serum (Invitrogen, 10091148)；
1% (1g/100ml) penicillin/streptomycin (Invitrogen, 15070-063)；
10ng/ml recombinant human fibroblast growth factor (JPC, bFGF)；
MSC differential medium need to additionally add 5ng/ml TGF β (Humanzyme, HZ1131).
2, cell line is as follows:
Human embryo stem cell H9 cell line is WiCell Products, article No.: WA09 (H9)-DL-7.
Human embryonic kidney cell 293T system is purchased from ATCC, article No. CRL-3216.
3, human embryo stem cell H9 cell line cultural method is as follows:
(1) by H9 cell inoculation in advance cultivated by mitomycin (Sigma Co., USA's product, article No.: M0503) the culture of the mouse embryonic fibroblasts (U.S.'s Invitrogen Products, article No.: S1520-100) inactivated In plate, hESC's culture medium (CDF12 culture medium) and mouse embryonic fibroblasts co-incubation are used；
(2) by H9 cell inoculation in advance with extracellular matrix (qualified-Matrigel, U.S. BD Article No.: Biosciences product 354277) in coated culture plate, uses mTeSR culture medium (U.S. StemCell Technologies product) culture.
4, it is as follows to pack biomaterial used for virus:
(1) it is as follows to pack biomaterial used for recombined adhenovirus:
PCR2.1-TOPO carrier is Invitrogen Products.
Helper adenovirus carrier pCIHDAdGT8-4 carrier: it is detailed in " An HSV amplicon-based helper System for helper-dependent adenoviral vectors.Shuji Kubo, et al.BBRC.2003.307 (4): a 826-830 " text, the public can obtain from original text author or Institute of Biophysics, Academia Sinica.
116 cell of derived cell system of 293 system of Human embryonic's nephrocyte: it is detailed in " Improved system for helper-dependent adenoviral vector production.Palmer D.and Ng P.Molecular Therapy.2003.8 (5): 846-52. " one text, the public can obtain from original text author or Institute of Biophysics, Academia Sinica ?.
Helper adenovirus AdHPBGF35: it is detailed in " Genome Size and Structure Determine Efficiency of Postinternalization Steps and Gene Transfer of Capsid-Modified Adenovirus Vectors in a Cell-Type-Specific Manner.Dmitry M.Shayakhmetov, et Al., (18) Journal of Virology.2004.78: a 10009-10022. " text, the public can be from original text author or China Biophysics research institute, the academy of sciences obtains.
(2) it is as follows to pack biomaterial used for retrovirus:
Retroviral vector and packaging plasmid are purchased from Addgene, and article No. is as follows: pBABE-neo-hTERT (1774), PBABE-zeo-large T genomic (1778), pBABE-puro-HRAS V12 (1768), gag/pol (14887), VSV-G(8454)。
(3) it is as follows to pack biomaterial used for slow virus:
It is overexpressed the slow virus carrier plasmid of luciferase luciferase: being detailed in " SIRT6 safeguards human Mesenchymal stem cells from oxidative stress by coactivating NRF2.Pan et.al, Cell research. (2016) 26:190-205. " text, the public can obtain from Institute of Biophysics, Academia Sinica.
P53 strikes low slow virus carrier plasmid PLVTHM-shP53: being detailed in " PTEN deficiency reprogrammes human neural stem cells towards a glioblastoma stem cell-like phenotype.Duan Et.al .Nature communication. (2015) 10.1038. " text, the public can grind from Chinese Academy of Sciences's biophysics Study carefully and is obtained.
Slow virus packaging plasmid is purchased from Addgene, and article No. is as follows: psPAX (12260), pMD2.G (12259).
5, the fluorescent labeled antibody for flow cytometry sorting MSC is as follows:
The anti-human cell surface identification molecule CD90 antibody of fluorescein FITC label, BD BiosCiences, article No.: 555595。
The anti-human cell surface identification molecule CD73 antibody of fluorescein PE label, BD Biosciences, article No.: 550257。
The anti-human cell surface of fluorescein APC label identifies molecule CD105 antibody, BD Biosciences, article No.: 17- 1057-42。
Fluorescein APC marks isotype control Ab, BD Biosciences, article No.: 555751.
Fluorescein PE marks isotype control Ab, BD Biosciences, article No.: 555749.
Fluorescein FITC marks isotype control Ab, BD Biosciences, article No.: 555742.
6, as follows for the antibody of immunofluorescence:
Anti-human FOXA2 antibody, Cell Signaling Technology, article No.: 8186S.
Anti-human SMA antibody, Zhong Shan Golden Bridge, article No.: ZM-0003.
Anti-human TUJ1 antibody, Sigma, article No.: T2200.
Anti-human LAP2 antibody, BD Biosciences, article No.: 611000.
Anti-human Lamin B1 antibody, Santa Cruz Biotechnology, article No.: sc-6217.
Anti-human 67 antibody of Ki, Vector Laboratories, article No.: VP-RM04.
Anti-human P16 antibody, BD Biosciences, article No.: 550834.
Anti-human P21 antibody, Cell Signaling Technology, article No.: 2947.
Embodiment 1, adversity gene NRF2 targeting modification human pluripotent stem cell preparation
One, the preparation of the enhanced multipotential stem cell of NRF2
The present invention passes through to mankind's adversity gene NRF2 in multipotential stem cell (Pluripotent Stem Cell, PSC) Single site carry out targeting editor, make the 245th of the cDNA sequence of NRF2 gene (GeneBank ID:4780) by wild The base A of type sports bases G, and the 82nd of the amino acid sequence of NRF2 albumen becomes glycine (G) from glutamic acid (E), obtain Obtain the enhanced multipotential stem cell of NRF2.Specific step is as follows (specific steps are referring to Figure 1A):
1, the building of viral expression plasmids
It is obtained by PCR amplification across people first from RP11-483K11 BAC DNA library (BACPAC Resources) The genetic fragment of genoid group NRF2 the 1st and No. 2 introne (intron1-exon2-intron2) of gene.Then pass through fixed point Mutagenesis kit (Invitrogen, article No.: A13282) is mutated the 245th of the cDNA sequence that NRF2 gene is corresponded in the segment the The nucleotide site (A245G) of position sports bases G by the base A of wild type, and keeps other sequences constant, is mutated Segment afterwards, and by AscI the and SpeI restriction enzyme site of the segment insertion pCIHDAdGT8-4 carrier after mutation, it is recombinated Plasmid.
2, viral expression plasmids and helper plasmid cotransfection incasing cells obtain recombined adhenovirus particle
The recombinant plasmid obtained with PI-SceI (NEB) digestion step 1, obtains linearization plasmid, and by the linearization plasmid It is imported jointly with helper virus AdHPBGF35 in 116 cell of derived cell system of 293 system of human embryonic kidney cell and carries out recombinant adenovirus Poison packaging, and purified by ultracentrifugation and obtain recombined adhenovirus particle.
3, recombined adhenovirus particle infects aim cell
HESCs cell (H9) (1 × 10 is infected with recombined adhenovirus particle7A cell, viral dose are 15 bgal- Transducing units (btu), viral dose unit can be found in document " Palmer, D.J.&Ng, P. Physical and Infectious titers of helper-dependent adenoviral vectors:a method of direct Comparison to the adenovirus reference material.Mol Ther 10,792-798 (2004) " " Suzuki, K.et al.Highly efficient transient gene expression and gene targeting in primate embryonic stem cells with helper-dependent adenoviral Vectors.Proc Natl Acad Sci USA 105,13781- 13786 (2008) " the 2-4 days after infection, are added G418 (25~400g/ml, invitrogen Products) carries out positive screening, the 10-13 days after infection, is added 4 μM Ganciclovir (GANC, invitrogen Products) carries out negative screening.Finally the cell survived is carried out Sequencing identification (PCR primer be NRF2A245GseqF:ACCATTTGTGACTTTGCCCTTTAGTGACCTCTACCATC and NRF2A245GseqR:AACCTGCCATAACTTTCCCAAGAACTGA, sequencing primer aaaaacagaaaaaacttgaa), The cell that site is correctly edited on a NRF2 allele is obtained, NRF2 is denoted byAG/+HESC cell.
4, above-mentioned linearization plasmid is imported into NRF2 with helper virus AdHPBGF35 jointlyAG/+In hESC cell again into Row gene editing, and cell after editor is identified, the cell that site is correctly edited on two NRF2 allele is obtained, it will It is denoted as NRF2AG/AGThe enhanced multipotential stem cell of hESC cell, i.e. NRF2.
Two, the identification of the enhanced multipotential stem cell of NRF2
1, the sequencing identification of the enhanced multipotential stem cell of NRF2
Sequencing identification is carried out to the enhanced multipotential stem cell of NRF2.Show through sequencing identification: the enhanced multipotency of NRF2 is dry thin The site A245G of NRF2 gene occurs correctly to edit (Figure 1B) in born of the same parents, and two of the NRF2 gene in the enhanced adult cell of NRF2 The 245th of article homologue sports bases G by base A.
2, the Morphological Identification of the enhanced multipotential stem cell of NRF2
Morphological Identification, NRF2 are carried out to the enhanced multipotential stem cell of NRF2AG/AGThe Morphological Identification result of hESC such as Fig. 1 C It is shown.Furthermore it can be seen from the figure that the enhanced pluripotent cell of NRF2 still has, to be divided into inside and outside triploblastica in vivo thin The ability of born of the same parents.
3, the expression of multipotency stemness gene detects in the enhanced multipotential stem cell of NRF2
Respectively to wild type human embryonic stem cell H9 cell line (NRF2+/+)、NRF2AG/+HESC cell (NRF2AG/+ ) and NRF2 hESCAG/AGHESC cell (NRF2AG/AGHESC the table of expression multipotency stemness gene OCT4, SOX2, NANOG) It is detected up to level.Primer for PCR identification is as follows:
18S-F:GTAACCCGTTGAACCCCATT；
18S-R:CCATCCAATCGGTAGTAGCG；
OCT4-F:GGGTTTTTGGGATTAAGTTCTTCA；
OCT4-R:GCCCCCACCCTTTGTGTT:
SOX2-F:CAAAAATGGCCATGCAGGTT；
SOX2-R:AGTTGGGATCGAACAAAAGCTATT；
NANOG-F:ACAACTGGCCGAAGAATAGCA；
NANOG-R:GGTTCCCAGTCGGGTTCAC.
As a result as shown in figure iD.As can be seen from the figure: NRF2+/+、NRF2AG/+HESC and NRF2AG/AGHESC cell is equal Normal expression multipotency stemness gene OCT4, SOX2, NANOG.
The preparation and its Function detection of the enhanced mescenchymal stem cell of embodiment 2, NRF2
The enhanced multipotential stem cell of the NRF2 obtained in embodiment 1 is further divided into NRF2 enhanced and filled by the present invention Matter stem cell (the enhanced MSC of NRF2).And be experimentally confirmed: NRF2 obtains active activation in the enhanced MSC of NRF2, in vivo Degeneration-resistant, anti-cell aging is shown in vitro and resists the characteristic of vicious transformation.Specific step is as follows:
One, the preparation of the enhanced MSC of NRF2
1, by NRF2AG/AGHESC carries out embryoid body (EB) differentiation, the specific steps are as follows: prepares thin containing 300-500 Born of the same parents, uniform NRF2AG/AGHESC clone, is cleaned once with room temperature PBS, with Dispase (Invitrogen company, goods Number for 17105041) 37 DEG C of digestion 20-30min.After ESC Clone formation sphere, after being resuspended with CDF12 culture medium, it is added to low It adheres in culture plate (Corning company, article No. 3471), 37 DEG C, 5%CO2Embryoid body is formed after CMC model 1-3 days.
2, the embryoid body for obtaining step 1 is inoculated in matrigel (matrigel) (Invitrogen company) coated 6 hole It is cultivated in plate, continues to cultivate 2 weeks to fibrous cell's appearance.After primary passage, sorted using flow cytometry CD73, CD90 and CD105 therein are positive cell population, and the enhanced MSC of as NRF2 is denoted by NRF2AG/AG MSC。
By the NRF2 in above-mentioned stepsAG/AGHESC replaces with wild type human embryonic stem cell H9 cell line, other steps are not Become, Induction of committed differentiation obtains wild type mesenchymal cell and is denoted as NRF2+/+ MSC。
Two, the phenotypic evaluation and Function detection of the enhanced MSC of NRF2
1, the phenotypic evaluation of the enhanced MSC of NRF2
The NRF2 that step 1 is obtainedAG/AGMSC and NRF2+/+The surface marker of MSC is detected.
As a result as referring to figure 1E.As can be seen from the figure: the NRF2 that step 1 obtainsAG/AGMSC and NRF2+/+MSC is equal MSC special surface marker CD73, CD90 and CD105 can be expressed, without expressing unrelated CD34, CD43 and CD45.
2, in the enhanced MSC of NRF2 adversity gene NRF2 active activation
(1) NRF2 protein content in the enhanced MSC of NRF2
Respectively with NRF2AG/AGMSC and NRF2+/+MSC is for trying cell, and detection is for NRF2 protein content in examination cell.Specifically Steps are as follows: using RIPA cell pyrolysis liquid (the green skies, P0013B) cracking for trying cell, then being tried using BCA protein quantification Agent box (the green skies, P0010) measurement finally takes 20ug albumen to carry out Western blot real respectively for protein concentration in examination cell It tests.It the use of primary antibody is NRF2 (abcam, 62352), secondary antibody is goat anti-rabbit igg/HRP (Zhong Shan Golden Bridge, ZDR-5306).
As a result as shown in fig. 1H.As can be seen from the figure: NRF2AG/AGNRF2 protein content in MSC (the enhanced MSC of NRF2) It is apparently higher than NRF2+/+ MSC。
(2) nuclear localization
Respectively with NRF2AG/AGMSC and NRF2+/+MSC is to detect NRF2 albumen in cytoplasm and caryoplasm respectively for trying cell Content.Specific step is as follows: being extracted respectively using Nuclear extract and suppressor proteins extraction agent box (the green skies, P0028) Then cytoplasm and caryoplasm component protein take equal protein to carry out Western blot experiment respectively, and with cytoplasmic marker object β- Tubulin and caryoplasm marker Lamin B1 is control.
As a result as shown in fig. 1F.As can be seen from the figure: NRF2AG/AGNRF2 albumen in MSC (the enhanced MSC of NRF2) Content in cytoplasm and caryoplasm is above NRF2+/+ MSC。
(3) mRNA of adversity gene NRF2 downstream target gene and protein level detection in the enhanced MSC of NRF2
1) real-time quantitative PCR is tested
Respectively with NRF2AG/AGMSC and NRF2+/+MSC is to extract the RNA for trying cell and reverse transcription respectively for trying cell For cDNA, real-time quantitative PCR is carried out using following primer respectively, detection is for adversity gene NRF2 downstream target gene in examination cell: NQO1 gene, HO-1 gene, GCLC gene, GCLM gene, GR gene, TXN gene, TRXR1 gene expression quantity.
NQO1-F:CGCAGACCTTGTGATATTCCAG；
NQO1-R:CGTTTCTTCCATCCTTCCAGG:
HO1-F:AAGACTGCGTTCCTGCTCAAC；
HO1-R:AAAGCCCTACAGCAACTGTCG；
GCLC-F:GGATTTGGAAATGGGCAATTG；
GCLC-R:CTCAGATATACTGCAGGCTTGGAA；
GCLM-F:TGCAGTTGACATGGCCTGTT；
GCLM-R:TCACAGAATCCAGCTGTGCAA；
GSR-F:TTGTCGGGCTTGGAAGTCAG；
GSR-R:TGGTAGCCTACCGGGAACTG:
TXN-F:GTGAAGCAGATCGAGAGCAAG；
TXN-R:CGTGGCTGAGAAGTCAACTACTA；
TRXR1-F:GGGCAATTTATTGGTCCTCA；
TRXR1-R:GGTCTTTCACCAGTGGCAAT.
2) respectively with NRF2AG/AGMSC and NRF2+/+MSC is to extract for trying cell for the albumen in examination cell and progress Western blot experiment, detection is for NQO1 and HO-1 protein expression level in examination cell.And with cytoplasmic marker object β- Tubulin is control.It the use of antibody is NQO1 (Santa Cruz Biotechnology, 32793), HO-1 (ENZO, ADI- SPA-895-D)。
As a result as shown in Fig. 1 G and Fig. 1 H.As can be seen from the figure: NRF2AG/AGMSC (the enhanced MSC of NRF2) middle and lower reaches Target gene: NQO1 gene, HO-1 gene, GCLC gene, GCLM gene, GR gene, TXN gene and TRXR1 gene expression quantity It is above NRF2+/+MSC.And NRF2AG/AGNQO1 and HO-1 protein expression level is also above NRF2 in MSC+/+ MSC。
In conclusion NRF2 gene obtains constitutive activation after the modification of NRF2 single site.
3, the degeneration-resistant anti-cell senescence characteristics of the enhanced MSC of NRF2
(1) the high vigor under exogenous stimulation
Using including oxidative pressure, endoplasmic reticulum pressure, the exogenous irritant processing including DNA damage pressure and apoptotic stimulus MSC.Specific step is as follows: will be for trying cell NRF2AG/AGMSC and NRF2+/+MSC is laid on 96 orifice plates, respectively using following outer Source stimulant (being at the final concentration and purchase of exogenous irritant in bracket) stimulation was for examination cell 48 hours:
1) oxidative pressure: DMSO (0.1%, Sigma), PQ (2mM, Paraquat, Sigma), PX12 (50uM, Santa Cruz Technology), TBH (100uM, tert-Butyl hydroperoxide, Sigma), L-BSO (500uM, L- Buthionine-sulfoximine, Sigma)；
2) endoplasmic reticulum pressure: TM (6ug/mL, Tunicamycin, Sigma) and TG (1.5ug/mL, Thapsigargin, Sigma)；
3) DNA damage: 4NQO (100uM, 4-nitroquinoline N-oxide, Sigma) and AAT2 (50uM, Apoptosis Activator 2, TOCRIS)；
4) apoptosis: CCCP (100uM, Carbonyl cyanide 3-chlorophenylhydrazone, Sigma).
96 AQueous One Solution Cell Proliferation Kit of CellTiter is pressed after stimulation For the vigor of examination cell after (Promega, G3582) kit and its application method detection stimulation.It is directly thin to culture when detection 96 AQueous One Solution reagent of CellTiter is added in the culture medium of born of the same parents, after being incubated for 1 hour in cell incubator The absorbance value for detecting 490nm calculates versus cell vigor according to the numerical value of OD490.Versus cell vigor calculation formula are as follows: Log2(OD490(NRF2AG/AG)/OD490(NRF2+/+))。
The result shows that: under background level and incentive condition, the enhanced MSC of NRF2 all has stronger cell viability (figure 2A)。
(2) growth ability measures
Utilize the NRF2 of cell count statistics continuous passage cultureAG/AGMSC and NRF2+/+The growth ability of MSC.
As a result as shown in Figure 2 B.As can be seen from the figure: NRF2AG/AGMSC cell (the enhanced MSC of NRF2) multiplication rate It is apparently higher than NRF2+/+MSC cell shows the ability for significantly resisting cell ageing.
(3) SA- β-Gal is dyed
The dyeing of cell ageing beta galactosidase is that one kind is based on SA-beta-Gal (senescence- when aging Associated beta-galactosidase) activity level up-regulation and to senile cell or tissue carry out dyeing detection side Method.The NRF2 that step 1 is obtained respectivelyAG/AGMSC and NRF2+/+MSC carries out SA- β-Gal dyeing, and in common optics The aging situation of cell or tissue can be observed under microscope, and sun further is dyed to the SA- β-Gal in two groups of cells Property cells ratio carry out quantitative statistical analysis.Specific step is as follows:
Respectively with NRF2AG/AGMSC and NRF2+/+MSC is to use PBS for trying cell (early generation: the 5th generation, late generation: the 11st generation) Washing 1 time adds dyeing fixer (+0.2% glutaraldehyde of 2% formaldehyde), and room temperature fixes 5 minutes.Fixer is discarded, PBS is used 1ml dyeing working fluid is added in washing 1 time, every hole.Using X-Gal as substrate, under the beta galactosidase catalysis of senescence-specific Navy blue product can be generated.
As a result as shown in Figure 2 C, it can be seen from the figure that the NRF2 in late generation+/+MSC has an apparent blue, and early generation NRF2+/+The MSC and NRF2 in late generationAG/AGMSC (the enhanced MSC of NRF2) positive rate is very low.As it can be seen that the enhanced MSC's of NRF2 declines Old delay of progression.
(4) Toxic Metabolites content detection
Respectively with NRF2AG/AGMSC and NRF2+/+MSC be for examination cell (early for the EP: the 5 generation, evening is for the LP: the 11 generation), It is incubated for 30 minutes with 1 μM of oxygen radical probe DCFDA (Invitrogen, article No.: C6827), is examined using flow cytometer jointly It surveys DCFDA intensity (i.e. active o content in indicator cells).Detailed step can refer to Invitrogen company specification.
As a result as shown in Figure 2 D, NRF2AG/AGMSC (the enhanced MSC of NRF2) accumulates less activity in generation sooner or later Oxygen shows that the enhanced MSC of NRF2 can more effectively remove this Toxic Metabolites.
(5) aging gene detection of expression
Respectively with NRF2AG/AGMSC and NRF2+/+MSC be for examination cell (early for the EP: the 5 generation, evening is for the LP: the 11 generation), Protein expression situation of the Western blot experiment detection for aging cance high-expression gene p16, p21, GATA4 in examination cell.It uses Primary antibody is p16 (BD, 550834), P21 (Cell signaling, 2947), GATA4 (Santa cruz, SC-1237).It is corresponding Secondary antibody be goat anti-mouse igg/HRP (Zhong Shan Golden Bridge, ZDR-5307), goat anti-rabbit igg/HRP (Zhong Shan Golden Bridge, ZDR-5306) and Rabbit-anti sheep IgG/HRP (Zhong Shan Golden Bridge, ZDR-5308).
As a result as shown in Figure 2 E.It can be seen from the figure that and NRF2+/+MSC is compared, genes amplification type MSC (NRF2AG/AG MSC low-abundance aging related genes p16, p21 and GATA4) are expressed always.
(6) proliferative capacity detects
Respectively with NRF2AG/AGMSC and NRF2+/+MSC be for examination cell (early for the EP: the 5 generation, evening is for the LP: the 11 generation), Ki67 expression relevant to proliferation activity is detected by immunofluorescence staining.Specific step is as follows: being laid on circle for examination cell It is penetrating through 0.4%TritonX-100 after being fixed using 4% paraformaldehyde on slide.Penetrating cell is closed in donkey serum 1h, subsequent primary antibody are incubated overnight, and the use of primary antibody are Ki67 (Vector Laboratories, article No.: VP-RM04).Corresponding secondary antibody Cell picture is shot using laser confocal microscope after being incubated for 45 minutes.
As a result as shown in Figure 2 F.It can be seen from the figure that and NRF2+/+MSC is compared, NRF2AG/AG(NRF2 is enhanced by MSC MSC) higher Ki67 positive cell rate is all had in generation sooner or later.
(7) nuclear structures integrity detection
Respectively with NRF2AG/AGMSC and NRF2+/+MSC is to pass through for trying cell (early generation: the 5th generation, late generation: the 11st generation) The expression of immunofluorescence staining detection nuclear membrane albumen Lamin B1 and LAP2.Specific step is as follows: being laid on circle for examination cell It is penetrating through 0.4%TritonX-100 after being fixed using 4% paraformaldehyde on slide.Penetrating cell is closed in donkey serum 1h, subsequent primary antibody are incubated overnight, using primary antibody be LaminB1 (Abcam, article No.: 16048) and LAP2 (BD, article No.: 611000).Corresponding secondary antibody uses laser confocal microscope to shoot cell picture after being incubated for 45 minutes.
As a result as shown in Figure 2 G.As can be seen from the figure: and NRF2+/+MSC is compared, the NRF2 in late generationAG/AG MSC(NRF2 Enhanced MSC) (what arrow was signified in Fig. 2 G is nuclear membrane abnormal cell, can not after nuclear membrane protein staining for the cell of nuclear membrane exception See apparent nuclear membrane profile) number significantly reduces, show NRF2AG/AGMSC (the enhanced MSC of NRF2) has more complete cell Nuclear structure.
4, the enhanced MSC of NRF2 resists the characteristic of vicious transformation
(1)NRF2AG/AGTMSC and NRF2+/+The preparation of TMSC
Using external vicious transformation system, respectively to NRF2AG/AGMSC and NRF2+/+The tumorigenesis factor is transferred in MSC, it will be non- The MSC of tumor is converted into the MSC (transformed MSC, call TMSC in the following text) of tumor, respectively obtains NRF2AG/AGTMSC and NRF2+/+TMSC.Then detection tumour correlation properties.Specific step is as follows:
1) by retroviral vector plasmid pBABE-neo-hTERT, pBABE-zeo- needed for external vicious transformation system Large T genomic, pBABE-puro-HRAS V12 respectively with packaging plasmid gag/pol and VSV-G cotransfection to 293T In cell, culture supernatant is collected, and pass through ultracentrifugation purification of retrovirus particle.It will be needed for external vicious transformation system Slow virus carrier plasmid PLVTHM-shP53 is collected respectively with packaging plasmid psPAX and pMD.2G cotransfection into 293T cell Culture supernatant, and lentiviral particle is purified by ultracentrifugation.
2) NRF2 is infected respectively using the virus that purifying obtainsAG/AGMSC and NRF2+/+MSC.As shown in Figure 3A, MSC Vicious transformation includes lengthening of telomeres, and three aspect of tumor suppressor gene missing and oncogenic mutation, the process is by infecting 3 kinds of reverses Record virus and a kind of slow virus are realized.Slow virus can express green fluorescence GFP albumen simultaneously, while realize the visable indicia of cell. Specific operation process is in morning for pBABE-neo-hTERT, the pBABE-zeo- for successively infecting acquisition in step (1) in MSC Large T genomic and pBABE-puro-HRAS tri- kinds of retrovirus of V12.Since three kinds of viruses are respectively provided with neo, The resistance marker of zeo and puro, thus corresponding G418 (Invitrogen, 10131035) successively is used, zeocin Three kinds of drugs of (Invitrogen, R25001) and puromycin (Invitrogen, A1113803) carry out positive screening and obtain The cell that three kinds of virus is integrated is obtained, PLVTHM-shP53 slow virus is finally infected and reinforces the inhibition of tumor suppressor gene and the mark of GFP Note.NRF2 is respectively obtained through this stepAG/AGTMSC and NRF2+/+ TMSC。
(2) non-anchor dependence growth ability
Tumour cell can grow up to clone on the agar that can not be adhered to, and non-tumor cell then can not, therefore it is non-anchor according to Bad growth ability and tumour cell formation entity tumor are closely related.Respectively by NRF2AG/AGTMSC and NRF2+/+TMSC with The agarose (0.35%) of dissolved state is uniformly mixed, and is laid in Tissue Culture Dish rapidly, covers TMSC after agarose solidification Non-anchor dependence growth ability is observed in culture medium culture.
As a result as shown in Figure 3B: NRF2AG/AGTMSC its non-anchor dependence growth ability after vicious transformation is thin compared with wild type Weaken (Fig. 3 B) significantly after dysuria with lower abdominal colic.
(3) internal one-tenth knurl ability
Respectively by NRF2AG/AGTMSC and NRF2+/+TMSC (3 × 10^6 cell) is implanted into nude mice (strain: Balb/C Nude mice) the nearly joint of hind leg.It is unicellular that the TMSC of adhere-wall culture, which is digested, is resuspended in and is mixed with 20%Matrigel In PBS (Gibco, the 10010023) solution of (BD Biosciences, 354277), cell suspension is infused using ordinary syringe It injects in the muscle of the nearly joint of hind leg.After transplanting the 2-3 month, is swelled when obvious swollen object occurs in hind leg, put to death mouse.Cut hind leg Make to weigh in the balance, and calculates relative mass (relative mass=transplanting NRF2+/+Hind leg quality/transplanting NRF2 of TMSCAG/AG The hind leg quality of TMSC).
As a result as shown in figs. 3 c and 3d: it can be seen from the figure that relative mass is 2.73 ± 0.22, transplanting NRF2+/+ The hind leg quality of TMSC, which is noticeably greater than, transplants NRF2AG/AGThe hind leg quality of TMSC.Illustrate NRF2+/+TMSC can grow osteosarcoma Shape tumour, and NRF2AG/AGTMSC then thoroughly loses the ability to form tumour.
Application of the enhanced mescenchymal stem cell of embodiment 3, NRF2 in cellular transplantation therapy
Since the enhanced mescenchymal stem cell of NRF2 (the enhanced MSC of NRF2) that embodiment 2 obtains has degeneration-resistant, anti-cell The enhanced mescenchymal stem cell of the NRF2 obtained in embodiment 2 is used for carefully by aging and the tumorigenic characteristic of resistance, the present invention Born of the same parents' transplantation treatment.Specific step is as follows:
One, the enhanced MSC of NRF2 is transplanted to the tibialis anterior of mouse
1, respectively to NRF2AG/AGMSC and NRF2+/+MSC carries out luciferase label.Specific step is as follows: will be overexpressed The slow virus carrier plasmid of luciferase luciferase is thin to 293T with slow virus packaging plasmid psPAX and pMD2.G cotransfection In born of the same parents, culture supernatant is collected, and pass through ultracentrifugation purified virus particles.The virus infection NRF2 obtained using purifyingAG/AG MSC and NRF2+/+MSC respectively obtains the NRF2 of luciferase labelAG/AGMSC and NRF2+/+MSC；
2, the NRF2 for respectively marking luciferaseAG/AGMSC and NRF2+/+MSC (1 × 10^6 cell) is transplanted to small In the tibialis anterior of mouse, the MSC that leg retains is detected using living animal imager after 7 days.
As a result as shown in Figure 4 A, NRF2AG/AGMSC (the enhanced MSC of NRF2) is compared with NRF2+/+MSC can be retained more long.
Two, the enhanced MSC of NRF2 is transplanted to the immunodeficient mouse muscle of posterior-limb ischemia
Respectively by NRF2AG/AGMSC and NRF2+/+MSC is transplanted in the immunodeficient mouse muscle of posterior-limb ischemia, is utilized The recovery situation of 0th, 4,8,12,16 day mouse hind leg blood flow after laser Doppler flowmetry detection transplanting.Simultaneously by PBS solution (control) ((Gibco, 10010023)) is as control.
As a result as shown in Figure 4 B and 4C, PBS solution or transplanting NRF2 are relatively injected+/+MSC is compared, and transplants NRF2AG/AG MSC (the enhanced MSC of NRF2) can restore the blood flow of impaired hind leg faster, show NRF2AG/AGMSC takes part in blood vessel after damage Regeneration and reparation.

Claims (11)

1. a kind of preparation method of mescenchymal stem cell, includes the following steps:
(1) it is glycine by the 82nd glutamic acid mutation of the NRF2 albumen in vitro human pluripotent stem cells, obtainsNRF2 The multipotential stem cell of genes amplification type；
(2) to describedNRF2The multipotential stem cell of genes amplification type is oriented induction differentiation, obtainsNRF2Genes amplification type Mescenchymal stem cell；
The human pluripotent stem cells are that human embryo stem cell H9 cell line or people induce multi-potent stem cell.
2. according to the method described in claim 1, it is characterized by: in step (1), it is described will be in vitro human pluripotent stem cells NRF2 albumen the 82nd glutamic acid mutation be glycine method be byNRF2245th base A of gene is mutated For bases G.
3. according to the method described in claim 2, it is characterized by: described willNRF2245th base A of gene is sported The method of bases G is genome fixed point editor；
The method of the genome fixed point editor can be for ZFN is edited, TALEN is edited, CRISPR/Cas9 is edited or HdADV is mediated Fixed point editor.
4. according to the method described in claim 3, it is characterized by: the method for genome fixed point editor is HdADV mediation Fixed point editor.
5. method according to any one of claims 1-4, it is characterised in that:
In step (2), the method for the Induction of committed differentiation includes the following steps:
(b1) willNRF2The multipotential stem cell of genes amplification type carries out embryoid body differentiation, obtains embryoid body；
(b2) embryoid body is cultivated to fibrous cell's appearance；Using secondary culture, wherein CD73, CD90, CD105 are sorted It is positive cell population, it is as describedNRF2The mescenchymal stem cell of genes amplification type.
6. being prepared using any the method in claim 1-5NRF2The mescenchymal stem cell of genes amplification type.
7. being prepared using any the method in claim 1-5NRF2The multipotential stem cell of genes amplification type.
8. as claimed in claim 6NRF2The mescenchymal stem cell of genes amplification type is as claimed in claim 7NRF2Gene increases The multipotential stem cell of strong type is in following c1)-c5) in it is any in application:
C1) the product of preparation resistance and/or delaying cell aging；
C2) tumorigenic product is resisted in preparation；
C3) product of pernicious tumor formation conversion is resisted in preparation；
C4 the product of cellular transplantation therapy) is prepared；
C5) the product of preparation regeneration and/or reparation damage blood vessel.
9. application according to claim 8, it is characterised in that:
It is described resistance and/or delaying cell aging be embodied in following d1)-d6) and in it is any:
D1) cell viability enhances under exogenous irritant stimulation；
D2) stronger proliferative capacity is showed in continuous passage incubation in vitro；
D3 the ability enhancing of Toxic Metabolites) is removed；
D4 it) is reduced with the expression of Identifying cellular senescence-associated genes；
D5) there are more complete nuclear structures；
D6) retention time is longer in human or animal body；
Any one of the pernicious tumor formation conversion of resistance is embodied in following e1)-e3):
E1) tumor ability of cell proliferation reduces；
E2 the growth ability that relevant non-anchor dependence) is formed to tumour reduces；
E3 the ability for) forming tumour in vivo reduces；
The cellular transplantation therapy is cell transplantation repairing and treating.
10. a kind of product, active constituent is as claimed in claim 6NRF2The mescenchymal stem cell of genes amplification type；
The function of the product be following m1)-m5) and in it is any:
M1) resistance and/or delaying cell aging；
M2 antitumorgienesis) is supported；
M3 pernicious tumor formation conversion) is resisted；
M4) cellular transplantation therapy；
M5 the regeneration and/or reparation of blood vessel) are damaged.
11. product according to claim 10, it is characterised in that:
It is described resistance and/or delaying cell aging be embodied in following d1)-d6) and in it is any:
D1) cell viability enhances under exogenous irritant stimulation；
D2) stronger proliferative capacity is showed in continuous passage incubation in vitro；
D3 the ability enhancing of Toxic Metabolites) is removed；
D4 it) is reduced with the expression of Identifying cellular senescence-associated genes；
D5) there are more complete nuclear structures；
D6) retention time is longer in human or animal body；
Any one of the pernicious tumor formation conversion of resistance is embodied in following e1)-e3):
E1) tumor ability of cell proliferation reduces；
E2 the growth ability that relevant non-anchor dependence) is formed to tumour reduces；
E3 the ability for) forming tumour in vivo reduces；
The cellular transplantation therapy is cell transplantation repairing and treating.
CN201611192461.9A 2016-12-21 2016-12-21 A kind of preparation method of human pluripotent stem cells that are while resisting cell ageing and vicious transformation Active CN106591228B (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
CN201611192461.9A CN106591228B (en) 2016-12-21 2016-12-21 A kind of preparation method of human pluripotent stem cells that are while resisting cell ageing and vicious transformation
PCT/CN2017/080393 WO2018113145A1 (en) 2016-12-21 2017-04-13 Method for preparing human pluripotent stem cells for resisting both cellular senescence and malignant transformation
JP2018549154A JP2020501501A (en) 2016-12-21 2017-04-13 Method for producing human pluripotent stem cells simultaneously resistant to cell senescence and malignant transformation

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201611192461.9A CN106591228B (en) 2016-12-21 2016-12-21 A kind of preparation method of human pluripotent stem cells that are while resisting cell ageing and vicious transformation

Publications (2)

Publication Number Publication Date
CN106591228A CN106591228A (en) 2017-04-26
CN106591228B true CN106591228B (en) 2019-06-18

Family

ID=58602284

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201611192461.9A Active CN106591228B (en) 2016-12-21 2016-12-21 A kind of preparation method of human pluripotent stem cells that are while resisting cell ageing and vicious transformation

Country Status (3)

Country Link
JP (1) JP2020501501A (en)
CN (1) CN106591228B (en)
WO (1) WO2018113145A1 (en)

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109097333B (en) * 2018-07-17 2019-07-23 杭州观梓健康科技有限公司 It resists cell ageing and extends the mescenchymal stem cell and its preparation method and application of blood glucose-control effect time-histories
CN109055428A (en) * 2018-09-19 2018-12-21 上海市第人民医院 A kind of recombined glandulae correlation viral vectors and the preparation method and application thereof
CN111257565A (en) * 2018-12-03 2020-06-09 上海细胞治疗集团有限公司 Detection kit and detection method for aged cells
CN112280800B (en) * 2020-10-19 2022-06-07 上海市东方医院（同济大学附属东方医院） Construct and application thereof in preparation of medicines for tracing and removing aged cells of animals
CN112941106B (en) * 2021-03-15 2022-03-15 安可来(重庆)生物医药科技有限公司 Method for delaying mesenchymal stem cell senescence through FOXP1 gene editing and mutation

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011083637A1 (en) * 2010-01-07 2011-07-14 財団法人東京都医学総合研究所 Therapeutic agent for hepatic disorder
CN102686724A (en) * 2009-10-27 2012-09-19 财团法人首尔大学校产学协力团 Method for producing mesenchymal stem cells from human pluripotent stem cells, and mesenchymal stem cells produced by same
CN103740757A (en) * 2014-01-21 2014-04-23 中国科学院生物物理研究所 Method for preparing pig neural stem cells by reprogramming
CN104419683A (en) * 2013-09-10 2015-03-18 中国科学院生物物理研究所 Method for preparing autologous induced pluripotent stem cells of patient with Fanconi anemia and application of method
CN104726496A (en) * 2015-03-27 2015-06-24 中国科学院生物物理研究所 Multipotent stem cells carrying human adult premature senility syndrome gene mutations and preparation method thereof
CN104877967A (en) * 2015-05-26 2015-09-02 中山大学附属第三医院 Cell strain MSCs for overexpression of Nrf2 gene as well as preparation method and application of cell strain MSCs

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102686724A (en) * 2009-10-27 2012-09-19 财团法人首尔大学校产学协力团 Method for producing mesenchymal stem cells from human pluripotent stem cells, and mesenchymal stem cells produced by same
WO2011083637A1 (en) * 2010-01-07 2011-07-14 財団法人東京都医学総合研究所 Therapeutic agent for hepatic disorder
CN104419683A (en) * 2013-09-10 2015-03-18 中国科学院生物物理研究所 Method for preparing autologous induced pluripotent stem cells of patient with Fanconi anemia and application of method
CN103740757A (en) * 2014-01-21 2014-04-23 中国科学院生物物理研究所 Method for preparing pig neural stem cells by reprogramming
CN104726496A (en) * 2015-03-27 2015-06-24 中国科学院生物物理研究所 Multipotent stem cells carrying human adult premature senility syndrome gene mutations and preparation method thereof
CN104877967A (en) * 2015-05-26 2015-09-02 中山大学附属第三医院 Cell strain MSCs for overexpression of Nrf2 gene as well as preparation method and application of cell strain MSCs

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
"Genetic variation in the Nrf2 promoter associates with defective spermatogenesis in humans";Bolan Yu et al.;《J Mol Med》;20120531;第90卷;第1333-1342页 *
"Genetic Variations and Haplotype Structures of Transcriptional Factor Nrf2 and Its Cytosolic Reservoir Protein Keap1 in Japanese";Hiromi FUKUSHIMA-UESAKA et al.;《Drug Metab. Pharmacokinet.》;20071231;第22卷(第3期);第212-219页 *
"Molecular Mechanisms Activating the Nrf2-Keap1 Pathway of Antioxidant Gene Regulation";MAKOTO KOBAYASHI et al.;《ANTIOXIDANTS & REDOX SIGNALING》;20051231;第7卷(第3&4期);第385-394页 *
"Nrf2:INrf2 (Keap1) signaling in oxidative stress";James W. Kaspar et al.;《Free Radical Biology&Medicine》;20090807;第47卷;第1304-1309页 *
"Nrf2–Keap1 defines a physiologically important stress response mechanism";Hozumi Motohashi et al.;《TRENDS in Molecular Medicine》;20041006;第10卷(第11期);第549-557页 *
"抗氧化应激转录因子-Nrf2 的研究进展";林晓萍等;《中国病理生理杂志》;20111231;第27卷(第6期);第1234-1239页 *

Also Published As

Publication number Publication date
CN106591228A (en) 2017-04-26
JP2020501501A (en) 2020-01-23
WO2018113145A1 (en) 2018-06-28

Similar Documents

Publication Publication Date Title
CN106591228B (en) A kind of preparation method of human pluripotent stem cells that are while resisting cell ageing and vicious transformation
US8673633B2 (en) Method for producing induced pluripotent stem cells with high efficiency and induced poluripotent stem cells prouced thereby
KR20080056181A (en) Method of deriving progenitor cell line
Pedroni et al. Photobiomodulation therapy and vitamin C on longevity of cell sheets of human dental pulp stem cells
CN112920989A (en) Liver organoid model, establishment method and application thereof, and pharmaceutical composition for treating hepatocyte iron death
CN104419683A (en) Method for preparing autologous induced pluripotent stem cells of patient with Fanconi anemia and application of method
CN108774203A (en) A kind of compound delaying mammalian cell and body aging and its application
CN104726496B (en) Carry the multipotential stem cell and preparation method of mankind's adult early ageing disease gene mutation
JP5653223B2 (en) Generation of continuous cell lines
WO2010099643A1 (en) Method for promoting somatic cells proliferation
KR20080016888A (en) Method for transfer of gene into fat cell or progenitor fat cell
CN104126005A (en) Induced pluripotent stem cells prepared from human kidney-derived cells
JP2007000077A (en) Method for serum-free culture of adherent animal cell and culture medium for serum-free culture of adherent animal cell
JP6960535B2 (en) Human mesenchymal stem cells capable of delaying cellular senescence and resisting malignant transformation, their preparation methods and use
CN105441481B (en) A kind of preparation method of SIRTUIN6 gene delection human mesenchymal stem cells
CN109852587B (en) Preparation method of human Kekan syndrome specific adult stem cells
Crawford et al. Identification of murine endogenous xenotropic retrovirus in cultured multicellular tumour spheroids from nude‐mouse‐passaged nasopharyngeal carcinoma
WO2019183042A1 (en) Autologous mitochondrial extraction and expansion
CN109762845A (en) The mescenchymal stem cell model and its construction method and application that RAP1 function is lost
EP4144835A1 (en) Method for culturing cell population containing cartilage-derived tie2-positive cells, and use of said method
CN110628824B (en) Construction method and application of DJ-1 function-loss cell model
KR101211962B1 (en) Generation composition for induced pluripotent stem cells with Bmi1, G9aHMTase inhibitor and DMNT inhibitor treatment and method of manufacturing induced pluripotent stem cells using the same
KR20160126734A (en) A method for producing autoimmune disease patient-specific induced pluripotent stem cell and a use thereof
CN101744808A (en) New application of ascorbic acid
WO2011145615A1 (en) Nucleic acid for production of pluripotent stem cell

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant