CN106591228A - Production method of human multipotent stem cells for simultaneously preventing cell ageing and malignant transformation - Google Patents

Abstract

The invention discloses a production method of NRF2 gene-enhanced mesenchymal stem cells for simultaneously preventing cell ageing and malignant transformation The method comprises the following steps: successfully reconstructing an anti-adversity related gene by using a gene editing technology for the first time, and modifying only one coding site to realize controllable active activation of an endogenous anti-adversity gene to obtain gene-enhanced mesenchymal stem cells with improved anti-adversity. In vivo and in vitro experiments verify that the gene-enhanced stem cells can prevent adversity and cell ageing, and have good tissue restoration function and malignant tumor transformation resisting ability. The method also solves two key and bottleneck problems of the effectiveness and the safety in cell transplantation therapy.

Description

It is a kind of while resisting the preparation of the human pluripotent stem cells of cell ageing and vicious transformation Method

Technical field

The invention belongs to biological technical field, is related to a kind of while the people for resisting cell ageing and vicious transformation is how competent thin The preparation method of born of the same parents.

Background technology

Cellular transplantation therapy is the developing direction of regenerative medicine field most prospect and potentiality in recent years.Cell transplantation is intended to Supplement is substituted in vivo because of caused by the factors such as the disease or aging cell exhausted or lost normal function, the cell of transplanting Normal function, recovery organization homeostasiss survived and played in vivo, and then tissue repair and regeneration realized.Although cell transplantation is controlled Treat and splendid therapeutic effect is given expression at aspects such as Bone Marrow Stem Cells Transplantation in Treating leukemia, but which widely should With the challenge for still facing many problems.At present, the principal element for limiting cellular transplantation therapy concentrates on effectiveness and safety two Aspect.

Can the effectiveness of cellular transplantation therapy be mainly reflected in the quality before graft transplantation and survive after entering in vivo Integrate and play regeneration function.On the one hand, there is certain " life-span " in incubation in vitro in graft, is embodied in and holds It is continuous that cell senescence (cellular senescence) state is quickly entered after limited continuous passage by replicating pressure influence, Stop propagation and lose function.On the other hand, the position of cell transplantation is generally located in the tissue microenvironment of disease or aging, its In inflammatory factor, unwanted metabolic products etc. can damage external source graft.Cell can be all caused to occur in terms of the above two serious Feature fails, and causes to transplant inefficiency.The safety of cellular transplantation therapy is concentrated mainly on the tumorigenesis wind after long-term engraftment Danger.Cellular transplant is persistently under pressure in sick body stress, and genome may become extremely unstable, if in oncogene or suppression cancer Undergo mutation on gene, cancer may be developed into, form potential safety hazard.

The efficiency of cellular transplantation therapy how is improved by specific intervention means, tumorigenesis risk is reduced always as far as possible Since be all that regenerative medicine being capable of wide variety of crucial problem.However, not yet developing simple and effective side so far Method overcomes this technical bottleneck.The current trial for improving cell transplantation effect is concentrated mainly on and improves transplantation site microenvironment and increasing In terms of strong graft " degeneration-resistant " characteristic two.Many researchs are by supplementing in the sick body microenvironment of unfavorable cells play normal function The mode of external source " nutrition and protective factors " is improving transplantation effect, but the method is only capable of improving transplanting environment in a short time, moves Plant the poor prognosis outstanding problems such as recurrence.In contrast to this, improve " endogenous cause of ill " of graft by ad hoc approach, that is, strengthen transplanting material The improvement for expecting itself intrinsic opposing adverse circumstance ability to realize transplantation effect is more direct and long-acting means.Lack at present Number research shows to import resistance relevant protein, specific signal in regulating cell using slow viruss or retroviral vector Path or gene expression, strengthen opposing of the cell to adverse circumstance, and then realize the lifting of cellular transplantation therapy effect.Although a series of Preclinical study demonstrates the feasibility for improving the intrinsic adverse-resistant characteristic of cell, but the gene regulation of integrated viral vector mediation must So there is the random integration of genome, gene mutation increased risk, safety cause anxiety, this largely reducing its clinically should With value.

The development of gene target editing technique has greatly promoted the progress of cellular transplantation therapy.This technology causes people The genetic code on genome can be accurately edited, it is existing at present to correct disease cells using gene target editing technique in a large number The case of pathogenic mutation is reported.The gene correction cell Jing amplification in vitros for recovering normal function can be used for autotransplantation, be Excellent material in cellular transplantation therapy.

The content of the invention

It is an object of the present invention to provide a kind of while resisting the NRF2 genes amplification types of cell ageing and vicious transformation Mescenchymal stem cell preparation method.

The preparation method of the mescenchymal stem cell that the present invention is provided comprises the steps：

(1) by the glutamic acid mutation of the 82nd of the NRF2 albumen in vitro human pluripotent stem cells be glycine, obtain The pluripotent stem cell of NRF2 genes amplification types；

(2) induction differentiation is oriented to the pluripotent stem cell of the NRF2 genes amplifications type, obtains NRF2 genes amplifications The mescenchymal stem cell of type.

In said method, in step (1), the paddy of the 82nd of the NRF2 albumen by vitro human pluripotent stem cells Histidine mutations are that base A of the 245th of NRF2 genes is sported bases G for the method for glycine；The NRF2 genes 245th the 245th for NRF2 gene coding regions.

In said method, the method that base A of described the 245th by NRF2 genes sports bases G is fixed for genome Point editor；

The method of the genome fixed point editor can be edited for ZFN, TALEN is edited, CRISPR/Cas9 is edited or HdADV The fixed point editor of mediation；The method of the genome fixed point editor is specially the fixed point editor of HdADV mediations.

In an embodiment of the present invention, the fixed point editor of the HdADV mediations can realize by the following method：

The acquisition of the first step, mutant fragments

By in the genetic fragment of human genome NRF2 the 1st and No. 2 intron (intron1-exon2-intron2) of gene The nucleotide site of the 245th of the cDNA sequence of correspondence NRF2 genes, sports bases G by base A of wild type, and keeps Other sequences are constant, the fragment after being mutated；

The structure of second step, viral expression plasmids

By in AscI the and SpeI restriction enzyme sites of the fragment insertion pCIHDAdGT8-4 carriers after the mutation, recombinated Plasmid.

3rd step, viral expression plasmids and helper plasmid cotransfection incasing cellss obtain recombinant adenoviruss granule

With recombiant plasmid described in PI-SceI (NEB) enzyme action, linearization plasmid is obtained, and by the linearization plasmid with auxiliary Help viral AdHPBGF35 recombinant adenoviruss packaging to be carried out in importing jointly incasing cellss, obtain recombinant adenoviruss granule；The bag Dress cell is specially 116 cell of derived cell system that human embryonic kidney cell 293 is；

4th step, recombinant adenoviruss granule infection aim cell

Human pluripotent stem cells are infected with recombinant adenoviruss granule, through screening, obtain site on a NRF2 allele The cell of correct editor, is denoted by NRF2^AG/+HESC cells；

5th step, the linearization plasmid and the helper viruses AdHPBGF35 are imported into the NRF2 jointly^AG/+hESC Carry out gene editing in cell again, and cell after editor is identified, obtain site on two NRF2 allele correct The cell of editor, the as pluripotent stem cell of NRF2 genes amplifications type.

In said method, in step (2), the method for the Induction of committed differentiation comprises the steps：

(b1) pluripotent stem cell of NRF2 genes amplification types is carried out into embryoid body differentiation, obtains embryoid body；

(b2) cultivate the embryoid body to occur to fibrous cell；Again through Secondary Culture, sorting wherein CD73, CD90, CD105 is the cell population of the positive, the mescenchymal stem cell of as described NRF2 genes amplifications type.

In said method, the concrete grammar of the embryoid body differentiation is as follows：Prepare equal containing 300-500 cell, size One NRF2^AG/AGHESC is cloned, with room temperature PBS once, then with 37 DEG C of Dispase digestion 20-30min.Treat that ESC is cloned Formed spheroid after, it is resuspended with CDF12 culture medium, be then added to it is low adhesion culture plate (Corning companies, article No. 3471) in, 37 DEG C, 5%CO₂CMC model forms embryoid body after 1-3 days.

Cultivate the embryoid body as follows to the concrete grammar that fibrous cell occurs：The embryoid body is inoculated in into matrigel Cultivated in coated 6 orifice plate, continue culture and occur to fibrous cell for 2 weeks.

In said method, the human pluripotent stem cells are human embryo stem cell or people's induced multi-potent stem cell.

In said method, the human embryo stem cell is specially human embryo stem cell H9 cell lines.

It is a further object to provide the mesenchyme of the NRF2 genes amplification types prepared using said method Stem cell.

The pluripotent stem cell of the NRF2 genes amplification types prepared using said method falls within the protection model of the present invention Enclose.

It is a still further object of the present invention to provide the mescenchymal stem cell of above-mentioned NRF2 genes amplifications type or above-mentioned NRF2 bases Because of the new application of the pluripotent stem cell of enhancement mode.

The invention provides the mescenchymal stem cell of above-mentioned NRF2 genes amplifications type or above-mentioned NRF2 genes amplifications type is more Can stem cell in following c1)-c5) and in application in any one：

C1) prepare the product of opposing and/or delaying cell aging；

C2) prepare the tumorigenic product of opposing；

C3) prepare the pernicious product into tumor conversion of opposing；

C4) prepare the product of cellular transplantation therapy；

C5) prepare regeneration and/or repair the product of injured blood vessel.

Last purpose of the invention provides a kind of product.

The active component of the product that the present invention is provided is the mescenchymal stem cell of above-mentioned NRF2 genes amplifications type；

The function of the product be following m1)-m5) and in any one：

M1) opposing and/or delaying cell aging；

M2) to antitumorgienesis；

M3) resist pernicious into tumor conversion；

M4) cellular transplantation therapy；

M5) the regeneration and/or reparation of injured blood vessel.

In above-mentioned application or the said goods,

It is described opposing and/or delaying cell aging be embodied in following d1)-d6) and in any one：

D1) under exogenous irritant stimulation, cell viability strengthens；

D2) higher multiplication capacity is showed in continuous passage incubation in vitro；

D3 the ability for) removing Toxic Metabolites strengthens；

D4) reduce with the expression of Identifying cellular senescence-associated genes；

D5) with more complete nuclear structures；

D6) retention time is longer in the human or animal body；

It is described opposing it is pernicious into tumor conversion is embodied in following e1)-e3) and in any one：

E1) tumor ability of cell proliferation is reduced；

E2 the energy for growth reduction that related an active non-anchor is relied on) is formed to tumor；

E3 the ability for) forming tumor in vivo is reduced；

The cellular transplantation therapy is cell transplantation repairing and treating.

The present invention utilizes gene editing technology successful modification anti contravariance related gene first, and only single encoding loci modification is just real The controllable active activation of existing endogenous adversity gene, obtains the genes amplification type stem cell of adverse-resistant characteristic raising, and by internal Experiment in vitro demonstrates genes amplification type stem cell and can resist adverse circumstance and cell ageing, with more preferably tissue repair function with And resist the pernicious ability into tumor conversion.The method of the present invention solves effectiveness and safety two in cellular transplantation therapy simultaneously A big crucial and bottleneck difficult problem.

Description of the drawings

Fig. 1 is the pluripotent stem cell that present invention produces adversity gene NRF2 single site editors, and thus derives base Because of enhancement mode mescenchymal stem cell, the NRF2 activity in this cell obtains sustained activation.Wherein, ideographs of the A for gene editing； Sequencing results of the B for NRF2 Gene As 245G site；C is exempting from for the form and internal triploblastica differentiation of the pluripotent stem cell for obtaining Epidemic disease Fluorescence Identification；D is the expression of dryness gene in pluripotent stem cell；E is relevant with MSC to nothing in the MSC that differentiation is obtained The surface marker appraisal of pass；F is content analysis of the NRF2 albumen inside and outside nucleus in MSC；G is NRF2 downstreams target base The mRNA level in-site of cause；H is the protein expression situation of NRF2 and its crucial downstream target gene NQO1 and HO-1.

Fig. 2 is the characteristic that genes amplification type mescenchymal stem cell resists adverse circumstance and cell ageing.Wherein, A is exogenous stimulation The lower cell viability detection of thing process；B is MSC growth curves；C is SA- β-Gal coloration results；D is detected for active o content；E is The result of aging mark of correlation thing expression；F is the detection that cell breeds mark of correlation thing Ki67；G is examined for nuclear membrane integrity Survey.

Fig. 3 is the characteristic that genes amplification type mescenchymal stem cell resists vicious transformation.Wherein, A is external vicious transformation mould Formula figure；B is the growing state of MSC an active non-anchor dependence after vicious transformation；C is the internal one-tenth knurl ability of MSC after vicious transformation；D is The transverse and longitudinal section statining identification of the long tumor part of mice.

Fig. 4 is to transplant the example that genes amplification type mescenchymal stem cell is applied to posterior-limb ischemia model restoration of blood flow.Wherein, A is retention abilities of the MSC in muscle microenvironment；B is every posterior-limb ischemia mice restoration of blood flow situation；C is different time points The representative picture of mice leg.

Specific embodiment

Experimental technique used in following embodiments if no special instructions, is conventional method.

In following embodiments, material used, reagent etc., if no special instructions, commercially obtain.

Quantitative test in following embodiments, is respectively provided with three repetitions and tests, results averaged.

1st, the culture medium prescription in following embodiments is as follows：

(1) CDF12 culture medium prescriptions：

DMEM/F12 culture medium (Invitrogen, 11320-033)；

0.1mM non essential amino acid (Invitrogen, 11140-050)；

1mM GlutaMAX (Invitrogen, 35050-061)；

20% (volumn concentration) Knockout serum substitutes (Invitrogen, N10828-028)；

1% (1g/100ml) penicillin/streptomycin (Invitrogen, 15070-063)；

55 μM of beta -mercaptoethanols (Invitrogen, 21985-023)；

10ng/ml people FGF2 (Joint Protein Central).

(2) mescenchymal stem cell (MSC) culture medium prescription：

MEM culture medium (Invitrogen, 12571071)；

10% (volumn concentration) hyclone (Invitrogen, 10091148)；

1% (1g/100ml) penicillin/streptomycin (Invitrogen, 15070-063)；

10ng/ml recombinant human fibroblast growth factors (JPC, bFGF)；

MSC division culture mediums need to additionally add 5ng/ml TGF β (Humanzyme, HZ1131).

2nd, cell line is as follows：

Human embryo stem cell H9 cell lines are WiCell Products, article No.：WA09(H9)-DL-7.

Human embryonic kidney cell 293T systems are purchased from ATCC, article No. CRL-3216.

3rd, human embryo stem cell H9 cell lines cultural method is as follows：

(1) H9 cells is seeded to and cultivated through mitomycin (Sigma Co., USA's product, article No. in advance：M0503) Mouse embryo fibroblasts (U.S.'s Invitrogen Products, the article No. of inactivation：S1520-100, in culture plate), make With hESC's culture medium (CDF12 culture medium) and mouse embryo fibroblasts co-cultivation；

(2) H9 cells are seeded in advance with extracellular matrix (qualified-Matrigel, U.S. BD Biosciences products, article No.：354277) in coated culture plate, using mTeSR culture medium (U.S. StemCell Technologies products) culture.

4th, biomaterial used by virus packaging is as follows：

(1) biomaterial used by recombinant adenoviruss packaging is as follows：

PCR2.1-TOPO carriers are Invitrogen Products.

Helper adenovirus carrier pCIHDAdGT8-4 carriers：Refer to " An HSV amplicon-based helper system for helper-dependent adenoviral vectors.Shuji Kubo,et al.BBRC.2003.307 (4):826-830 " one is literary, and the public can be obtained from original text author or Institute of Biophysics, Academia Sinica.

116 cell of derived cell system that Human embryonic's nephrocyte 293 is：Refer to " Improved system for helper-dependent adenoviral vector production.Palmer D.and Ng P.Molecular Therapy.2003.8(5):846-52. " one is literary, and the public can be obtained from original text author or Institute of Biophysics, Academia Sinica .

Helper adenovirus AdHPBGF35：Refer to " Genome Size and Structure Determine Efficiency of Postinternalization Steps and Gene Transfer of Capsid-Modified Adenovirus Vectors in a Cell-Type-Specific Manner.Dmitry M.Shayakhmetov,et al.,Journal of Virology.2004.78(18):10009-10022. " one is literary, and the public can be from original text author or China Academy of science's biophysicss institute is obtained.

(2) biomaterial used by retrovirus packaging is as follows：

Retroviral vector and packaging plasmid are purchased from Addgene, and article No. is as follows：PBABE-neo-hTERT (1774), PBABE-zeo-large T genomic (1778), pBABE-puro-HRAS V12 (1768), gag/pol (14887), VSV- G(8454)。

(3) biomaterial used by slow viruss packaging is as follows：

The slow virus carrier plasmid of overexpression luciferase luciferase：Refer to " SIRT6 safeguards human mesenchymal stem cells from oxidative stress by coactivating NRF2.Pan et.al, .Cell research.(2016)26:190-205. " one is literary, and the public can be obtained from Institute of Biophysics, Academia Sinica.

P53 strikes low slow virus carrier plasmid PLVTHM-shP53：Refer to " PTEN deficiency reprogrammes human neural stem cells towards a glioblastoma stem cell-like phenotype.Duan Et.al .Nature communication. (2015) 10.1038. " one is literary, and the public can be ground from Chinese Academy of Sciences's biophysicss Study carefully and obtained.

Slow viruss packaging plasmid is purchased from Addgene, and article No. is as follows：PsPAX (12260), pMD2.G (12259).

5th, the fluorescent-labeled antibody for flow cytometry sorting MSC is as follows：

The anti-human cell surface identification molecule CD90 antibody of fluorescein FITC labellings, BD Biosciences, article No.： 555595。

The anti-human cell surface identification molecule CD73 antibody of fluorescein PE labellings, BD Biosciences, article No.： 550257。

The anti-human cell surface identification molecule CD105 antibody of fluorescein APC labellings, BD Biosciences, article No.：17- 1057-42。

Fluorescein APC labelling isotype control Abs, BD Biosciences, article No.：555751.

Fluorescein PE labelling isotype control Abs, BD Biosciences, article No.：555749.

Fluorescein FITC labelling isotype control Abs, BD Biosciences, article No.：555742.

6th, the antibody for immunofluorescence is as follows：

Anti-human FOXA2 antibody, Cell Signaling Technology, article No.：8186S.

Anti-human SMA antibody, Zhong Shan Golden Bridge, article No.：ZM-0003.

Anti-human TUJ1 antibody, Sigma, article No.：T2200.

Anti-human LAP2 antibody, BD Biosciences, article No.：611000.

Anti-human Lamin B1 antibody, Santa Cruz Biotechnology, article No.：sc-6217.

67 antibody of anti-human Ki, Vector Laboratories, article No.：VP-RM04.

Anti-human P16 antibody, BD Biosciences, article No.：550834.

Anti-human P21 antibody, Cell Signaling Technology, article No.：2947.

The preparation of embodiment 1, the human pluripotent stem cell of adversity gene NRF2 targeting modifications

First, the preparation of NRF2 enhancement mode pluripotent stem cell

The present invention is by the mankind adversity gene NRF2 in pluripotent stem cell (Pluripotent Stem Cell, PSC) Single site carry out targeting editor, make NRF2 genes (GeneBank ID：4780) the 245th of cDNA sequence is by wild Base A of type sports bases G, and the 82nd of the aminoacid sequence of NRF2 albumen is changed into glycine (G) from glutamic acid (E), obtains Obtain NRF2 enhancement mode pluripotent stem cells.Comprise the following steps that (concrete steps are referring to Figure 1A)：

1st, the structure of viral expression plasmids

Obtained across people by PCR amplifications first from RP11-483K11 BAC DNA libraries (BACPAC Resources) The genetic fragment of genoid group NRF2 the 1st and No. 2 intron (intron1-exon2-intron2) of gene.Then by fixed point Mutagenesis kit (Invitrogen, article No.：A13282) it is mutated the 245th of the cDNA sequence of correspondence NRF2 genes in the fragment Nucleotide site (A245G), bases G is sported by base A of wild type, and keeps other sequences constant, after being mutated Fragment, and by after mutation fragment insertion pCIHDAdGT8-4 carriers AscI and SpeI restriction enzyme sites in, obtain recombinate matter Grain.

2nd, viral expression plasmids and helper plasmid cotransfection incasing cellss obtain recombinant adenoviruss granule

The recombiant plasmid obtained with PI-SceI (NEB) enzyme action step 1, obtains linearization plasmid, and by the linearization plasmid Being imported in 116 cell of derived cell system that human embryonic kidney cell 293 is jointly with helper viruses AdHPBGF35 carries out recombinant adenovirus Poison packaging, and recombinant adenoviruss granule is obtained by ultracentrifugation purification.

3rd, recombinant adenoviruss granule infection aim cell

With recombinant adenoviruss granule infection hESCs cells (H9) (1 × 10⁷Individual cell, viral dose are 15bgal- Transducing units (btu), viral dose unit can be found in document " Palmer, D.J.＆Ng, P.Physical and infectious titers of helper-dependent adenoviral vectors:a method of direct Comparison to the adenovirus reference material.Mol Ther 10,792-798 (2004). " and “Suzuki,K.et al.Highly efficient transient gene expression and gene targeting in primate embryonic stem cells with helper-dependent adenoviral vectors.Proc Natl Acad Sci U S A 105,13781-13786 (2008). ", the 2-4 days after infection, add G418 (25～400g/ Ml, invitrogen Products) positive screening is carried out, the 10-13 days after infection, add 4 μM of Ganciclovir (GANC, invitrogen Products) carry out the screening of feminine gender.Finally the cell to surviving carries out sequencing identification (PCR Primer is NRF2A245GseqF：ACCATTTGTGACTTTGCCCTTTAGTGACCTCTACCATC and NRF2A245GseqR： AACCTGCCATAACTTTCCCAAGAACTGA, sequencing primer are aaaaacagaaaaaacttgaa), obtain a NRF2 equipotential The cell that site is correctly edited on gene, is denoted by NRF2^AG/+HESC cells.

4th, above-mentioned linearization plasmid is imported into NRF2 jointly with helper viruses AdHPBGF35^AG/+Enter in hESC cells again Row gene editing, and cell after editor is identified, the cell that site is correctly edited on two NRF2 allele is obtained, will Which is denoted as NRF2^AG/AGHESC cells, i.e. NRF2 enhancement mode pluripotent stem cell.

2nd, the identification of NRF2 enhancement mode pluripotent stem cell

1st, the sequencing identification of NRF2 enhancement mode pluripotent stem cell

Sequencing identification is carried out to NRF2 enhancement mode pluripotent stem cell.Jing sequencing identifications show：NRF2 enhancement mode is how competent thin In born of the same parents, the A245G sites of NRF2 genes occur correctly to edit (Figure 1B), and two of the NRF2 genes in NRF2 enhancement mode adult cells The 245th of article homologous chromosome sports bases G by base A.

2nd, the identification of morphology of NRF2 enhancement mode pluripotent stem cell

Identification of morphology, NRF2 are carried out to NRF2 enhancement mode pluripotent stem cell^AG/AGThe identification of morphology result of hESC such as Fig. 1 C institutes Show.In addition it can be seen that NRF2 enhancement mode pluripotent cell still has is divided into inside and outside triploblastica cell in vivo Ability.

3rd, in NRF2 enhancement mode pluripotent stem cell, the expression of multipotency dryness gene is detected

Respectively to wild type human embryonic stem cell H9 cell line (NRF2^+/+)、NRF2^AG/+HESC cell (NRF2^AG/+hESC) And NRF2^AG/AGHESC cell (NRF2^AG/AGThe expression of expression multipotency dryness gene OCT4, SOX2, NANOG hESC) Detected.Primer for PCR identifications is as follows：

18S-F：GTAACCCGTTGAACCCCATT；

18S-R：CCATCCAATCGGTAGTAGCG；

OCT4-F：GGGTTTTTGGGATTAAGTTCTTCA；

OCT4-R：GCCCCCACCCTTTGTGTT；

SOX2-F：CAAAAATGGCCATGCAGGTT；

SOX2-R：AGTTGGGATCGAACAAAAGCTATT；

NANOG-F：ACAACTGGCCGAAGAATAGCA；

NANOG-R：GGTTCCCAGTCGGGTTCAC.

As a result as shown in figure ip.As can be seen from the figure：NRF2^+/+、NRF2^AG/+HESC and NRF2^AG/AGHESC cells are equal Normal expression multipotency dryness gene OCT4, SOX2, NANOG.

Embodiment 2, the preparation of NRF2 enhancement mode mescenchymal stem cells and its Function detection

The present invention is further divided into the NRF2 enhancement mode pluripotent stem cell obtained in embodiment 1 between NRF2 enhancement mode and fills Matter stem cell (NRF2 enhancement mode MSC).And be experimentally confirmed：In NRF2 enhancement mode MSC, NRF2 obtains active activation, in vivo The external characteristic for showing degeneration-resistant, anti-cell aging and opposing vicious transformation.Comprise the following steps that：

First, the preparation of NRF2 enhancement mode MSC

1st, by NRF2^AG/AGHESC carries out embryoid body (EB) differentiation, comprises the following steps that：Prepare thin containing 300-500 Born of the same parents, uniform NRF2^AG/AGHESC is cloned, with Dispase (Invitrogen companies, article No. with room temperature PBS once For 17105041) 37 DEG C digestion 20-30 min.After ESC Clone formation spheroids, with CDF12 culture medium it is resuspended after, be added to low viscous Attached culture plate (Corning companies, article No. 3471) in, 37 DEG C, 5%CO₂CMC model forms embryoid body after 1-3 days.

2nd, the embryoid body that step 1 is obtained is inoculated in into coated 6 hole of matrigel (matrigel) (Invitrogen companies) Cultivated in plate, continue culture and occur to fibrous cell for 2 weeks.Again after once passing on, sorted using flow cytometry CD73, CD90 and CD105 therein are the cell population of the positive, and as NRF2 enhancement mode MSC is denoted by NRF2^AG/AG MSC。

By the NRF2 in above-mentioned steps^AG/AGHESC replaces with wild type human embryonic stem cell H9 cell lines, and other steps are not Become, Induction of committed differentiation obtains wild type mesenchymal cell and is denoted as NRF2^+/+MSC。

2nd, the phenotypic evaluation and Function detection of NRF2 enhancement mode MSC

1st, the phenotypic evaluation of NRF2 enhancement mode MSC

The NRF2 obtained by step one^AG/AGMSC and NRF2^+/+The surface marker of MSC is detected.

As a result as referring to figure 1e.As can be seen from the figure：The NRF2 that step one is obtained^AG/AGMSC and NRF2^+/+The equal energy of MSC MSC special surface marker CD73, CD90 and CD105 are enough expressed, and does not express unrelated CD34, CD43 and CD45.

2nd, in NRF2 enhancement mode MSC adversity gene NRF2 active activation

(1) NRF2 protein contents in NRF2 enhancement mode MSC

Respectively with NRF2^AG/AGMSC and NRF2^+/+MSC is that detection is for NRF2 protein contents in examination cell for examination cell.Specifically Step is as follows：Using RIPA cell pyrolysis liquids (the green skies, P0013B) cracking for examination cell, then tried using BCA protein quantifications Agent box (the green skies, P0010) is determined for protein concentration in examination cell, and finally taking 20ug albumen respectively carries out Western blot realities Test.Resist for NRF2 using one that (abcam, 62352), two resist for goat anti-rabbit igg/HRP (Zhong Shan Golden Bridge, ZDR-5306).

As a result as shown in fig. 1h.As can be seen from the figure：NRF2^AG/AGNRF2 protein contents in MSC (NRF2 enhancement mode MSC) Apparently higher than NRF2^+/+MSC。

(2) nuclear localization

Respectively with NRF2^AG/AGMSC and NRF2^+/+MSC is that in detecting kytoplasm and caryoplasm respectively, NRF2 albumen contains for examination cell Amount.Comprise the following steps that：Born of the same parents are extracted respectively using Nuclear extract and suppressor proteins extraction agent box (the green skies, P0028) Matter and caryoplasm component protein, then taking equal protein carries out Western blot experiments respectively, and with cytoplasmic marker thing β- Tubulin and caryoplasm label Lamin B1 is control.

As a result as shown in fig. 1f.As can be seen from the figure：NRF2^AG/AGNRF2 albumen in MSC (NRF2 enhancement mode MSC) Content in kytoplasm and caryoplasm is above NRF2^+/+MSC。

(3) mRNA of adversity gene NRF2 downstream target genes and protein level detection in NRF2 enhancement mode MSC

1) real-time quantitative PCR experiment

Respectively with NRF2^AG/AGMSC and NRF2^+/+MSC is, for examination cell, to extract RNA the reverse transcription for examination cell respectively For cDNA, real-time quantitative PCR is carried out using following primer respectively, detection is for adversity gene NRF2 downstream target genes in examination cell： NQO1 genes, HO-1 genes, GCLC genes, GCLM genes, GR genes, TXN genes, the expression of TRXR1 genes.

NQO1-F：CGCAGACCTTGTGATATTCCAG；

NQO1-R：CGTTTCTTCCATCCTTCCAGG；

HO1-F：AAGACTGCGTTCCTGCTCAAC；

HO1-R：AAAGCCCTACAGCAACTGTCG；

GCLC-F：GGATTTGGAAATGGGCAATTG；

GCLC-R：CTCAGATATACTGCAGGCTTGGAA；

GCLM-F：TGCAGTTGACATGGCCTGTT；

GCLM-R：TCACAGAATCCAGCTGTGCAA；

GSR-F：TTGTCGGGCTTGGAAGTCAG；

GSR-R：TGGTAGCCTACCGGGAACTG；

TXN-F：GTGAAGCAGATCGAGAGCAAG；

TXN-R：CGTGGCTGAGAAGTCAACTACTA；

TRXR1-F：GGGCAATTTATTGGTCCTCA；

TRXR1-R：GGTCTTTCACCAGTGGCAAT.

2) respectively with NRF2^AG/AGMSC and NRF2^+/+MSC is, for examination cell, to extract for the albumen in examination cell and carry out Western blot are tested, and detection is for NQO1 and HO-1 protein expression levels in examination cell.And with cytoplasmic marker thing β-tubulin For control.Using antibody be NQO1 (Santa Cruz Biotechnology, 32793), HO-1 (ENZO, ADI-SPA-895- D)。

As a result as shown in Fig. 1 G and Fig. 1 H.As can be seen from the figure：NRF2^AG/AGMSC (NRF2 enhancement mode MSC) middle and lower reaches Target gene：The expression of NQO1 genes, HO-1 genes, GCLC genes, GCLM genes, GR genes, TXN genes and TRXR1 genes It is above NRF2^+/+MSC.And NRF2^AG/AGIn MSC, NQO1 and HO-1 protein expression levels are also above NRF2^+/+MSC。

In sum, after the modification of NRF2 single sites, NRF2 genes obtain constitutive activation.

3rd, the degeneration-resistant anti-cell senescence characteristics of NRF2 enhancement mode MSC

(1) the high vigor under exogenous stimulation

Using including oxidative pressure, endoplasmic reticulum pressure, DNA damage pressure and apoptotic stimulus are processed in interior exogenous irritant MSC.Comprise the following steps that：Will be for trying cell NRF2^AG/AGMSC and NRF2^+/+MSC is laid on 96 orifice plates, respectively using following outer Source stimulus object (in bracket for exogenous irritant final concentration and purchase at) stimulate for examination cell 48 hours：

1) oxidative pressure：DMSO (0.1%, Sigma), PQ (2 mM, Paraquat, Sigma), PX12 (50uM, Santa Cruz Technology), TBH (100uM, tert-Butyl hydroperoxide, Sigma), L-BSO (500uM, L- Buthionine-sulfoximine, Sigma)；

2) endoplasmic reticulum pressure：TM (6ug/mL, Tunicamycin, Sigma) and TG (1.5ug/mL, Thapsigargin, Sigma)；

3) DNA damage：4NQO (100 uM, 4-nitroquinoline N-oxide, Sigma) and AAT2 (50uM, Apoptosis Activator 2,TOCRIS)；

4) apoptosis：CCCP(100uM,Carbonyl cyanide 3-chlorophenylhydrazone,Sigma).

Stimulate after terminating by 96 AQueous One Solution Cell Proliferation Kit of CellTiter (Promega, G3582) test kit and its using method detection supply the vigor of examination cell after stimulating.It is directly thin to culture during detection 96 AQueous One Solution reagents of CellTiter are added in the culture medium of born of the same parents, after being incubated 1 hour in cell culture incubator The absorbance of detection 490nm, according to the numerical computations versus cell vigor of OD490.Versus cell vigor computing formula is： Log2(OD490(NRF2^AG/AG)/OD490(NRF2^+/+))。

As a result show：Under background level and incentive condition, NRF2 enhancement mode MSC is respectively provided with higher cell viability (figure 2A)。

(2) energy for growth is determined

The NRF2 of continuous passage culture is counted using cell counting^AG/AGMSC and NRF2^+/+The energy for growth of MSC.

As a result as shown in Figure 2 B.As can be seen from the figure：NRF2^AG/AGMSC cells (NRF2 enhancement mode MSC) multiplication rate Apparently higher than NRF2^+/+MSC cells, show significantly to resist the ability of cell ageing.

(3) SA- β-Gal dyeing

The dyeing of cell ageing beta galactosidase is a kind of based on SA-beta-Gal (senescence- during aging Associated beta-galactosidase) activity level raise and to senile cell or tissue carry out dye detection side Method.The NRF2 that respectively step one is obtained^AG/AGMSC and NRF2^+/+MSC carries out SA- β-Gal dyeing, and aobvious in common optics The aging situation of cell or tissue can be just observed under micro mirror, and further to the SA- β-Gal stained positives in two groups of cells Cells ratio carries out quantitative statistical analysis.Comprise the following steps that：

Respectively with NRF2^AG/AGMSC and NRF2^+/+MSC is for examination cell (early generation：5th generation, late generation：11st generation), use PBS Washing 1 time, adds dyeing fixative (+0.2% glutaraldehyde of 2% formaldehyde), and room temperature fixes 5 minutes.Fixative is discarded, PBS is used Washing 1 time, adds 1ml dyeing working solutions per hole.With X-Gal as substrate, under the beta galactosidase catalysis of senescence-specific Navy blue product can be generated.

As a result as shown in Figure 2 C, it can be seen that the NRF2 in late generation^+/+MSC has obvious blueness, and early for NRF2^+/+The MSC and NRF2 in late generation^AG/AGMSC (NRF2 enhancement mode MSC) positive rate is very low.It can be seen that, the aging of NRF2 enhancement mode MSC is entered Cheng Yanhuan.

(4) Toxic Metabolites content detection

Respectively with NRF2^AG/AGMSC and NRF2^+/+MSC is (early for EP for examination cell：In 5th generation, evening is for LP：11st generation), with 1 μM of oxygen-derived free radicals probe DCFDA (Invitrogen, article No.：C6827) common incubation 30 minutes, using flow cytomery DCFDA intensity (i.e. active o content in indicator cells).Detailed step refers to Invitrogen companies description.

As a result as shown in Figure 2 D, NRF2^AG/AGMSC (NRF2 enhancement mode MSC) accumulates less activity in generation sooner or later Oxygen, shows that NRF2 enhancement mode MSC can more effectively remove this Toxic Metabolites.

(5) aging gene detection of expression

Respectively with NRF2^AG/AGMSC and NRF2^+/+MSC is (early for EP for examination cell：In 5th generation, evening is for LP：11st generation), Protein expression situation of the Western blot experiments detection for aging cance high-expression gene p16, p21, GATA4 in examination cell.Use One resist for p16 (BD, 550834), P21 (Cell signaling, 2947), GATA4 (Santa cruz, SC-1237).Correspondence Two resist for goat anti-mouse igg/HRP (Zhong Shan Golden Bridge, ZDR-5307), goat anti-rabbit igg/HRP (Zhong Shan Golden Bridge, ZDR-5306) and rabbit Anti- sheep IgG/HRP (Zhong Shan Golden Bridge, ZDR-5308).

As a result as shown in Figure 2 E.It can be seen that and NRF2^+/+MSC is compared, genes amplification type MSC (NRF2^{AG/ AG}MSC low-abundance SAG p16, p21 and GATA4) are expressed all the time.

(6) multiplication capacity detection

Respectively with NRF2^AG/AGMSC and NRF2^+/+MSC is (early for EP for examination cell：In 5th generation, evening is for LP：11st generation), lead to Cross immunofluorescence staining and detect the Ki67 expression related to proliferation activity.Comprise the following steps that：Circular glass is laid on for trying cell On piece, after being fixed using 4% paraformaldehyde, Jing 0.4%TritonX-100 are penetrating.Penetrating cell closes 1h in donkey serum, With latter anti-overnight incubation, resist for Ki67 (Vector Laboratories, article No. using one：VP-RM04).Correspondence two is anti-to incubate Cell picture is shot using laser confocal microscope after educating 45 minutes.

As a result as shown in Figure 2 F.It can be seen that and NRF2^+/+MSC is compared, NRF2^AG/AGMSC (NRF2 enhancement mode MSC) higher Ki67 positive cell rate is respectively provided with generation sooner or later.

(7) nuclear structures integrity detection

Respectively with NRF2^AG/AGMSC and NRF2^+/+MSC is for examination cell (early generation：5th generation, late generation：11st generation), by exempting from Epidemic disease fluorescent staining method detects the expression of nuclear membrane albumen Lamin B1 and LAP2.Comprise the following steps that：Circular glass is laid on for trying cell On piece, after being fixed using 4% paraformaldehyde, Jing 0.4%TritonX-100 are penetrating.Penetrating cell closes 1h in donkey serum, With latter anti-overnight incubation, resist for LaminB1 (Abcam, article No. using one：And LAP2 (BD, article No. 16048)：611000).It is right Ying Erkang shoots cell picture using laser confocal microscope after being incubated 45 minutes.

As a result as shown in Figure 2 G.As can be seen from the figure：And NRF2^+/+MSC is compared, the NRF2 in late generation^AG/AG MSC(NRF2 Enhancement mode MSC) (in Fig. 2 G, arrow indication is nuclear membrane abnormal cell, can not after nuclear membrane protein staining for nuclear membrane abnormal cell See obvious nuclear membrane profile) number significantly reduces, and shows NRF2^AG/AGMSC (NRF2 enhancement mode MSC) is with more complete cell Nuclear structure.

4th, NRF2 enhancement mode MSC resists the characteristic of vicious transformation

(1)NRF2^AG/AGTMSC and NRF2^+/+The preparation of TMSC

Using external vicious transformation system, respectively to NRF2^AG/AGMSC and NRF2^+/+The tumorigenesis factor is proceeded in MSC, will be non- The MSC of tumor is converted into the MSC (transformed MSC, call TMSC in the following text) of tumor, respectively obtains NRF2^AG/AGTMSC and NRF2^+/+ TMSC.Tumor correlation properties are detected subsequently.Comprise the following steps that：

1) by retroviral vector plasmid pBABE-neo-hTERT, pBABE-zeo- needed for external vicious transformation system Large T genomic, pBABE-puro-HRAS V12 are thin to 293T with packaging plasmid gag/pol and VSV-G cotransfection respectively In born of the same parents, culture supernatant is collected, and passes through ultracentrifugation purification of retrovirus granule.Will be slow needed for external vicious transformation system Viral vector plasmid PLVTHM-shP53 respectively with packaging plasmid psPAX and pMD.2G cotransfection to 293T cells in, collect training Foster supernatant, and pass through ultracentrifugation purification lentiviral particle.

2) virus obtained using purification infects NRF2 respectively^AG/AGMSC and NRF2^+/+MSC.As shown in Figure 3A, the evil of MSC Property conversion include lengthening of telomeres, in terms of antioncogene disappearance and oncogenic mutation three, the process is by 3 kinds of reverse transcription diseases of infection Poison and a kind of slow virus are realized.Slow viruss can express green fluorescence GFP albumen simultaneously, while realizing the visable indicia of cell.Specifically Operating process is pBABE-neo-hTERT, pBABE-zeo-large T for infecting acquisition in step (1) in morning is for MSC successively Tri- kinds of retrovirus of genomic and pBABE-puro-HRAS V12.Due to three kinds of viruses respectively have neo, zeo and The resistance marker of puro, thus successively using corresponding G418 (Invitrogen, 10131035), zeocin (Invitrogen, ) and three kinds of medicines of puromycin (Invitrogen, A1113803) carry out positive screening and obtain three kinds of viral expansions R25001 The cell of conjunction, finally infects PLVTHM-shP53 slow viruss and strengthens the suppression of antioncogene and the labelling of GFP.Jing this step is distinguished Obtain NRF2^AG/AGTMSC and NRF2^+/+TMSC。

(2) an active non-anchor relies on energy for growth

Tumor cell can grow up to clone on the agar that cannot be adhered to, and non-tumor cell then can not, therefore an active non-anchor according to It is closely related that bad energy for growth forms entity tumor with tumor cell.Respectively by NRF2^AG/AGTMSC and NRF2^+/+TMSC with it is molten Agarose (0.35%) mix homogeneously of solution state, is laid in Tissue Culture Dish rapidly, and TMSC trainings are covered after agarose solidification Foster base culture, observation an active non-anchor rely on energy for growth.

As a result as shown in Figure 3 B：NRF2^AG/AGIt is thin compared with wild type that TMSC its an active non-anchor Jing after vicious transformation relies on energy for growth Weaken (Fig. 3 B) after dysuria with lower abdominal colic significantly.

(3) internal one-tenth knurl ability

Respectively by NRF2^AG/AGTMSC and NRF2^+/+TMSC (3 × 10^6 cell) is implanted into nude mice (strain：Balb/ Cnude mice) the nearly joint of hind leg.It is unicellular by the TMSC digestion of adhere-wall culture, is resuspended in and is mixed with 20%Matrigel (BD Biosciences, PBS 354277) (10010023) in solution, noted by Gibco using ordinary syringe by cell suspension Inject in the muscle of the nearly joint of hind leg.After the transplanting 2-3 months, when substantially swollen thing protuberance occurs in hind leg, mice is put to death.Cut hind leg Weighed using balance, and calculate relative mass (relative mass=transplanting NRF2^+/+Hind leg quality/transplanting the NRF2 of TMSC^AG/AG The hind leg quality of TMSC).

As a result as shown in figs. 3 c and 3d：It can be seen that relative mass is 2.73 ± 0.22, NRF2 is transplanted^+/+ The hind leg quality of TMSC noticeably greater than transplants NRF2^AG/AGThe hind leg quality of TMSC.Illustrate NRF2^+/+TMSC can grow osteosarcoma Shape tumor, and NRF2^AG/AGTMSC then thoroughly loses the ability to form tumor.

The application of embodiment 3, NRF2 enhancement mode mescenchymal stem cells in cellular transplantation therapy

As the NRF2 enhancement mode mescenchymal stem cells (NRF2 enhancement mode MSC) of the acquisition of embodiment 2 are with degeneration-resistant, anti-cell Aging and the tumorigenic characteristic of opposing, the NRF2 enhancement mode mescenchymal stem cell obtained in embodiment 2 is used for thin by the present invention Born of the same parents' transplantation treatment.Comprise the following steps that：

The first, NRF2 enhancement mode MSC be transplanted to the tibialis anterior of mice

1st, respectively to NRF2^AG/AGMSC and NRF2^+/+MSC carries out luciferase labelling.Comprise the following steps that：By overexpression The slow virus carrier plasmid of luciferase luciferase is thin to 293T with slow viruss packaging plasmid psPAX and pMD2.G cotransfection In born of the same parents, culture supernatant is collected, and passes through ultracentrifugation purified virus particles.The virus infection NRF2 obtained using purification^AG/AG MSC and NRF2^+/+MSC, respectively obtains the NRF2 of luciferase labelling^AG/AGMSC and NRF2^+/+MSC；

2nd, respectively by the NRF2 of luciferase labelling^AG/AGMSC and NRF2^+/+MSC (1 × 10^6 cell) is transplanted to mice Tibialis anterior in, detect the MSC that retains of leg using living animal imager after 7 days.

As a result as shown in Figure 4 A, NRF2^AG/AGMSC (NRF2 enhancement mode MSC) is compared with NRF2^+/+MSC can retain more long.

The 2nd, NRF2 enhancement mode MSC be transplanted to the immunodeficient mouse muscle of posterior-limb ischemia

Respectively by NRF2^AG/AGMSC and NRF2^+/+MSC is transplanted in the immunodeficient mouse muscle of posterior-limb ischemia, using sharp The recovery situation of the 0th, 4,8,12,16 day mouse hind leg blood flow after the detection transplanting of light doppler flowmeter.Simultaneously by PBS solution (control) ((Gibco, 10010023)) is used as control.

As a result as shown in Figure 4 B and 4C, relatively injection PBS solution or transplanting NRF2^+/+MSC is compared, and transplants NRF2^AG/AG MSC (NRF2 enhancement mode MSC) can recover the blood flow of impaired hind leg faster, show NRF2^AG/AGMSC take part in blood vessel after damaging Regeneration and reparation.

Claims (10)

1. a kind of preparation method of mescenchymal stem cell, comprises the steps：

(1) by the glutamic acid mutation of the 82nd of the NRF2 albumen in vitro human pluripotent stem cells be glycine, obtain NRF2 The pluripotent stem cell of genes amplification type；

(2) induction differentiation is oriented to the pluripotent stem cell of the NRF2 genes amplifications type, obtains NRF2 genes amplification types Mescenchymal stem cell.

2. method according to claim 1, it is characterised in that：It is in step (1), described by vitro human pluripotent stem cells The glutamic acid mutation of the 82nd of NRF2 albumen be that base A of the 245th of NRF2 genes is mutated for the method for glycine For bases G.

3. method according to claim 2, it is characterised in that：Base A of described the 245th by NRF2 genes is sported The method of bases G is genome fixed point editor；

The method of the genome fixed point editor can be edited for ZFN, TALEN is edited, CRISPR/Cas9 is edited or HdADV mediations Fixed point editor；The method of the genome fixed point editor is specially the fixed point editor of HdADV mediations.

4. according to arbitrary described method in claim 1-3, it is characterised in that：

In step (2), the method for the Induction of committed differentiation comprises the steps：

(b1) pluripotent stem cell of NRF2 genes amplification types is carried out into embryoid body differentiation, obtains embryoid body；

(b2) cultivate the embryoid body to occur to fibrous cell；Again through Secondary Culture, sorting wherein CD73, CD90, CD105 It is the cell population of the positive, the mescenchymal stem cell of as described NRF2 genes amplifications type.

5. according to arbitrary described method in claim 1-4, it is characterised in that：

The human pluripotent stem cells are human embryo stem cell or people's induced multi-potent stem cell；

And/or, the human embryo stem cell is specially human embryo stem cell H9 cell lines.

6. the mescenchymal stem cell of the NRF2 genes amplification types for being prepared using arbitrary methods described in claim 1-5.

7. the pluripotent stem cell of the NRF2 genes amplification types for being prepared using arbitrary methods described in claim 1-5.

8. the NRF2 genes described in the mescenchymal stem cell or claim 7 of the NRF2 genes amplification types described in claim 6 increase The pluripotent stem cell of strong type is in following c1)-c5) in application in any one：

C1) prepare the product of opposing and/or delaying cell aging；

C2) prepare the tumorigenic product of opposing；

C3) prepare the pernicious product into tumor conversion of opposing；

C4) prepare the product of cellular transplantation therapy；

C5) prepare regeneration and/or repair the product of injured blood vessel.

9. a kind of product, its active component are the mescenchymal stem cell of the NRF2 genes amplification types described in claim 6；

The function of the product be following m1)-m5) and in any one：

M1) opposing and/or delaying cell aging；

M2) to antitumorgienesis；

M3) resist pernicious into tumor conversion；

M4) cellular transplantation therapy；

M5) the regeneration and/or reparation of injured blood vessel.

10. it is according to claim 8 application or claim 9 described in product, it is characterised in that：

It is described opposing and/or delaying cell aging be embodied in following d1)-d6) and in any one：

D1) under exogenous irritant stimulation, cell viability strengthens；

D2) higher multiplication capacity is showed in continuous passage incubation in vitro；

D3 the ability for) removing Toxic Metabolites strengthens；

D4) reduce with the expression of Identifying cellular senescence-associated genes；

D5) with more complete nuclear structures；

D6) retention time is longer in the human or animal body；

It is described opposing it is pernicious into tumor conversion is embodied in following e1)-e3) and in any one：

E1) tumor ability of cell proliferation is reduced；

E2 the energy for growth reduction that related an active non-anchor is relied on) is formed to tumor；

E3 the ability for) forming tumor in vivo is reduced；

The cellular transplantation therapy is cell transplantation repairing and treating.