CN106478787A

CN106478787A - Genomic modification system and application thereof

Info

Publication number: CN106478787A
Application number: CN201610872335.1A
Authority: CN
Inventors: 杨进孝; 张成伟
Original assignee: Beijing Dbn Biotech Co Ltd; Beijing Dabeinong Technology Group Co Ltd
Current assignee: Beijing Dbn Biotech Co Ltd; Beijing Dabeinong Technology Group Co Ltd
Priority date: 2016-09-30
Filing date: 2016-09-30
Publication date: 2017-03-08

Abstract

The present invention relates to a kind of genomic modification system and application thereof, described genomic modification system is included for identifying SEQ ID NO:The nuclease E7 L of 1 the 3rd 19 and be used for identifying SEQ ID NO:The nuclease E7 R of the complementary seriess of 2 the 9th 25, described nuclease E7 L comprises with SEQ ID NO:The identification albumen of the aminoacid sequence shown in 18 the 157th 738, described nuclease E7 R comprises with SEQ ID NO:The identification albumen of the aminoacid sequence shown in 19 the 157th 738.Genomic modification system of the present invention can be used for plant oriented molecule breeding, not only can obtain and have improved effect but the progeny plant of non-carry genetic modification composition, and can be stable hereditary in offspring, shorten the plant breeding time simultaneously, accelerate breeding process, cost-effective, efficiently precisely.

Description

Genomic modification system and application thereof

Technical field

The present invention relates to a kind of genomic modification system and application thereof, struck based on TALEN technology fixed point particularly to a kind of System except paddy gene BADH2 and application thereof.

Background technology

Oryza sativa L. is most important in the world and one of crops of extensive plantation, and transformation rice genome has for agricultural development Significant.Scented rice is a kind of specific type rice, and it commercially has very high economic worth, and this has been the jasmine of Thailand Jasmine fragrant rice is confirmed.Fragrance has become the important indicator of an evaluation rice quality at present.There are some researches show, Oryza sativa L. is fragrant Taste gene is located on the 8th chromosome, and by single recessive gene control, 2- acetyl -1- pyrrolin (2-acetyl-1- Pyrroline, 2-AP) it is to determine the most important chemical composition of rice aroma.The research such as Louis etc. and Bradbury is sent out at first Existing, rice scent is due to the Badh2 of coding Betaine aldehyde dehydrogenase (Betaine Aldehyde Dehydrogenase, BADH) The disappearance of gene order coding region 8bp and 3bp mutation lead to BADH2 original function to be lost, so that the work of Betaine aldehyde dehydrogenase Interrupted with the metabolic pathway of substrate 2-AP, fragrance matter constantly accumulates.Hidden from one lists related to 2-AP of discovery such as Lorieux Property gene fgr control fragrance character after, a series of scent genes identification mark of correlations are developed, including RFLP labelling, SSR marker And RAPD labelling etc., but these telltale marks are bigger than normal with the distance of gene easily false positive so as to certain using also receiving Limit.

At this stage, scented rice breeding relies primarily on traditional conventional breeding, by the hybridization of many wheels and backcrossing by fragrant seed rice matter BADH2 mutant gene in resource imports in key rice cultivar.But carry out breeding using existing perfume seed rice matter to deposit In larger difficulty, the economical character of tradition perfume rice germ plasm resource is often not fully up to expectations, as lodging resistance, insect resistace and disease resistance relatively Difference, and yield is not high.While aroma characteristics being introduced to waiting to improve the breed by traditional breeding method using these germplasm, due to even The reasons such as lock burden, usually can bring bad negative character, lead to not obtain the scented rice varieties that can be used for actual production, or The variety yield being brought out is extremely low.Therefore, need exploitation to have scented rice character in actual production, and comprehensive agronomy character is good Fragrant seed rice matter produces cenospecies as scented rice breeding germ plasm resource or directly as parent.

TALENs (transcriptional activation increment effector nuclease) is the gene site-directed modification new technique occurring in recent years, There is extensive research and application in the fields such as animal, plant and the mankind.Transcriptional activation increment effector (Transcription Activator-Like Protein Effector, TALE) it is that xanthomonas pathogen is secreted in host plant cell A kind of toxic protein, can identify DNA of plants, drive gene expression.TALENs be exactly using TALE DNA binding structural domain and The nuclease of the DNA cutting domain synthetic of Fok I.Two TALEN monomers combine in DNA double chain according to certain way On, DNA is cut off by the dimer being formed with cleavage activity, produces DNA double chain interruption (DSB), and cell starts repair mechanism, passes through This inaccurate repair mode of non-homologous end joining (NHEJ) can produce site-directed point mutation, by homologous recombination (HR) Mode is repaired and can be realized accurately gene site-directed insertion or gene replacement.

Therefore, can be directly by BADH2 site-directed point mutation in fine quality rice (non-scented rice) or strike by TALENs technology Remove, the demand formulating High quality sweet rice in actual production not only can be met, breeding cycle can also be greatly shortened.

Content of the invention

It is an object of the invention to provide a kind of genomic modification system and application thereof, effectively overcome prior art physics and chemistry and lure The technological deficiencies such as change method targeting is strong, traditional breeding method time length, high cost and screening difficulty.

For achieving the above object, the invention provides a kind of identify albumen, including：

A () has SEQ ID NO:The protein of the aminoacid sequence composition shown in 18 157-738 positions, it is used for identifying SEQ ID NO:1 3-19 position；Or

B () has SEQ ID NO:The protein of the aminoacid sequence composition shown in 19 157-738 positions, it is used for identifying SEQ ID NO:The reverse complementary sequence of 2 9-25 positions.

For achieving the above object, present invention also offers a kind of identify nucleotide sequence, including：

The nucleotide sequence of (a) coding described identification albumen；Or

B () has SEQ ID NO:Nucleotide sequence shown in 17 469-2214 positions；Or

C () has SEQ ID NO:Nucleotide sequence shown in 20 469-2214 positions.

For achieving the above object, present invention also offers a kind of comprise the described nuclease identifying albumen.

Further, described nuclease also includes TAL effector N-terminal, TAL effector C-terminal and Cobra venom endonuclease.

For achieving the above object, present invention also offers a kind of genomic modification system, including for identifying SEQ ID NO:The nuclease E7-L of 1 3-19 position and be used for identifying SEQ ID NO:The nuclease of the reverse complementary sequence of 2 9-25 positions E7-R, described nuclease E7-L comprise (a) described protein in described identification albumen, and described nuclease E7-R comprises described identification (b) described protein in albumen.

Further, encode the aminoacid sequence such as SEQ ID NO of described nuclease E7-L:Shown in 18, described nuclease The aminoacid sequence of E7-R such as SEQ ID NO:Shown in 19.

Further, the nucleotide sequence encoding described genomic modification system includes SEQ ID NO:17 and SEQ ID NO:Nucleotide sequence shown in 20.

For achieving the above object, present invention also offers a kind of expression cassette, it is included in the regulating and controlling sequence regulation and control of effectively connection Under coding described genomic modification system nucleotide sequence.

For achieving the above object, present invention also offers a kind of recombinant expression carrier, containing encoding described genomic modification The nucleotide sequence of system or described expression cassette.

For achieving the above object, present invention also offers a kind of pinpoint the method knocking out paddy gene BADH2, including in water Expressing said gene group modification system in rice.

For achieving the above object, present invention also offers a kind of method producing fragrance Oryza sativa L., including by described genome Modification system or described expression cassette or described recombinant expression carrier Introduced into Rice genome.

For achieving the above object, present invention also offers a kind of method producing fragrance rice, produce including by methods described Raw fragrance Oryza sativa L. selfing or with the hybridization of another rice plant, have dulcet rice to obtain.

For achieving the above object, present invention also offers a kind of described genomic modification system is obtaining fragrance Oryza sativa L. or perfume (or spice) Purposes in taste rice.

For achieving the above object, present invention also offers a kind of test kit, including described genomic modification system, for increasing The strong modification efficiency to target sequence.

The genome of heretofore described plant, plant tissue or plant cell, refers to plant, plant tissue or plant Intracellular any hereditary material, and include nucleus and plastid and mitochondrial genome.

Heretofore described polynucleotide and/or nucleotide form completely " gene ", encode in required host cell Protein or polypeptide.Those skilled in the art are it is readily appreciated that can be placed in the polynucleotide of the present invention and/or nucleotide Under regulating and controlling sequence in purpose host controls.

As the application, used in claim, unless clearly indicated otherwise in context, otherwise odd number and list The term of number form formula, such as " one ", " one " and " being somebody's turn to do ", including plural thing.Thus, for example " plant ", " this plant " or " plant " also indicates that multiple plants.And based on context, may further indicate that this plant in heredity using term " plant " Similar or identical offspring.Similarly, term " nucleic acid " can refer to many copies of nucleic acid molecules.Similarly, term " probe " May refer to same or analogous probe molecule.

Digital scope includes the numeral limiting this scope, and clearly includes each integer in limited range and non- Integer fraction.Unless otherwise noted, otherwise whole technology used herein and scientific terminology have and ordinary skill people The identical implication that member is commonly understood by.

In the present invention, term " nucleic acid " and " polynucleotide " are used interchangeably, based on context implication, may refer to DNA or RNA.Wherein DNA includes but is not limited to cDNA, genomic DNA, synthetic DNA (such as synthetic) and contains nucleic acid analog DNA (or RNA).Polynucleotide can have any three dimensional structure.Nucleic acid can be double-strand or single-stranded (both sense strand or antisense were single-stranded). The non-limiting example of polynucleotide include gene, genetic fragment, exon, intron, messenger RNA (mRNA), transfer RNA, Ribosomal RNA, ribozyme, cDNA, recombination of polynucleotide, branched polynucleotides, plasmid, carrier, the separation DNA of any sequence, appoint The separation RNA of what sequence, nucleic probe and primer and nucleic acid analog.

Heretofore described regulating and controlling sequence include but is not limited to promoter, transit peptides, terminator, enhancer, targeting sequencing, Intron and other are operably connected to the regulating sequence of described transcriptional activation increment effector nuclease.

Described promoter is effable promoter in plant, and described " effable promoter in plant " refers to guarantee The promoter that connected coded sequence is expressed in plant cell.In plant, effable promoter can be composing type Promoter.The example instructing the promoter of constitutive expression in plant includes but is not limited to, from cauliflower mosaic viruses 35S promoter, Semen Maydiss Ubi promoter, promoter of Oryza sativa L. GOS2 gene etc..Alternatively, in plant, effable promoter can For tissue-specific promoter, that is, this promoter such as instructs the table of coded sequence in some tissues of plant in chlorenchyma Reach its hetero-organization (can be measured) that level is higher than plant, such as PEP carboxylase promoter by conventional RNA test.Alternatively, In plant, effable promoter can be wound-induced promoter.Wound-induced promoter or the expression pattern instructing wound-induced Promoter refer to when plant is stood machinery or gnaws, by insecticide, the wound causing, the table of the coded sequence under promoter regulation Reach and be significantly increased compared with the conditions of normal growth.The example of wound-induced promoter includes but is not limited to, Rhizoma Solani tuber osi and Fructus Lycopersici esculenti Protease suppressor gene (pin I and pin II) and zein enzyme level gene (MPI) promoter.

In the present invention, term " detached " is related to also include the sequence that any non-natural produces during nucleic acid, because described non- Naturally-produced sequence does not find under its natural environment and it is not close to sequence in naturally-produced genome.

In the present invention, term " TALENs " refers to activating transcription factor sample effector nuclease (Transcription Activator-like (TAL) effector nucleases), TALENs be a kind of can targeting modification specific DNA sequence enzyme. It by means of transcriptional activation increment effector (Transcription Activator-Like Protein Effector, TALE), a kind of identification specificity DNA base pair is come by the native protein that vegetative bacteria is secreted.Theoretically, TAL effector Identification and binding purpose DNA sequence can be designed.TAL effector N-terminal typically has encoding transport signals (translocation Signal), TAL effector C-terminal has nuclear localization signal (nuclear localization signal, NLS) and transcriptional activation Domain (activation domain, AD), and middle part is then its domain with DNA specific recognition and combination of mediation.? The cutting domain that transcriptional activation domain (AD) in TAL effector is substituted for Cobra venom endonuclease has been generated as TALENs, Described cutting domain is typically from no sequence-specific FokI Cobra venom endonuclease.TALENs can be incorporated in spy with DNA knot Ectopic sites are cut to DNA, thus importing new hereditary material.

In the present invention, term " genomic modification " be used as the genome of organism or chromosome or exchromosomal DNA or Any modification of the result modified as gene target or gene function producing in organelle DNA.

In the present invention, " modification " refers to lead to target sequence permanently or temporarily to change including using any gene technology but does not limit In disappearance, insertion, mutation, displacement, otch, methylate, acetylation, connection, restructuring, spiral untwist, chemical modification, labelling, work The suppression of one or more nucleotide in change, inactivation and target sequence.

In the present invention, " mutant " refers to the individuality undergone mutation, and it has the sequences different from wild type, may lead At least part of function is caused to lose for example, the change of sequence in promoter or enhancer region will affect organism at least in part The expression of middle coded sequence.Term " mutation " refers to by such as disappearance, interpolation, replacement or to reset sequence in the nucleotide sequence causing Any change of row.Mutation also can affect the one or more steps of this sequence participation.For example, the change in DNA sequence can be led Cause the synthesis of mRNA that is activated, having amount of activated or inactive change and/or albumen.

In the present invention, term " nuclease " is intended to including exonuclease and endonuclease.

In the present invention, term " endonuclease " refers to can be between catalytic dna or interior (preferably DNA molecular) nucleic acid of RNA molecule Any wild type of hydrolysis (cutting) or variant enzyme.The non-limiting example of endonuclease includes II type restricted enzyme example As Fok I, Hha I, Hind III, Not I, BbvC I, EcoR I, Bg II and Alw I.

In the present invention, " localization domain " is optionally added to the part of protein part, and localization domain can be by egg White part or the protein part of programming or the complex of assembling position to specific cells in living cells or Subcellular Localization.Positioning knot Structure domain can include the aminoacid of following domain and builds by being fused to the aminoacid sequence of protein part to mix：Nuclear location Signal (NLS)；Mitochondrion targeting sequencing (MLS)；Chloroplast targeting sequencing；And/or be designed with by albumen transport or guiding or Position any sequence of any subdivided portions to the organelle containing nucleic acid, cellular compartment or cell.In some embodiments In, organism is eukaryote, and localization domain includes allowing albumen to enter the nuclear location knot in nucleus and genomic DNA Structure domain (NLS).The sequence of described NLS may include any function NLS of positively charged sequence.In other embodiments, fixed Nuclear localization sequence may include the targeting sequencing making the nucleoprotein of protein part or programming enter organelle, so that organelle DNA is modified It is possibly realized.

Term " probe " is one section of detached nucleic acid molecules, is combined with detectable label or the report point of routine above it Son, for example, radiosiotope, part, chemiluminescence agent or enzyme.This probe is complementary with a chain of target nucleic acid , in the present invention, probe with from rice plant-E7 genome a DNA complementation, though this genomic DNA come Also it is derived from plant or seed or the extract of rice plant-E7 from rice plant-E7 or seed.The probe of the present invention is not only Including DNA (deoxyribonucleic acid) or ribonucleic acid, also include specifically being combined with target dna sequence and can be used for detecting this target The polyamide of the presence of DNA sequence and other probe materials.

Term " primer " is one section of detached nucleic acid molecules, and it passes through nucleic acid hybridization, and annealed combination is to complementary target dna On chain, form heterozygote between primer and target dna chain, then in the presence of polymerase (such as archaeal dna polymerase), along mesh Mark DNA extends.The primer pair of the present invention is related to its application in target nucleic acid sequence amplification, for example, by polymerase chain Formula reaction (PCR) or other conventional nucleic acid amplification methods.

The length of probe and primer is usually 11 polynucleotide or more, preferably 18 polynucleotide or more, More preferably 24 polynucleotide or more, most preferably 30 polynucleotide or more.This probe and primer are in height Specifically hybridize with target sequence under degree stringent hybridization condition.Although protecting different from target dna sequence and to target dna sequence The probe holding hybridization ability can be by conventional design out, however, it is preferred to, probe in the present invention and primer With the continuous nucleic acid of target sequence, there is completely DNA sequence homogeneity.

The nucleic probe of the present invention and primer are hybridized with target dna sequence under strict conditions.Any conventional nucleic acid is miscellaneous Hand over or amplification method may be used to derive from the presence of the DNA of rice plant-E7 in identification sample.Nucleic acid molecules or its fragment Specific hybrid can be carried out with other nucleic acid molecules in any case.As the present invention uses, if two nucleic acid molecules Antiparallel double-strandednucleic acid structure can be formed it is possible to say that this two nucleic acid molecules can carry out specific hybrid to each other.As Really two nucleic acid molecules show completely complementarity, then claim one of nucleic acid molecules to be that another nucleic acid molecules is " complementary Thing ".As the present invention uses, when the corresponding nucleotide of each nucleotide and another nucleic acid molecules of nucleic acid molecules Mutually the added time, then this two nucleic acid molecules are claimed to show " complete complementary ".If two nucleic acid molecules can be stablized with enough Property phase mutual cross so that they are annealed under the conditions of at least conventional " low strict " and are bonded to each other, then claim this two nucleic acid Molecule is " minimum level is complementary ".Similarly, if two nucleic acid molecules can with enough stability phase mutual crosses so that They are annealed under the conditions of conventional " highly strict " and are bonded to each other, then claim this two nucleic acid molecules to have " complementary ".From Deviate in complete complementary and can allow, as long as this not exclusively two molecules of prevention that deviate form duplex structures.In order to Enable nucleic acid molecules as primer or probe it is only necessary to ensure that it has sufficient complementarity in sequence, so that Stable duplex structure can be formed under the specific solvent being adopted and salinity.

As the present invention uses, the sequence of basic homology is one section of nucleic acid molecules, and this nucleic acid molecules is in high stringency With the complementary strand of another section of nucleic acid molecules matching, specific hybrid can occur down.Promote the suitable strict of DNA hybridization Condition, for example, is processed with 6.0 × sodium chloride/sodium citrate (SSC) about under the conditions of 45 DEG C, then uses under the conditions of 50 DEG C 2.0 × SSC washs, and these conditions are known to those skilled in the art.For example, the salinity in washing step can be selected From the about 2.0 × SSC of Low stringency conditions, 50 DEG C to high stringency of about 0.2 × SSC, 50 DEG C.Additionally, washing step In temperature conditionss can be increased to about 65 DEG C of high stringency from about 22 DEG C of the room temperature of Low stringency conditions.Temperature strip Part and salinity can all change it is also possible to one of keep constant and another variable changes.Preferably, originally One nucleic acid molecules of invention can be under moderate stringency, such as with SEQ ID NO at about 2.0 × SSC and about 65 DEG C: 1 and SEQ ID NO:One or more nucleic acid molecules or its complementary series in 2, or arbitrary fragment generation of above-mentioned sequence is special Property hybridization.It is highly preferred that the present invention nucleic acid molecules under high stringency with SEQ ID NO:1 and SEQ ID NO: One or more nucleic acid molecules or its complementary series in 2, or arbitrary fragment generation specific hybrid of above-mentioned sequence.The present invention In, preferred label nucleic acid molecules have SEQ ID NO:1 or SEQ ID NO:2 or its complementary series, or above-mentioned sequence Arbitrary fragment.SEQ ID NO:1 or SEQ ID NO:2 labels that can serve as in plant breeding method are miscellaneous to identify heredity The offspring handing over.Probe can pass through, with the hybridization of target dna molecule, the method that any one be well known to those skilled in the art Detected, these methods include but is not limited to, fluorescent labeling, radioactive label, antibody class labelling and chemiluminescent labeling.

With regard to the amplification (for example, by PCR) target nucleic acid sequence being carried out using specific amplimer, " strict bar Part " refers to the condition only allowing primer pair target nucleic acid sequence that hybridization occurs in the hot amplified reaction of DNA, has and target core The primer of the corresponding wild-type sequence of acid sequence (or its complementary series), can be combined with described target nucleic acid sequence, and excellent Choosing produces unique amplified production, and amplified production is amplicon.

Term " specific binding (target sequence) " refer under stringent hybridization condition probe or primer only with comprise target Target sequence in the sample of sequence hybridizes.

As the present invention uses, " through the DNA of amplification " or " amplicon " refers to the target as a nucleic acid-templated part The nucleic acid amplification product of nucleotide sequence.For example, whether had by passing through containing rice plant-E7 of the present invention to determine rice plants Property Crossing system produce, or whether the Oryza sativa L. sample from field for the collection comprises rice plant-E7, or extracts from rice, such as rice Whether rice comprises rice plant-E7, and the DNA extracting from rice plants tissue sample or extract can be by using primer pair Nucleic acid amplification method is diagnostic amplicon with the presence producing for the DNA of rice plant-E7.Amplicon has a fixed length Degree and sequence, described in described sequence pair, rice plant-E7 is also diagnostic.The length range of amplicon can be primer pair Add a nucleotide base pair in conjunction with length, preferably add about 50 nucleotide bases pair, more preferably add about 205 Ten nucleotide bases pair, most preferably add about 450 nucleotide bases to or more.

In the present invention, " label " refers to pass through spectroscopy, photochemistry, biochemistry, immunochemistry, chemical or other thing Reason means are detectable compositionss.For example, useful label includes 32P, fluorescent dye, electron-dense reagents, enzyme (example As conventional in ELISA), biotin, digoxin or hapten and it can be made to be other entities detectable.Label can It is impregnated at nucleic acid and any position of albumen.

In the present invention, " test kit " may include genomic modification system and following any one or complete of present invention description Portion：Measure reagent, buffer, probe and/or primer and Sterile Saline or another kind of pharmaceutically acceptable Emulsion and suspension base Bottom.Additionally, test kit may include saying of directions for use (for example, operation scheme) containing the method for putting into practice present invention description Bright property material.

In the present invention, by Exogenous DNA transfered plant, the nucleotide sequence of genomic modification system or table as described in by coding Reach box or recombinant vector and import plant cell, conventional method for transformation includes but is not limited to, Agrobacterium-medialed transformation, micro The DNA penetrate bombardment, directly DNA being taken in protoplast, electroporation or silicon whisker mediation imports.

The invention provides a kind of genomic modification system and application thereof, there is advantages below：

1st, the genomic modification system that the present invention provides, be can be used for plant oriented molecule breeding, is obtained by this method Just generation improvement plant, can obtain through heredity separation and have improved effect but the progeny plant of non-carry genetic modification composition, thus The Plant Genome stability risk that exogenous dna fragment insertion brings is eliminated while obtaining aroma characteristics.

2nd, the genomic modification system that the present invention provides can orient on the basis of pointed decoration crop endogenous gene and carry out Crop molecular improvement, the gene after targeting modification can be stable hereditary in offspring, and the technology such as overexpression, RNAi that overcome are held The defects such as the gene loss that is also easy to produce, silence.

3rd, the fragrance Oryza sativa L. that genomic modification system of the present invention is cultivated is not it is achieved that artificial culture contains transgene component Fragrance Oryza sativa L., purposiveness is strong, and Genomic damage is little, can evade the risk that transgenic may bring.

4th, genomic modification system of the present invention shortens the plant breeding time, accelerates breeding process, cost-effective, high Effect is precisely.

5th, the present invention formulates out the allelic form of new BADH2 gene first, and the insertion of 1bp occurs in the 7th exon, Enrich scent gene resource.

6th, the present invention formulates out odor type China first and accounts for rice material-rice plant-E7, in addition to having fragrance, in plant shape Other character aspects such as state, period of duration and wild type China account for rice material no significant difference, and therefore it can serve as fragrant rice breeding Germ plasm resource；When heterozygous state is in due to the BADH2 gene of rice plant-E7 of the present invention, its produce rice also have bright Aobvious fragrance, so the homozygosis material of rice plant-E7 can be applied to actual production directly as restorer, to obtain hybridization Kind, and then obtain the dulcet rice of tool.

Below by drawings and Examples, technical scheme is described in further detail.

Brief description

Fig. 1 is that the recombinant expression carrier DBN-E7-L of genomic modification system of the present invention and application thereof builds flow chart；

Fig. 2 is the recombinant expression carrier DBN-E7-R structural representation of genomic modification system of the present invention and application thereof；

Fig. 3 is the recombinant expression carrier pDBN-BADH2E7 structural representation of genomic modification system of the present invention and application thereof Figure；

Fig. 4 is the gas chromatography-mass spectrum figure of the fragrance matter 2-AP of genomic modification system of the present invention and application thereof；

Fig. 5 is the plant configuration figure in vegetative growth phase of genomic modification system of the present invention and application thereof；

Fig. 6 is the plant configuration figure in the period of maturation of genomic modification system of the present invention and application thereof；

Fig. 7 is the plant plant height comparison diagram in the period of maturation of genomic modification system of the present invention and application thereof；

Fig. 8 is the plant tillering number comparison diagram in the period of maturation of genomic modification system of the present invention and application thereof；

Fig. 9 is that 66 fragments to external source T-DNA area of genomic modification system of the present invention and application thereof carry out residual inspection The amplification region schematic diagram surveyed；

Figure 10 is 1 fragment in 66 fragments to external source T-DNA area of genomic modification system of the present invention and application thereof Carry out the amplification figure of residue detection；

Figure 11 is the employing 21 of genomic modification system of the present invention and application thereof to 3 pairs of primer pair external sources T-DNA in primer Area carries out the amplification figure of residue detection；

Figure 12 is 1 potential position of missing the target in the site of missing the target potential to 8 of genomic modification system of the present invention and application thereof Point carries out the sequencing result figure of effect identification of missing the target.

Specific embodiment

Further illustrate the technical scheme of genomic modification system of the present invention and application thereof below by specific embodiment.

The acquisition of the BADH2 gene order that first embodiment, rice material China account for

1st, the extraction of DNA

DNA extraction is according to conventional CTAB (cetyl trimethylammonium bromide) method adopting：Take the tender rice varieties of 2g children China accounts for after (China accounts for rice material and provided by Beijing gold Nong Huazhong industry company limited) blade of plant pulverizes in liquid nitrogen, Add 0.5ml in CTAB buffer (20g/L CTAB, 1.4M NaCl, 100mM Tris-HCl, 20mM of 65 DEG C of preheatings of temperature EDTA (ethylenediaminetetraacetic acid), adjusts pH to 8.0 with NaOH), after fully mixing, in 65 DEG C of extracting 90min of temperature；Successively add 0.5 times of volume of phenol and 0.5 times of volume of chloroform, overturn and mix；It is centrifuged 10min under 12000rpm (revolutions per minute) rotating speed；Inhale Take supernatant, add 2 times of volume dehydrated alcohol, softly rock centrifuge tube, in 4 DEG C of standing 30min of temperature；Under 12000rpm rotating speed It is centrifuged 10min again；Collect DNA to ttom of pipe；Abandon supernatant, the ethanol being 70% with 1ml mass concentration, washing precipitation； It is centrifuged 5min under 12000rpm rotating speed；Vacuum is drained or is dried up in super-clean bench；DNA is precipitated and dissolved in appropriate TE buffer In (10mM Tris-HCl, 1mM EDTA, pH8.0), under the conditions of being saved in -20 DEG C of temperature.

Template is expanded as PCR after the DNA of said extracted is diluted 10 times.

2nd, the BADH2 gene that amplifying rice material China accounts for

The BADH2 gene order of No. 11 rice materials, such as sequence table SEQ ID NO are spent in obtaining from NCBI:Shown in 3.

According to the middle BADH2 gene order spending No. 11 rice materials (as SEQ ID NO in sequence table:Shown in 3), design is drawn Thing

Primer 1-F：SEQ ID NO in ACCTATCGCTTTCCACCTC, such as sequence table:Shown in 4；

Primer 1-R：SEQ ID NO in CTCTCCGCTTGAACCCAT, such as sequence table:Shown in 5；

Primer 2-F：SEQ ID NO in CCAAATCGATCGATATGGTCTAG, such as sequence table:Shown in 6；

Primer 2-R：SEQ ID NO in CTATTTAGTACCATGCTTGGGTCAT, such as sequence table:Shown in 7；

Primer 3-F：SEQ ID NO in GATGCTTTGAGTACTTTGCAGATC, such as sequence table:Shown in 8；

Primer 3-R：SEQ ID NO in ATTGAGAGGAATATCATTTCCATTG, such as sequence table:Shown in 9；

Primer 4-F：SEQ ID NO in CTGATGTGTGTAAAGAGGTTGGT, such as sequence table:Shown in 10；

Primer 4-R：SEQ ID NO in AACATCATAGAGACATGGACACA, such as sequence table:Shown in 11；

Primer 5-F：SEQ ID NO in TCTCTTTGGTTGCTTTTGGAC, such as sequence table:Shown in 12；

Primer 5-R：SEQ ID NO in CAGCACCAGCCAGACCATAACT, such as sequence table:Shown in 13；

Primer 6-F：SEQ ID NO in TGGCCAACGATACTCAGTGAGTT, such as sequence table:Shown in 14；

Primer 6-R：SEQ ID NO in AATCAAACATCGATATGCACAA, such as sequence table:Shown in 15.

The BADH2 gene order of rice material is accounted for as template with China, enters performing PCR amplification according to following conditions：

Above-mentioned reaction buffer is：200mM Tris-HCl (pH8.4), 200mM KCl, 15mM MgCl₂.

PCR reaction condition is：94 DEG C of denaturations 5min, subsequently into following circulation：94 DEG C of degeneration 0.5min, 58 DEG C of annealing 0.5min, 72 DEG C of extension 2min, totally 30 circulations, last 72 DEG C of extension 5min.

Using PCR cleaning agents box (Axygen), purification is carried out to above-mentioned PCR primer, concrete grammar is with reference to its description of product Book；Directly carry out sequence verification, and each PCR primer sequence is spliced using ContigExpress Project software, with Obtain complete spliced sequence information；Confirm SEQ ID in the BADH2 gene order such as sequence table that rice material China accounts for NO:Shown in 16.

The sequence of BADH2 gene the 7th exon (E7) that the present invention is accounted for rice material China is for transcriptional activation increment effect SEQ ID NO in the target sequence of factor nucleic acid enzyme (TALEN), such as sequence table:The 2844th of 16 is to shown in the 2909th.

Second embodiment, the design of TALEN and acquisition

1st, the screening of TALEN target sequence

Target sequence E7 targeting rice material China accounts for the 7th exon of BADH2 gene, and sequence is as follows:5’- GtTGCATTTACTGGGAGTTatgaaactggtaaaaagattaTGGCTTCAGCTGCTCC Tatggttaag-3 ' (sequence table Middle SEQ ID NO:The 2844th of 16 is to the 2909th)；Wherein left and right sides capitalization is TALEN module recognition sequence (being respectively designated as L-E7 and R-E7), middle lower case is intervening sequence.

2nd, the design of TALEN encoding gene and synthesis

TALEN with the L-E7 in target sequence E7 for module recognition sequence is named as E7-L, described nuclease E7-L's Aminoacid sequence such as sequence table SEQ ID NO:Shown in 18, coding gene sequence such as sequence table SEQ ID of described nuclease E7-L NO:Shown in 17, wherein, SEQ ID NO in sequence table:17 1-465 position coding TAL effector N-terminal, 469-2214 position The identification albumen of coding L-E7,2215-2856 position encodes TAL effector C-terminal, and 2857-3459 position encodes endonuclease Enzyme Fok I；

TALEN with the R-E7 in target sequence E7 for module recognition sequence is named as E7-R, described nuclease E7-R's Aminoacid sequence such as sequence table SEQ ID NO:Shown in 19, coding gene sequence such as sequence table SEQ ID of described nuclease E7-R NO:Shown in 20, wherein, SEQ ID NO in sequence table:20 1-465 position coding TAL effector N-terminal, 469-2214 position The identification albumen of coding R-E7,2215-2856 position encodes TAL effector C-terminal, and 2857-3459 position encodes endonuclease Enzyme Fok I；

SEQ ID NO in sequence table:17 and SEQ ID NO:Polynucleotide sequence shown in 20 is biological by Nanjing Jin Sirui Science and Technology Ltd. synthesizes.

3rd embodiment, the structure of TALEN recombinant expression carrier and its conversion Agrobacterium

1st, build TALEN recombinant expression carrier pDBN-BADH2E7

With restricted enzyme BsaI and BsmBI E7-L polynucleotide sequence fragment and expression vector described in enzyme action respectively DBNBC-01 (carrier framework：PCAMBIA2301 (CAMBIA mechanism can provide)), by the E7-L cutting nucleotide sequence fragment It is inserted between the BsmBI site of expression vector DBNBC-01, be people in the art using conventional enzymatic cleavage methods carrier construction Known to member, it is built into recombinant expression carrier DBN-E7-L, it builds flow process (Kan as shown in Figure 1：Kanamycin gene； RB：Right margin；pr35S：Cauliflower mosaic viruses (CaMV35S) promoter (SEQ ID NO:21)；E7-L：E7-L nucleotides sequence Row (SEQ ID NO:17)；tNos：Terminator (the SEQ ID NO of rouge alkali synthetase gene:22)；LB：Left margin).

With restricted enzyme BsaI E7-R polynucleotide sequence fragment and expression vector DBNBC-01 described in enzyme action respectively (carrier framework：PCAMBIA2301 (CAMBIA mechanism can provide)), the E7-R cutting nucleotide sequence fragment is inserted into expression Between the BsaI site of carrier DBNBC-01, it is well known to those skilled in the art using conventional enzymatic cleavage methods carrier construction , it is built into recombinant expression carrier DBN-E7-R, its carrier structure (Kan as shown in Figure 2：Kanamycin gene；RB：Right margin； pr35S：Cauliflower mosaic viruses (CaMV35S) promoter (SEQ ID NO:21)；E7-R：E7-R nucleotide sequence (SEQ ID NO:20)；tNos：Terminator (the SEQ ID NO of rouge alkali synthetase gene:22)；LB：Left margin).

With restricted enzyme SpeI, AscI and BamHI enzyme action carrier is carrier pG (carrier framework：pCAMBIA2301 (CAMBIA mechanism can provide)), reclaim Backbone-Hpt fragment；With restricted enzyme SpeI and SfiI enzyme action restructuring table Reach carrier DBN-E7-L, reclaim E7-L cassette fragment；With with restricted enzyme SfiI and the recombinant expressed load of AscI enzyme action Body DBN-E7-R, reclaims E7-R cassette fragment；Connect above-mentioned Backbone-Hpt fragment, E7-L with T4 ligase Cassette fragment and the fragment of three recovery of E7-R cassette fragment, are built into recombinant expression carrier pDBN-BADH2E7, Its carrier structure (Kan as shown in Figure 3：Kanamycin gene；RB：Right margin；pr35S：Cauliflower mosaic viruses (CaMV35S) Promoter (SEQ ID NO:21)；E7-L：E7-L nucleotide sequence (SEQ ID NO:17)；tNos：Rouge alkali synthetase gene Terminator (SEQ ID NO:22)；E7-R：E7-R nucleotide sequence (SEQ ID NO:20)；Hpt：Hygromix phosphotransferase Gene (SEQ ID NO:23)；t35S：Cauliflower mosaic viruses (CaMV35S) terminator (SEQ ID NO:24)；LB：The left side Boundary).Then connection product is converted escherichia coli T1 competent cell (Transgen, Beijing, China with heat shock method； CAT：CD501), its hot shock condition is：50 μ l escherichia coli T1 competent cells, 10 μ l connection products, 42 DEG C of water-baths 30 seconds；37 DEG C culture 1 hour (under 100rpm rotating speed shaking table shake), then the LB solid in kanamycin containing 50mg/L (Kanamycin) put down In temperature on plate (tryptone 10g/L, yeast extract 5g/L, NaCl 10g/L, agar 15g/L adjust pH to 7.5 with NaOH) Grow overnight under the conditions of 37 DEG C.Picking white colony, LB fluid medium (tryptone 10g/L, yeast extract 5g/L, NaCl 10g/L, kanamycin 50mg/L, adjust pH to 7.5 with NaOH) under the conditions of 37 DEG C of temperature overnight incubation.Alkalinity extraction Its plasmid：Bacterium solution is centrifuged 1min under 12000rpm rotating speed, goes supernatant, the precipitation thalline solution I of 100 μ l ice pre-coolings (25mM Tris-HCl, 10mM EDTA (ethylenediaminetetraacetic acid), 50mM glucose, pH8.0) suspends；200 μ l are added newly to prepare Solution II (0.2M NaOH, mass concentration are 1%SDS (sodium lauryl sulphate)), pipe is overturned 4 times, mixing, puts ice Upper 3-5min；Add the ice-cold solution III of 150 μ l (3M potassium acetate, 5M acetic acid), fully mix immediately, place 5- on ice 10min；It is centrifuged 5min under the conditions of 4 DEG C of temperature, rotating speed 12000rpm, in supernatant, adds 2 times of volume dehydrated alcohol, mix Room temperature places 5min afterwards；It is centrifuged 5min under the conditions of 4 DEG C of temperature, rotating speed 12000rpm, abandon supernatant, precipitation mass concentration is Dry after 70% washing with alcohol；30 μ l are added to contain TE (10mM Tris-HCl, 1mM of RNase (Rnase, 20 μ g/ml) EDTA, pH8.0) dissolution precipitation；Water-bath 30min at 37 DEG C of temperature, digests RNA；In temperature, -20 DEG C save backup.

The plasmid extracting, after the identification of SpeI, AscI and BamHI enzyme action, is selected positive colony, is carried out sequence verification, obtains Correct recombinant expression carrier pDBN-BADH2E7.

2nd, recombinant expression carrier conversion Agrobacterium

Agrobacterium LBA4404 is transformed into oneself constructed correct recombinant expression carrier pDBN-BADH2E7 liquid nitrogen method (Invitrgen, Chicago, USA, CAT：In 18313-015), its conversion condition is：100 μ l Agrobacterium LBA4404s, 3 μ l matter Grain DNA (recombinant expression carrier)；It is placed in 10min in liquid nitrogen, 37 DEG C of tepidarium 10min；Agrobacterium LBA4404 after conversion is connect Plant and cultivate 2h under the conditions of 28 DEG C of temperature, rotating speed are for 200rpm in LB test tube, be applied to the rifampicin containing 50mg/L (Rifampicin) until growing positive monoclonal and on the LB flat board of kanamycin of 100mg/L, picking Colony Culture is simultaneously Extract its plasmid, carry out digestion verification with restricted enzyme, result shows that recombinant expression carrier pDBN-BADH2E7 structure is complete Total correctness.

Fourth embodiment, the rice plant of acquisition conversion

For agriculture bacillus mediated rice conversion, briefly, rice varieties China is accounted for seed and is seeded in inducing culture (N6 Salt 3.1g/L, N6 vitamin, casein 300mg/L, sucrose 30g/L, 2,4 dichlorophenoxyacetic acid (2,4-D) 2mg/L, inositol 100mg/L, plant gel 3g/L, pH5.8) on, induce calluss (step 1 from Mature Embryos of Rice：Wound healing induction step), Afterwards, preferred calluss, contact calluss with agrobacterium suspension, wherein Agrobacterium can be by described genomic modification system System is transferred at least one the cell (step 2 on calluss：Infect step).In this step, calluss preferably soak Enter agrobacterium suspension (OD₆₆₀=0.1, infect culture medium (N6 salt 3.1g/L, N6 vitamin, casein 300mg/L, sucrose 30g/L, glucose 10g/L, acetosyringone (AS) 40mg/L, 2,4 dichlorophenoxyacetic acid (2,4-D) 2mg/L, pH5.2)) in To start inoculation.Calluss co-culture one section of period (3 days) (step 3 with Agrobacterium：Co-culture step).Preferably, wound healing It is organized in and infect liquid medium within (N6 salt 3.1g/L, N6 vitamin, casein 300mg/L, sucrose 30g/L, Fructus Vitis viniferae after step Sugared 10g/L, acetosyringone (AS) 40mg/L, 2,4- dichlorphenoxyacetic acid (2,4-D) 2mg/L, inositol 100mg/L, pH5.8) Upper culture.After the here co-cultivation stage, there is " recovery " step.In " recovery " step, recovery media (N6 salt 3.1g/ L, N6 vitamin, casein 300mg/L, sucrose 30g/L, 2,4 dichlorophenoxyacetic acid (2,4-D) 2mg/L, inositol 100mg/L, Plant gel 3g/L, pH5.8) at least exist a kind of oneself know suppression Agrobacterium growth antibiotic (cephamycin 150- 250mg/L), without the selective agent (step 4 of vegetable transformant：Recovering step).Preferably, calluss there being antibiotic but There is no on the solid medium of selective agent culture, to eliminate Agrobacterium and to provide convalescent period for infected cell.Then, inoculation more Transformed calli (the step 5 that injured tissue is cultivated in the culture medium containing selective agent (hygromycin) and growth selection：Select step Suddenly).Preferably, calluss are having the screening solid medium of selective agent (N6 salt 3.1g/L, N6 vitamin, casein 300mg/L, sucrose 30g/L, hygromycin 50mg/L, 2,4- dichlorphenoxyacetic acid (2,4-D) 2mg/L, plant gel 3g/L, PH5.8) the upper cell selective growth cultivated, lead to conversion.Then, callus regeneration becomes plant (step 6：Regeneration step Suddenly) it is preferable that the calluss of growth are in solid medium (N6 division culture medium and MS life in the culture medium containing selective agent Root culture medium) above cultivate with aftergrowth.

Screen the resistant calli obtaining and transfer to described N6 division culture medium (N6 salt 3.1g/L, N6 vitamin, cheese Plain 300mg/L, maltose 30g/L, inositol 100mg/L, proline 3 00mg/L, glutamic acid 200mg/L, hygromycin 10mg/L, 6- Benzyl aminoadenine 2mg/L, naa 1mg/L, plant gel 3g/L, pH5.8) on, culture differentiation at 25 DEG C.Break up out Seedling transfers to described MS root media (MS salt 2.15g/L, MS vitamin, casein 300mg/L, sucrose 15g/L, plant Gel 3g/L, pH5.8) on, cultivate high to about 10cm at 25 DEG C, move to hot-house culture.In greenhouse, train at 28 DEG C daily Support, obtain the T of conversion₀Rice plant.

5th embodiment, the mutation result of detection BADH2 gene

1st, the extraction of DNA

Method according to DNA extraction described in first embodiment 1 extracts the T of above-mentioned conversion₀The DNA of rice plant blade, And expand template as PCR after the DNA of described extraction is diluted 10 times.

2nd, detect the mutation result of BADH2 gene

According to the amplification method in above-mentioned first embodiment 2 and condition, design primer amplification and comprise target sequence E7's Section：

Primer 7-F：SEQ ID NO in CTGATGTGTGTAAAGAGGTTGG, such as sequence table:Shown in 25；

Primer 7-R：SEQ ID NO in TTTCCACCAAGTTCCAGTG, such as sequence table:Shown in 26.

By sequencing analysis, obtain the T that target sequence E7 undergos mutation₀Rice plant-E7, the target sequence E7 such as sequence after mutation SEQ ID NO in list:Shown in 27, its mutant form is to be inserted into base A in target sequence E7.Therefore after mutation SEQ ID NO in BADH2 gene order such as sequence table:Shown in 28, SEQ ID NO in its CDS sequence such as sequence table:Shown in 29.

3rd, obtain the T of mutation₂The seed of rice plant-E7

In (28 DEG C about) of the greenhouse described T of culture₀Rice plant-E7, to solid, harvests the T of mutation₁Rice plant-E7's Seed.

In (28 DEG C about) of the greenhouse described T of plantation₁The seed of rice plant-E7, obtains the T of mutation₁Rice plant-E7, cuts Take described T₁The seedling leaves (the 7-10 days after emerging) of rice plant-E7, according to the method for said extracted DNA, using primer 7-F and primer 7-R amplification comprises the section of target sequence E7, after sequencing analysis, by described T₁Rice plant-E7 divides into not The T undergoing mutation₁Rice plant, the T of homozygosis₁Rice plant-E7 and the T of heterozygosis₁Rice plant-E7 three types, treat that it is ripe Harvest the above-mentioned T not undergone mutation afterwards₁The seed of rice plant, the T of homozygosis₁The seed of rice plant-E7 and the T of heterozygosis₁Oryza sativa L. The seed of plant-E7.

Sixth embodiment, the fragrance identification of mutant material

1st, the fragrance identification of the rice plant blade of mutation

The T not undergone mutation described in weighing respectively₁Rice plant, the T of described homozygosis₁Rice plant-E7, described heterozygosis T₁Rice plant-E7, the China of British plain spirits account for each 2g of seedling leaves (tri-leaf period) of rice plant, put into 50ml centrifuge tube after shredding In, the KOH solution that adds 10ml concentration to be 1.7% (m/v), seal and place 10min at 30 DEG C of temperature, open lid Son, hears its abnormal smells from the patient immediately one by one, according to the strong classification of fragrance.This experiment is carried out using the method that five people evaluate respectively, and is reflected The title determining material is labeled by the way of random coded, and such as 1,2,3,4 by that analogy.

Above-mentioned test result indicate that：Five people are completely the same to the judged result of above-mentioned material, i.e. the T of homozygosis₁Oryza sativa L. is planted - E7 is savory for strain, the T of heterozygosis₁Rice plant-E7, the T not undergone mutation₁It is equal that the China of rice plant and British plain spirits accounts for rice plant There is no fragrance.

2nd, the fragrance identification-abnormal smells from the patient of the rice plant seed of mutation

The T not undergone mutation described in taking respectively₁The seed of rice plant, the T of described homozygosis₁The seed of rice plant-E7, The T of described heterozygosis₁The seed of rice plant-E7, the China of British plain spirits account for each 1000 of the seed of rice plant, and seed shells, point Do not put in little bowl, add little water, be respectively put on the steaming tray of four steamers, cover pot cover and steamer is individually positioned in four Directly carry out steaming and decocting in the room of individual independent closed.After about 40min, hear whether savory in room first, then raise steamer Lid, hear whether savory, finally take out well-done seed, more whether savory hear.Hear its abnormal smells from the patient one by one, according to fragrance Strong classification.This experiment is carried out using the method that five people evaluate respectively, and the title of identified material adopts the side of random coded Formula is labeled, and such as 1,2,3,4 by that analogy.

Above-mentioned test result indicate that：Five people are completely the same to the judged result of above-mentioned material, i.e. the T of homozygosis₁Oryza sativa L. is planted The seed of strain-E7 is savory, the T not undergone mutation₁The seed that the China of the seed of rice plant and British plain spirits accounts for rice plant does not have Savory；T due to heterozygosis₁The seed having 25% in the seed that rice plant-E7 selfing produces is to have dulcet homozygosis base Because of type seed, therefore the T of heterozygosis₁The seed of rice plant-E7 is also savory.

3rd, the fragrance identification-gas chromatography-mass spectrography of the rice plant seed of mutation

Carry out the mensure of 2-AP content by GC-MS (Gc/ms Analyser), concrete grammar is：Weigh respectively The T of homozygosis described in 0.5g₁The seed of rice plant-E7 and the T of described heterozygosis₁The seed of rice plant-E7, puts after shelling respectively Enter in 2ml centrifuge tube, fully clayed into power using high-speed oscillator, powder is transferred in 5ml jaw bottle, add 2ml to extract Liquid (dehydrated alcohol:Dichloromethane=1:1 (volume ratio), and the 2，4，6-trimethylpyridine containing 0.5mg/L is as internal reference).Pincers After mouthful bottle good seal, process 3 hours at 80 DEG C of temperature, be subsequently cooled to room temperature, be centrifuged 5 minutes under 13800rpm rotating speed, take Supernatant to sample bottle, using GC-MS instrument (GC7890A-5975C MS；Agilent Technologies, Santa Clara, CA, USA) carry out the mensure of 2-AP content.DB-5MS capillary column (30m × 0.25mm × 0.25 μm, J＆W) initial Temperature is 50 DEG C, keeps 2 minutes, is then warming up to 120 DEG C with 5 DEG C/min of speed, then again with 15 DEG C/min of speed It is warming up to 280 DEG C, and keep 3 minutes.GC-MS instrument is in electron-impact mode, and ionization voltage is 70eV, and ion source temperature is 230℃.Simultaneously using China account for the seed of rice plant and the seed (being given by China Agricultural University) of Japanese fine rice plant as Negative control, is detected using the seed (buying on market) of rice fragrance of a flower rice plant according to the method described above as positive control Analysis.Experiment sets 3 repetitions, averages.

As shown in figure 4, above-mentioned test result indicate that：Wild type China accounts for the fine Oryza sativa L. of seed and wild type Japan of rice plant It is not detected by the presence of fragrance matter 2-AP in the seed of plant；The T of described homozygosis₁The seed of rice plant-E7 and described miscellaneous The T closing₁The seed of rice plant-E7 is respectively provided with a certain amount of 2-AP, and the T of homozygosis₁The 2-AP of the seed of rice plant-E7 contains Amount is suitable with the seed of rice fragrance of a flower rice plant.

7th embodiment, the rice plant of analysis mutation

1st, the identification of plant configuration

For plant configuration to the described T not undergone mutation₁Rice plant, the T of described homozygosis₁Rice plant-E7 and China accounts for rice plant and carries out overall Phenotypic Observation and assessment in vegetative growth phase and period of maturation respectively, and carries out strain in the period of maturation High and tiller number is investigated.

As viewed in figures 5-8, in addition to aroma characteristics, in vegetative growth phase and period of maturation, in the described T not undergone mutation₁Water Rice plants, the T of described homozygosis₁Rice plant-E7 and China account for and other forms differences, concrete bag are not observed between rice plant Include plant growing way, plant type, plant height and tiller number.And the T of described homozygosis₁The blade of rice plant-E7 is savory, described does not occur The T of mutation₁Rice plant and the magnificent blade accounting for rice plant all do not have fragrance.

2nd, the external source T-DNA residue detection of the rice plant of mutation

Method according in the 5th embodiment 1 extracts the T of described homozygosis₁The leaf DNA of rice plant-E7, designs primer 8-F is (as SEQ ID NO in sequence table:Shown in 30) respectively with primer 8-R-1 (as SEQ ID NO in sequence table:Shown in 31), draw Thing 8-R-2 is (as SEQ ID NO in sequence table:Shown in 32) combine two pairs of primers, according to first embodiment amplification method and Condition, carries out external source T-DNA area target fragment augmentation detection (amplification region covers the 10% of external source T-DNA region), and obtains Many plants of residue detection are the T of the described homozygosis of negative (i.e. external source T-DNA area target fragment noresidue)₁Rice plant-E7.

Primer 8-F：SEQ ID NO in CTCCGTGACCGAGTTCAAGT, such as sequence table:Shown in 30；

Primer 8-R-1：SEQ ID NO in GACCGGGTCACGCTGCAC, such as sequence table:Shown in 31；

Primer 8-R-2：SEQ ID NO in TGCTTTGAAGACGTGGTTGGAA, such as sequence table:Shown in 32.

Using above-mentioned acquisition many plants of residue detection be negative described homozygosis T₁The leaf DNA of rice plant-E7, presses According to said method design primer 9-74 (as SEQ ID NO in sequence table:Shown in 33-164), according to the amplification side of first embodiment 66 fragments in external source T-DNA area are carried out augmentation detection by method and condition, account for rice plant using wild China right as feminine gender simultaneously According to rice plant being accounted for as positive control using the China containing external source T-DNA area, is tested and analyzed according to the method described above.Experiment If 3 repetitions.As shown in figure 9, amplification region covers the 96% of external source T-DNA region.Obtain 5 plants of residue detection and be feminine gender The T of the described homozygosis of (i.e. 66, external source T-DNA area fragment noresidue)₁Rice plant-E7, such as Figure 10 (+：Containing external source T-DNA The China in area accounts for rice plant；-：Represent that wild China accounts for rice plant；1st, 2,3,4,5 represent that 5 plants of obtained residue detection are The T of negative described homozygosis₁Rice plant-E7) shown in, Figure 10 show only the amplification of wherein 1 fragment, other 65 The amplification of fragment is consistent with it.

According to national transgenic detection method, using 21 to primer (the primer 75- used by national detection GMOs department 95, such as SEQ ID NO in sequence table:Shown in 165-206), the T to 5 plants of described homozygosis of above-mentioned acquisition₁Rice plant-E7 enters 21 fragments in row external source T-DNA area carry out augmentation detection, account for rice plant as negative control using wild China, to contain simultaneously The transformation event DNA sample of element to be detected, as positive control, is tested and analyzed according to the method described above.Experiment sets 3 weights Multiple.As Figure 11 (+：Contain the transformation event DNA sample containing element to be detected；-：Represent that wild China accounts for rice plant；1、2、3、 4th, the T of the no new described homozygosis of external source T-DNA residual of 5 plants obtained by 5 expressions₁Rice plant-E7) shown in, final acquisition The T of 5 plants of no new described homozygosis of external source T-DNA residual₁Rice plant-E7 (mutant of BADH2 gene)；Figure 11 only opens up Show the amplification of wherein 3 pairs of primers, other 18 is consistent with above-mentioned 3 pairs of primers to the amplification of primer.

3rd, the effect identification of missing the target of the rice plant of mutation

By TALEN module recognition sequence L-E7 (TGCATTTACTGGGAGTT) used in the present invention and R-E7 (AGGAGCAGCTGAAGCCA) in Cornell University website (https://tale-nt.cac.cornell.edu/node/add/ Talef-off-paired it is analyzed on), obtains 8 sites of potentially missing the target, specifying information is as shown in table 1.Using above-mentioned The T of 5 plants the obtaining no new described homozygosis of external source T-DNA residual₁The leaf DNA of rice plant-E7, separately designs primer, Expand above-mentioned 8 site areas of potentially missing the target, rice plant is accounted for as comparison using China simultaneously, detected according to the method described above Analysis.Experiment sets 3 repetitions.After sequencing, by 5 plants no external source T-DNA residual new described homozygosis T₁Rice plant-E7's The sequence that sequence accounts for rice plant with China is compared.

The specifying information table in 1,8 sites of potentially missing the target of table

As Figure 12 (T of the no new described homozygosis of external source T-DNA residual of 5 plants obtained by 1,2,3,4,5 expressions₁Oryza sativa L. Plant-E7) shown in, all do not undergo mutation in above-mentioned 8 potential sites of missing the target, effect of not missing the target, and Figure 12 show only The sequencing result in wherein 1 potential site of missing the target, the sequencing result in other 7 potential sites of missing the target is consistent with it.

In sum, genomic modification system of the present invention can be used for plant oriented molecule breeding, separates and can obtain through heredity Must have improved effect but the progeny plant of non-carry genetic modification composition, and can be stable hereditary in offspring, shorten plant simultaneously Thing breeding time, accelerates breeding process, cost-effective, efficiently precisely；The present invention formulates out the equipotential of new BADH2 gene first Form, it is achieved that artificial culture does not contain the fragrance Oryza sativa L. of transgene component, purposiveness is strong, gene for thus obtained fragrance Oryza sativa L. Group is damaged little, can evade the risk that transgenic may bring, and odor type China accounts for rice material-rice plant-E7, except having perfume (or spice) Outside taste, in terms of other character such as plant forms, period of duration, account for rice material no significant difference, in actual production with wild type China In have broad application prospects.

It should be noted last that, above example only in order to technical scheme to be described and unrestricted, although ginseng According to preferred embodiment, the present invention is described in detail, it will be understood by those within the art that, can be to the present invention Technical scheme modify or equivalent, without deviating from the spirit and scope of technical solution of the present invention.

Claims

1. a kind of identification albumen is it is characterised in that include：

2. a kind of identification nucleotide sequence is it is characterised in that include：

A () encodes the nucleotide sequence identifying albumen described in claim 1；Or

B () has SEQ ID NO:Nucleotide sequence shown in 17 469-2214 positions；Or

C () has SEQ ID NO:Nucleotide sequence shown in 20 469-2214 positions.

3. a kind of nuclease comprising identification albumen described in claim 1.

4. nuclease according to claim 3 is it is characterised in that described nuclease also includes TAL effector N-terminal, TAL Effector C-terminal and Cobra venom endonuclease.

5. a kind of genomic modification system is it is characterised in that include for identifying SEQ ID NO:The nuclease of 1 3-19 position E7-L and be used for identifying SEQ ID NO:The nuclease E7-R of the reverse complementary sequence of 2 9-25 positions, described nuclease E7-L bag Containing (a) described protein in identification albumen described in claim 1, described nuclease E7-R comprises to identify egg described in claim 1 (b) described protein in white.

6. genomic modification system according to claim 5 is it is characterised in that the aminoacid sequence of described nuclease E7-L As SEQ ID NO:Shown in 18, the aminoacid sequence such as SEQ ID NO of described nuclease E7-R:Shown in 19.

7. genomic modification system according to claim 6 is it is characterised in that encode the core of described genomic modification system Nucleotide sequence includes SEQ ID NO:17 and SEQ ID NO:Nucleotide sequence shown in 20.

8. a kind of expression cassette it is characterised in that be included in effectively connection regulating and controlling sequence regulation and control under coding claim 5 to 7 The nucleotide sequence of genomic modification system described in any one.

9. a kind of recombinant expression carrier is it is characterised in that contain genomic modification system described in coding any one of claim 5 to 7 The nucleotide sequence of system or expression cassette described in claim 8.

10. a kind of fixed point knock out paddy gene BADH2 method it is characterised in that include in Oryza sativa L. expression claim 5 to Genomic modification system described in 7 any one.

A kind of 11. methods producing fragrance Oryza sativa L. are it is characterised in that include repairing genome described in any one of claim 5 to 7 Recombinant expression carrier Introduced into Rice genome described in expression cassette described in decoration system or claim 8 or claim 9.

A kind of 12. methods producing fragrance rice are it is characterised in that include the fragrance water producing claim 11 methods described Rice selfing or with another rice plant hybridization, with obtain have dulcet rice.

Use in obtaining fragrance Oryza sativa L. or fragrance rice for the genomic modification system described in a kind of 13. any one of claim 5 to 7 On the way.

A kind of 14. test kits are it is characterised in that include genomic modification system described in any one of claim 5 to 7, for increasing The strong modification efficiency to target sequence.