CN106434892A - Primer and kit for detecting non-communicating hydrocephalus susceptibility - Google Patents
Primer and kit for detecting non-communicating hydrocephalus susceptibility Download PDFInfo
- Publication number
- CN106434892A CN106434892A CN201610767870.0A CN201610767870A CN106434892A CN 106434892 A CN106434892 A CN 106434892A CN 201610767870 A CN201610767870 A CN 201610767870A CN 106434892 A CN106434892 A CN 106434892A
- Authority
- CN
- China
- Prior art keywords
- gene
- hydrocephalus
- primer
- kit
- noncommunicating
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention discloses a primer and kit for detecting a non-communicating hydrocephalus susceptibility gene. A method for detecting the non-communicating hydrocephalus susceptibility gene is used for detecting a polymorphic site rs2719 of a susceptibility gene GSTT2. The primer and kit can be used for accurately detecting the non-communicating hydrocephalus susceptibility gene, and a new idea can be provided for intensive study, auxiliary diagnosis, preventive treatment and new drug research and development for non-communicating hydrocephalus by means of the primer and kit.
Description
Technical field
The present invention relates to a kind of detection kit, the particularly gene detecting kit of noncommunicating hydrocephalus.
Background technology
Hydrocephalus is due to brain disorder so that cerebrospinal fluid hypersecretion or (with) circulation, malabsorption and cause encephalic brain
Spinal fluid amount increase, Decrease density plaques or (with) cavum subarachnoidale expand a kind of illness.Its classical symptom for headache, vomiting,
Eye-blurred, papilledema, even with diplopia, dizziness and epileptic attack.Untreated congenital hydrocephalus, though having
20% can stop development, but, about dead in half infant a year and a half.
Hydrocephalus is divided into communicating hydrocephalus and noncommunicating hydrocephalus, and the formation of the cerebrospinal fluid of normal person and absorption are one
Individual dynamic equilibrium process.The formation of cerebrospinal fluid is to be produced by the choroid plexus of telocoele, and the cerebrospinal fluid that choroid plexus produces passes through
Other ventricles of the brain, flow to cavum subarachnoidale through the gap of cerebellum and pons, and the blood vessel through cavum subarachnoidale is reuptaked, to reach
To balance.If the cerebrospinal fluid that choroid plexus produces is too much or cavum subarachnoidale generation fibrillatable, may result in communicating brain and amass
Water, noncommunicating hydrocephalus also known as internal hydrocephaly, refer to pathology be positioned at ventricular system or near, block ventricular system brain
Spinal fluid circulates and is formed, i.e. fourth ventricle outlet occurs to block the hydrocephalus causing with upper bit, is common in arachnoid cyst, water guide
Pipe locking or narrow, median aperture or foramen of Monro depauperation, Chiari deformity, craniopharyngioma etc..Originally hydrocephalus infant does not has
Obvious clinical manifestation, with increasing of cerebrospinal fluid, infant shows as obvious head circumference and increases, and language cognition abilities is by shadow
Ring, quadriplegia；Infant needs to do cerebrospinal fluid shunt operation, i.e. shunts too much cerebrospinal fluid through conduit to abdominal cavity from telocoele
Treat；Therefore the early diagnosis to infant is extremely important, it is possible to achieve early diagnosis early treatment；Current diagnosis is mainly core
Magnetic resonance imaging technology, by patient's brain scans, determines Evan ratio, i.e. the widest part of telocoele is the widest with brain
The ratio of part, is hydrocephalus if greater than 0.3, but, dynamic sensitivity, easily produces to patient body needed for NMRS costly
Raw artifact, sweep time is long, and some patients has claustrophobia；And the brain judging after scanning with nuclear magnetic resonance technique amasss
Water be intended to by the time patient morbidity even seriously ill after just can be diagnosed, be unfavorable for so very much the control of the state of an illness, and hydrocephalus patient be such as
Can effective symptom management if fruit early diagnosis early treatment.
Since oneth century, people are to hydrocephalic physiology, biochemistry, image, drug therapy and society family, environment etc.
Aspect is observed, and is made that various hypothesis and judgement to hydrocephalus pathogenesis, with scientific and technological progress, it is increasingly recognised that base
Because defect is the major reason producing noncommunicating hydrocephalus, through investigation, noncommunicating hydrocephalus is that heredity grade is very high
Disease, how science and technology to treat communicating hydrocephalus growing today, how from heredity angle detection tumor susceptibility gene and individual
The disease susceptibility of body, thus carry out further risk profile and diagnosis, become numerous scientific and technical personnel and health care personnel face
The Tough questions facing,
Utilize genetic marker to detect Disease-causing gene, be the technology developing in recent years.Genetic marker, i.e. in dyeing
There is one section of specific DNA sequence fragment on body, and have polymorphism, in generations' transmission, it then follows rule is for separating, independently distributing
With chain rule, inhereditary material transmission information therefore can be obtained.Genetic marker can be zones of different gene element, by even
Lock and association analysis can obtain Disease-causing gene designation of chromosome region, can clone this ospc gene further.For various
Various disease, finds Disease-causing gene and analyzes one of key being to study.
Third generation genetic marker SNP (single nucleotide polymorphism) refers to certain particular core in genome
Can there are two or more different bases, minimum gene frequency >=1% in colony on the position of thuja acid.The mankind
Genome in most SNP site only exist 2 kinds of allele, so usual SNP can refer on location, a certain nucleotides
Diallelic change occurs.SNP is the extremely important method that the Human Genome Project moves towards application.It is primarily due to SNP to carry
It for a very strong instrument, is used for discovery, the qualification of diseases predisposing gene, drug design and the underlying biological of people at highest risk
Learn research etc..Because the mankind exist SNP site in a large number, provide the relation between more opportunity discovery gene and disease.Pass through
The sudden change of SNP discovery disease related gene is easier than researchs such as familys.Some SNP is not Disease-causing gene, but it may be with
Some adjacent Disease-causing gene is chain, is vital signs too.
SNP (is positioned at the possible direct shadow of SNP of gene internal so that its density height (average every 1kb just has 1), representativeness are strong
Ring protein structure or expression), genetic stability good (with microsatellite polymorphism comparatively speaking), be easy to automated analysis
Features such as (because SNP mostly is biallelic marker in crowd, can be simply with " +/-or 1/0 " direct parting) becomes good
Genetic marker.
There is no any result of study being associated with noncommunicating hydrocephalus with regard to GSTT2 gene at present, the present invention first
Noncommunicating hydrocephalus tumor susceptibility gene is detected by the secondary SNP of utilization technology, is the further investigation of noncommunicating hydrocephalus and anti-
Control, diagnose, treat and provide new thinking.
Content of the invention
It is an object of the invention to provide a kind of primer detecting noncommunicating hydrocephalus neurological susceptibility and kit, thus meet
This area, for the correct demand identifying noncommunicating hydrocephalus tumor susceptibility gene, is the further investigation of noncommunicating hydrocephalus, pre-
Anti-, treatment, diagnosis provide new thinking.
Inventor is shown by result of study, and No. 22 Chromosome G STT2 genes are positioned at 22q11.23, coding for glutathion sulphur
Transferase, is the tumor susceptibility gene of noncommunicating hydrocephalus, by the SNP site to GSTT2 gene：Rs2719 is analyzed, knot
Fruit display, rs2719 and noncommunicating hydrocephalus height correlation.
It is an object of the invention to be achieved through the following technical solutions：
1st, a kind of primer detecting noncommunicating hydrocephalus tumor susceptibility gene, it is characterised in that：Described primer is amplification GSTT2
Shown in the nucleotide sequence of gene rs2719, respectively sequence table SEQ ID No.1 and sequence table SEQ ID No.2.
2nd, a kind of kit detecting noncommunicating hydrocephalus tumor susceptibility gene, it is characterised in that include following reagent：
1) primer：For SEQ ID No.1, the nucleotide sequence shown in SEQ ID No.2,
2) PCR amplification buffer, Taq archaeal dna polymerase,
3) dNTP mixed liquor.
Specifically, the present invention realizes by following technical scheme：
The nucleotide sequence of a kind of GSTT2 tumor susceptibility gene rs2719 detecting noncommunicating hydrocephalus, is sequence table SEQ
Nucleotide sequence shown in ID No.3.This nucleotide sequence is positioned at GSTT2 gene, its variant sites, represents with letter " R ",
When the genotype of described mononucleotide polymorphism site rs2719 is G, the neurological susceptibility of experimenter is minimum, carries T
When allele, the neurological susceptibility of experimenter raises.
The detection method of a kind of vitro detection noncommunicating hydrocephalus tumor susceptibility gene, comprises the steps：
1st, extracting genome DNA
Use the kit extracting DNA, extract the DNA of full-length genome in the leucocyte of peripheral blood
2nd, genomic DNA quality testing
3rd, the detection of Genome DNA content and purity
4th, utilizing primer, PCR expands purpose fragment
The primer of amplification GSTT2 gene rs2719 polymorphism is respectively：The nucleotides of SEQ ID No.1, SEQ ID No.2
Sequence
5th, the genotype of pleomorphism site is detected.
By PCR primer direct Sequencing, the difference according to fluorescence signal judges genotype.
6th, result judges
The individuality that rs2719 base is (T) is noncommunicating hydrocephalus Susceptible population.
The assay method of the present invention determines the genomic DNA deriving from people, and sample source is unrestricted, as：Body fluid (blood
Liquid, ascites and urine etc.), histocyte (such as hepatic tissue) etc..Genomic DNA can be prepared by extracting and purifying these samples.
Adjust the concentration of genomic DNA so that it is consistent as far as possible.With genomic DNA as template, amplifiable go out gene containing GSTT2 dash forward
The nucleic acid fragment of displacement point, to obtain the great amount of samples of mensuration.This DNA fragmentation by the amplification point of genetic mutation containing GSTT2
The sample obtaining, is particularly suited for use as measuring material.
When carrying out gene auxiliary diagnosis, the present invention is preferably applied in and measures according to the existence of GSTT2 gene mutation type
Auxiliary diagnostic, auxiliary diagnostic includes the particular agent as neccessary composition, and it is corresponding to being used for measuring gene mutation
The method of type.Select suitable particular agent by the assay method using, such as DNA fragmentation and/or for PCR amplification step
Primer.
The statistical analysis by large sample for the present invention, have studied the rs2719 pleomorphism site of GSTT2 gene order non-
The gene frequency of communicating hydrocephalus patient, and according to transmission situation in ill children for the genotype, carry out transmitting not
Balance check and haplotyping, it was found that the genotype distribution of whole sample and gene frequency all meet Hardy-
Weinburg balances, and corrects through Bonferroni, and transmission disequilibrium check analysis has significant statistics difference, passes through full-page proof
This experiment is proved.
Judge the method for the Susceptible population of noncommunicating hydrocephalus according to the present invention by GSTT2 gene base mutation characteristic,
The examination of following method can be carried out to the crowd not showing clinical symptoms, rs2719 base be G be not susceptible to communicating brain
Ponding, rs2719 base is the easily generation noncommunicating hydrocephalus of T, is Susceptible population, has the family of this type of disease, must not avoid as taboo
Disease avoids doctor, causes the state of an illness day by day to deteriorate, delays, and causes the result being difficult to rehabilitation.This disease is prevented and treated early, is the present invention
One important use.
Compared with prior art, beneficial effects of the present invention is embodied in：
Noncommunicating hydrocephalus susceptible gene is detected by the 1st, the invention, main to hydrocephalic detection at present
If by way of nuclear magnetic resonance, and this method can not realize early diagnosis.
2nd, the present invention can realize early diagnosis, and traditional immunology diagnosis is mainly antigen-antibody reaction, is applied to face
After bed generally produces antibody in vivo, and there is longer " window phase " in the immunology detection of many, is unfavorable for disease
Early diagnosis, utilizes the kit of the present invention to detect, can be greatly shortened " window phase ", although its highly sensitive detection is also
Be conducive to the early diagnosis of disease, and if the patient of communicating hydrocephalus detected before serious symptom occurs, just
Can realize early diagnosing early treatment.
3rd, sample simple and convenient, can be by marks such as detection specific gene in the blood preparation of patient, present invention blood
Noncommunicating hydrocephalus is detected by this, belongs to the operation that those skilled in the art utilize prior art easily to realize.
4th, compared with traditional gene amplification, the detection method that the present invention provides saves time, highly sensitive, specifically
By force.
5th, utilize the present invention to illustrate the nucleotide variation of GSTT2 gene loci, as one of biomarker, can be used for medicine
The screening of the molecular target of design, has, to help to find, the bioactive molecule that regulation GSTT2 expresses, may advantageously facilitate non-communicating
Hydrocephalus new drug development.
Detailed description of the invention
Embodiment 1
1st, candidate gene and SNPs are selected
The present inventor's consulting literatures, utilize computer internet and bioinformatics to obtain each side communicating hydrocephalus to wait
Select gene studies, carry out Single nuclear polymorphism (SNP) at No. 22 chromosomes by linkage disequilibrium value method chain not
Equilibrium analysis, by NCBI (http://www.ncbi.nlm.nih.gov) database, it is thus achieved that GSTT2 gene, and pass through
http://www.ncbi.nlm.nih.gov/SNP, http://snp.cshl.org/ database, searches out and meets its condition
Candidate gene SNPs.Its inclusion criteria：1st, existing pertinent literature is reported；2nd, the minimum gene frequency in site should be greater than
10%；3rd, selected SNPs allows for meeting the requirement of primer-design software；4th, selected site can not affect Genotyping experiment.
2nd, research object
The present invention with 298 case noncommunicating hydrocephaluses and 301 case normal healthy controls (healthy, without physical disease, without family
Genetic disease history, be a cup too low history of disease, without drug abuse) it is research object.All research objects are Chinese han population, and
And sign the Informed Consent Form of Ethics Committee's approval voluntarily.
2.1 noncommunicating hydrocephaluses enter group and exclusion standard
2.1.1 enter group standard
(1) non-communicating non-hydrocephalus diagnostic criteria is met；
(2) voluntary participation sign Informed Consent Form.
2.1.2 exclusion standard
(1) it is diagnosed as communicating hydrocephalus patient；
(2) clear and definite central nervous system disease, such as apoplexy, Parkinson and epilepsy etc.
(3) severe physical disease, such as infection, diabetes and hypertension etc.；
3rd, blood and clinical data are collected
Experimenter is after the project Informed Consent Form conscientiously reading, understand and signing voluntarily Ethics Committee's approval, outside taking
In week venous blood 5ml ,-20 degree preserve to extraction genomic DNA.Collect noncommunicating hydrocephalus patient age, sex, family history,
National with schooling, be admitted to hospital and the data related with disease such as the time of making a definite diagnosis, clinical symptoms, cognitive function first；Normal person
Collect general demographic data and cognitive function measuring scale.
3.1 extracting genome DNA
Use the special DNA kit that extracts, the DNA of full-length genome in the leucocyte of extraction peripheral blood.Operating procedure is as follows：
Blood thaws, mark 1.5mlEppendorf centrifuge tube → cell pyrolysis liquid 900uL add in centrifuge tube → add thaw after complete
After blood 200uL, mix, under normal temperature, act on 20min, and reverse 4-6 time → 10,000rpm centrifugation time 4min, remove supernatant, so
Rear vibration, makes sediment again suspend → 300uL karyorhexis liquid, then vibrates lightly so that it is mix, then 37 DEG C of water-baths
30min → RNA digestive enzyme 1.5 μ L, vibration mixes, and water-bath 15min, 37 DEG C → albumen precipitation liquid 100uL flick at the bottom of pipe, normal temperature
Effect 20min → 12,000rpm centrifuges 4min, transfers to have added in the centrifuge tube of isopropanol 300uL by supernatant, 20min
Overturning → 12 gently, 000rpm centrifuges 4min, abandons supernatant, adds 70% ethanol 300uL, shakes up → 12 gently, and 000rpm centrifuges
4min, abandons supernatant, by centrifuge tube oblique inverted, waits airing → DNA lysate 100uL to mix, water-bath 1h, 65 DEG C (or 4 DEG C of mistakes
Night), DNA has prepared in centrifuge tube and has finished.
3.2 genomic DNA quality testings
Take 1-2 μ L genomic DNA stoste, whether meet quality by the extracted DNA sample of agarose electrophoresis method detection
Standard requires；
3.3 Genome DNA contents and the detection of purity
With NanoDrop-1000 all-wave every part of sample DNA content of long ultraviolet/visible light scanning spectrophotometer Accurate Determining
With OD ratio (A260/A230, A260/A280).A260/A230 ratio is low：The salt of small molecular weight impurity or remaining pollutes, if too high
There is the impurity of the unknown.Ratio (A260/A280) is low：Caused by albumen or phenol have residual；Ratio (A260/A280) ratio is high：
Caused by RNA has residual；Usual A260/A280 ≈ 1.8 representative sample DNA is pure
4th, primer is designed
The primer of amplification GSTT2 gene rs2719 polymorphism is respectively：
TCTCTCCAGCTTCATGTGAAGCTCTGCACA(SEQ ID No.1)
ATTGCAGATTTAGTGTCTTACTGGTTATGT(SEQ ID No.2)
PCR expands purpose fragment
Applying above primer to enter performing PCR amplification, PCR reaction system is 20ul, wherein Tris-HCl containing 10mM (PH8.4),
50mM KCl, 1.5mM MgCl2,200uM dNTP, each 0.4uM of upstream and downstream primer, Taq polymerase 1U, DNA profiling 30-50ng,
PCR amplification condition is：PCR reaction condition is 95 DEG C of denaturations 5min, 95 DEG C of denaturation 30s, 66 DEG C of annealing 30s, 72 DEG C of extensions
25s, altogether 35 circulations, 72 DEG C of overall elongation 2min, take PCR primer 5ul 1.5% agarose gel electrophoresis, with DNAmarker
For molecular weight standards, amplification.
5th, order-checking judges genotype
PCR primer detects through 8% polyacrylamide gel electrophoresis, and gel imaging system observes qualified rear gene sequencing company
Carry out sequence verification.
6th, result judges
The individuality that rs2719 base is (T) is noncommunicating hydrocephalus Susceptible population.
The present invention, by above-mentioned experiment, sets up Pedigree genetic analysis database, application goodness of fit Chi-square Test and
Transmission disequilibrium is checked, and application UNPHASED analyzes software and carries out monoploid transmission Chi-square Test, utilizes GraphPadprism to divide
Analysis data.
Transmission disequilibrium inspection display, SNP significantly associates (P with noncommunicating hydrocephalus<0.001). utilize PCR-RFLP
Technology, detects that rs2719 base is (T) (P related to noncommunicating hydrocephalus clinical symptoms total score<0.05).rs2719(T)
To positive symptom, cognitive function, the related (P of negative symptoms<0.05).
The calculating genotype frequency distribution of online genetic statistics SHEsis software is applied to meet Hardy-Weinberg balance fixed
Rule；Analyze the relevance in candidate gene SNPs site and noncommunicating hydrocephalus；Analyze chain injustice between each site of gene
Weighing apparatus degree and haplotype；Application MDR software analysis gene-intergenic reciprocation；Application GraphPadprism software analysis
Candidate gene SNPs site and noncommunicating hydrocephalus clinical symptoms.
The statistical analysis by large sample for the present invention, have studied the rs2719 pleomorphism site of GSTT2 gene order non-
The gene frequency of communicating hydrocephalus patient, and according to transmission situation in ill children for the genotype, carry out transmitting not
Balance check and haplotyping, it was found that the genotype distribution of whole sample and gene frequency all meet Hardy-
Weinburg balances, and corrects through Bonferroni, and transmission disequilibrium check analysis has significant statistics difference, passes through full-page proof
This experiment is proved.
298 case noncommunicating hydrocephalus patients are detected in this site altogether, the healthy normal control subjects of 301 cases；Rs2719 position
Point is two condition SNP；Through order-checking detection, colony occurs different genotype results.Use online genetic statistics SHEsis soft
Part analyzes genotype and the gene frequency of patient and normal healthy controls experimenter respectively, and the genotype frequency distribution of SNPs is all
Meet H-W balance, illustrate that the sampling colony of this research meets H-W balance.Detection rs2719 loci gene type and non-communicating brain
The correlation of ponding cognitive function of patients, result shows and positive symptom, negative symptoms, cognitive there were significant differences (P<0.05).
Illustrate that this site affects the clinical symptoms of patient.
Embodiment 2
Checking test：Use this kit, randomly select noncommunicating hydrocephalus clinical samples 20 case, control group sample 20
Example, through PCR order-checking detection GSTT2 gene rs2719 loci polymorphism.
1st, PCR amplification：
Expanding GSTT2 gene rs2719 Partial Fragment by PCR, PCR reaction system is：10 × PCR reaction buffer 3 μ
L, 10mM/LdNTP0.5 μ L, Taq DNA polymerase 0.5 μ L, 10pM/L primer 0.5 μ L, genomic DNA 1 μ L, add deionized water extremely
30μL.Add 20 μ L paraffin oils during PCR in each system, prevent from evaporating.
PCR reaction condition is 95 DEG C of denaturations 5min, 96 DEG C of denaturation 30s, 66 DEG C of annealing 30s, and 72 DEG C extend 25s, altogether
35 circulations, 72 DEG C of overall elongation 2min.
2nd, order-checking judges genotype
PCR primer detects through 8% polyacrylamide gel electrophoresis, send Hua Da gene to survey after gel imaging system observation is qualified
Prelude carries out sequence verification.
3rd, result
Result shows, clinical samples GSTT2 gene rs2719 site, and Genetic polymorphism type is 8 cases of TG, TT12 example；Strong
The all GG of health control group genotype.This method can effectively detect noncommunicating hydrocephalus.
Loci polymorphism：During GG, the neurological susceptibility of experimenter is minimum；Carrying T allele, the neurological susceptibility of experimenter raises.
The above, the only present invention preferably detailed description of the invention, but protection scope of the present invention is not limited thereto,
Any those familiar with the art in the technical scope that the invention discloses, the change that can readily occur in or replacement,
All should cover within protection scope of the present invention.Therefore, protection scope of the present invention should be with the protection model of claims
Enclose and be as the criterion.
Claims (2)
1. the primer detecting noncommunicating hydrocephalus tumor susceptibility gene, it is characterised in that：Described primer is amplification GSTT2 gene
Shown in the nucleotide sequence of rs2719, respectively sequence table SEQ ID No.1 and sequence table SEQ ID No.2.
2. the kit detecting noncommunicating hydrocephalus tumor susceptibility gene, it is characterised in that include following reagent：
1) primer：For SEQ ID No.1, the nucleotide sequence shown in SEQ ID No.2,
2) PCR amplification buffer, Taq archaeal dna polymerase,
3) dNTP mixed liquor.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610767870.0A CN106434892A (en) | 2016-08-30 | 2016-08-30 | Primer and kit for detecting non-communicating hydrocephalus susceptibility |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610767870.0A CN106434892A (en) | 2016-08-30 | 2016-08-30 | Primer and kit for detecting non-communicating hydrocephalus susceptibility |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106434892A true CN106434892A (en) | 2017-02-22 |
Family
ID=58091053
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610767870.0A Pending CN106434892A (en) | 2016-08-30 | 2016-08-30 | Primer and kit for detecting non-communicating hydrocephalus susceptibility |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106434892A (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004028339A2 (en) * | 2002-09-27 | 2004-04-08 | Brigham And Women's Hospital, Inc. | Treatment of patients with multiple sclerosis based on gene expression changes in central nervous system tissues |
-
2016
- 2016-08-30 CN CN201610767870.0A patent/CN106434892A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004028339A2 (en) * | 2002-09-27 | 2004-04-08 | Brigham And Women's Hospital, Inc. | Treatment of patients with multiple sclerosis based on gene expression changes in central nervous system tissues |
Non-Patent Citations (3)
| Title |
|---|
| BART J. DUCRO等: "A nonsensemutation in B3GALNT2 is concordant with hydrocephalus in Friesian horses", 《BMC GENOMICS》 * |
| MATTHEW S PERZANOWSKI等: "Prenatal acetaminophen exposure and risk of wheeze at age 5 years in an urban low-income cohort", 《THORAX》 * |
| SPRENGER,R.等: "Homo sapiens glutathione S-transferase theta 2 (GSTT2) and glutathione S-transferase theta 1，(GSTT1) genes, complete cds，GenBank: AF240786.1，118999bp DNA linear", 《NCBI GENBANK》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105861716B (en) | circRNA marker, kit and gene chip for depression diagnosis | |
| Lagier-Tourenne et al. | Homozygosity mapping of Marinesco–Sjögren syndrome to 5q31 | |
| CN104673891B (en) | A kind of detection method and kit of spinal muscular atrophy associated gene mutation | |
| CN107099609A (en) | A kind of droplet type digital pcr detects the genetic analysis method of low ratio trace target gene | |
| CN110699446B (en) | SNP marker rs3174298 related to non-syndrome cleft lip and palate diagnosis and application thereof | |
| CN105506164A (en) | Kit for detecting susceptibility of hebephrenic schizophrenia | |
| She et al. | Genetic testing in fetuses with isolated agenesis of the corpus callosum | |
| CN114891876A (en) | Functional genome area biomarker combination for diagnosing high myopia | |
| CN105543390A (en) | Primer and kit for detecting susceptibility of paranoia schizophrenia | |
| CN113444838A (en) | Molecular marker for detecting COVID-19 susceptibility, kit and application | |
| CN109182490B (en) | LRSAM1 gene SNP mutation site typing primer and application thereof in coronary heart disease prediction | |
| CN108300788A (en) | A kind of micro RNA combination and its application for detecting light-duty brain trauma | |
| CN106434892A (en) | Primer and kit for detecting non-communicating hydrocephalus susceptibility | |
| CN107686861A (en) | ERBB2 R113Q mutators are used to prepare the application for judging mammary gland genetic susceptibility of cancer kit | |
| CN104774841B (en) | Genetic epilepsy is with febrile seizure plus SCN1A gene new mutations | |
| CN106381330A (en) | Primer and kit for detecting susceptibility of communicating hydrocephalus | |
| CN106811545A (en) | The method and reagent of a kind of neurological susceptibility for predicting hypertriglyceridemia | |
| CN106434880A (en) | Primer for detecting simple type schizophrenia susceptibility and kit | |
| CN106191299A (en) | For detecting primer, test kit and the method for SCN1A gene 5 ' end non-coding mutation | |
| CN106434881A (en) | Primer and kit for detecting catatonic schizophrenia susceptibility | |
| CN106868128B (en) | Biomarker for auxiliary diagnosis of breast cancer and application thereof | |
| CN106434678A (en) | Hebephrenic type schizophrenia associated gene | |
| CN104293958B (en) | A kind of test kit predicting susceptibility of ankylosing spondylitis and method | |
| WO2018212371A1 (en) | Apoe promoter single nucleotide polymorphism associated with alzheimer's disease risk and use thereof | |
| CN113493863B (en) | Molecular marker for detecting COVID-19 susceptibility, kit and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20170222 |