CN106434678A - Hebephrenic type schizophrenia associated gene - Google Patents
Hebephrenic type schizophrenia associated gene Download PDFInfo
- Publication number
- CN106434678A CN106434678A CN201610766045.9A CN201610766045A CN106434678A CN 106434678 A CN106434678 A CN 106434678A CN 201610766045 A CN201610766045 A CN 201610766045A CN 106434678 A CN106434678 A CN 106434678A
- Authority
- CN
- China
- Prior art keywords
- gene
- dna
- disease
- hebephrenia
- schizophrenia
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/70571—Receptors; Cell surface antigens; Cell surface determinants for neuromediators, e.g. serotonin receptor, dopamine receptor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/172—Haplotypes
Abstract
The invention provides an associated gene closely associated with hebephrenic type schizophrenia, namely a DRD2 gene located at 11q23; because a mononucleotide polymorphism rs1800497 base C of the gene is mutated to T, the gene is associated with susceptibility of the hebephrenic type schizophrenia, individuals with the rs1800497 base of T are a hebephrenic type schizophrenia susceptible group, and individuals with the rs1800497 base of C are a group less susceptible to the hebephrenic type schizophrenia; the DRD2 gene and an encoded protein thereof have important guiding significance on elucidating a hebephrenic type schizophrenia genetic mechanism, establishing a gene diagnosis method, and guiding hebephrenic type schizophrenia diagnosis and prevention and development of novel treatment drugs.
Description
Technical field
The present invention relates to one has, with schizophrenia, the tumor susceptibility gene significantly associating, and is specifically related to one and hebephrenictype
The tumor susceptibility gene that schizophrenia significantly associates.
Background technology
Schizophrenia (schizophrenia) is a kind of chronic, seriousness, crippling encephalopathic, and serious harm human body is good for
Health.It is a kind of mental illness the most serious in mental disorder, within 2009, investigate display, the schizophrenia of China according to lancet
Disease patient numbers nearly 10,000,000.Schizophrenia needs life-long therapy, and treatment cost is high, according to statistics, and U.S.'s spirit in 2002
The treatment totle drilling cost of Split disease reaches 62,700,000,000 dollars, wherein direct cost 22,700,000,000 dollars, early dies young because of suicide and family members are because looking after
Patient and the loss etc. that causes is 32,400,000,000 dollars, and schizophrenia has high crippling, most of schizophreniac's meetings
Lifelong some symptom of residual, needs life-long therapy, due to schizoid seriousness and chronicity, to patient, family and society
Can affect very big, consume a large amount of public resource, therefore schizophrenia brings serious burden to society and family.
The incidence of disease in the male sex, women for the schizophrenia is almost identical, but the male sex occurs relatively early, to occur in evening in puberty
Phase and grow up in early days, about 15-25 year onset, and this stage constructs the critical period of life road just, and women is mainly at 20-
35 years old onsets.Patient has illusion, vain hope, autogenic movement the positive symptom such as to increase, and has flattening of affect, speech impairments, Social Withdrawal
Deng negative symptoms, there is Cognitive simultaneously, depressed, the symptoms such as cognitive impairment such as social work's functional lesion.
According to the different clinical manifestation of schizophrenia, morbidity form, clinical characters, the course of disease, therapeutic scheme, therapeutic response and
The factors such as prognosis, can be divided into simple form, intolerance style, hebephrenictype, catatonic type, undifferentiated type and Residual-type schizophrenia.
Hebephrenia is in schizophreniac, and ratio accounts for about 20%；Regular incidence is puberty, anxious
Suddenly, disease is very fast, and symptom is notable, and content is absurd.Its clinical manifestation with impulse of excitation, abnormal eccentric and parabulia is
Main, the abundant mutability of mental symptom, emotion is capricious.With the hebephrenictype based on positive symptom, early treatment effect is preferable.
Since oneth century, people are to schizoid physiology, biochemistry, image, drug therapy and family of society, ring
The aspects such as border are observed, and are made that various hypothesis and judgement to the pathogenesis of mental illness, and with scientific and technological progress, people are increasingly
Recognizing the major reason that gene defect is that many severe psychiatric diseases produce, when people run into environmental pressure, those carry
The people of diseases predisposing gene more likely suffers from mental hygiene illness than the people not carrying tumor susceptibility gene, through investigation, schizophrenia
Disease is the very much higher genopathy of heredity grade, mainly presents Familial aggregation, and once a family member is ill, other of this family
The tumor susceptibility gene that member carries is significantly larger than normal person, needs effectively to prevent and treatment, in science and technology growing the present
How it treats schizophrenia, how from the disease susceptibility of heredity angle detection tumor susceptibility gene and individuality, thus carries out
Further risk profile and diagnosis, drug development, become numerous scientific and technical personnel and Tough questions that health care personnel face, to the greatest extent
Managing the research of domestic and international tumor susceptibility gene to carry out for many years, but making slow progress, only minority is with regard to the report identifying inheritance susceptible gene,
But it is not specific to certain type of schizoid inspection research, in the world schizophrenia is divided into five types,
The tumor susceptibility gene that each type relates to is all different, it is impossible to general all reflects this five type with one or several genes
Fixed, so inevitable selectivity difference.Even if being diagnosed to be schizophrenia, but not knowing is which type of schizophrenia
Disease, lacks directive significance to follow-up treatment.
Utilize genetic marker to detect gene of curing the disease, be the technology developing in recent years.Genetic marker, i.e. in dyeing
There is one section of specific DNA sequence fragment on body, and have polymorphism, in generations' transmission, it then follows rule is for separating, independently distributing
With chain rule, inhereditary material transmission information therefore can be obtained.Genetic marker can be zones of different gene element, by even
Lock and association analysis can obtain Disease-causing gene designation of chromosome region, can clone this ospc gene further.For various
Various disease, finds Disease-causing gene and analyzes one of key being to study.
Third generation genetic marker SNP (single nucleotide polymorphism) refers to certain particular core in genome
Can there are two or more different bases, minimum gene frequency >=1% in colony on the position of thuja acid.The mankind
Genome in most SNP site only exist 2 kinds of allele, so usual SNP can refer on location, a certain nucleotides
Diallelic change occurs.SNP is the extremely important method that the Human Genome Project moves towards application.It is primarily due to SNP to carry
It for a very strong instrument, is used for discovery, the qualification of diseases predisposing gene, drug design and the underlying biological of people at highest risk
Learn research etc..Because the mankind exist SNP site in a large number, provide the relation between more opportunity discovery gene and disease.Pass through
The sudden change of SNP discovery disease related gene is easier than researchs such as familys.Some SNP is not Disease-causing gene, but it may be with
Some adjacent Disease-causing gene is chain, is vital signs too.
Nearest genome-wide screening result prompting, No. 11 chromosomes are associated with hebephrenia neurological susceptibility, but
So far do not find to determine the special tumor susceptibility gene related to hebephrenia in this chromosomal region.The present invention
Once disclose the associated gene of hebephrenia, be further investigation and the preventing and treating of hebephrenia, diagnose, control
Treat and provide new thinking.
Content of the invention
It is an object of the invention to disclose the associated gene of hebephrenia in No. 11 chromosomal regions, thus logical
Cross this tumor susceptibility gene hereditary capacity and propose a kind of method judging hebephrenia Susceptible population, thus meet this area
For the correct demand identifying hebephrenia tumor susceptibility gene, be beneficial to instruct hebephrenia diagnosis,
Prevention, treatment.
Inventor is shown by result of study, and No. 11 chromosome DRD2 genes are positioned at 11q23, Gene ID:1813, sequence
A length of 65.6kb, full name is d2 dopamine receptor gene, is the tumor susceptibility gene of hebephrenia, by DRD2 base
The SNP site of cause：Rs1800497, is analyzed, and result shows, rs1800497 and hebephrenia height correlation,
Rs1800497 base is the Susceptible population that the individuality of T is hebephrenia.
DRD2 gene code dopamine release hypotype, belongs to the acceptor of G-protein coupling, it is suppressed that adenyl cyclase is lived
Property so that cAMP level reduces, and due to the imbalance of DRD2 gene regulation, causes D2 expression of receptor abnormal so that in brain certain
The Dopamine in a little regions is disorderly, causes the generation of spirit hebephrenia.
DRD2 gene is expressed the highest in brain in lenticular nucleus, caudate nucleus, olfactory bulb and nucleus accumbens septi, rs1800497 base is T
Individuality occur classical symptom (illusion, vain hope, the disturbance of thought and spirituality aphasia) possibility raise, be hebephrenictype spirit point
Split the Susceptible population of disease.
It is an object of the invention to be achieved through the following technical solutions：
1st, a hebephrenia associated gene, is in 11q23 SNP rs1800497 base
C sports the DRD2 gene of T.
Specifically, the present invention realizes by following technical scheme：
The nucleotide sequence of a kind of DRD2 tumor susceptibility gene rs1800497 detecting hebephrenia, is sequence table
Nucleotide sequence shown in SEQ ID No.3.This nucleotide sequence is positioned at GNB1L gene, its variant sites, represents with letter " R ",
When the genotype of described mononucleotide polymorphism site rs1800497 is C, the neurological susceptibility of experimenter is minimum, takes
When band T allele, the neurological susceptibility of experimenter raises.
Its research process comprises the steps：
1st, by consulting literatures, computer internet and bioinformatics is utilized to obtain each side schizophrenia candidate's base
Because of research, carry out Single nuclear polymorphism (SNP) linkage disequilibrium at No. 11 chromosomes by linkage disequilibrium value method
Analyze, pass through NCBI
(http://www.ncbi.nlm.nih.gov/mapviewer) database, it is thus achieved that DRD2 gene, and pass through
http://www.ncbi.nlm.nih.gov/SNP, http://snp.cshl.org/ database, searches out and meets its condition
Candidate gene SNPs.
2nd, then this research with 320 case hebephrenias and 380 case normal healthy controls as research object.All researchs
Object is Chinese han population, and the diagnostic criteria of schizophreniac ICD-10 and CCMD-II-R to be met.
3rd, in the case of obtaining experimenter's informed consent, gather peripheric venous blood, use Promega (USA) liquid pure
Change and extract DNA kit, extract genomic DNA.By survey OD260, OD280 value, then by formula calculate DNA purity and
Content.DNA purity=OD260/OD280.
4th, according to corresponding base sequence synthetic primer, primer is designed：
ACGTTGGATGTGTGCAGCTCACTCCATCCT(SEQ ID No.1)
ACGTTGGATGCAACACAGCCATCCTCAAAG(SEQ ID No.2)
5th, PCR amplification purpose fragment
Applying above primer to enter performing PCR amplification, PCR reaction system is 20ul, wherein Tris-HCl containing 10mM (PH8.4),
50mM KCl, 1.5mM MgCl2,200uM dNTP, each 0.4uM of upstream and downstream primer, Taq polymerase 1U, DNA profiling 30-50ng,
PCR amplification condition is：1st, 94 DEG C of 5min, the 2nd, 96 DEG C of 45s, 60 DEG C of 60s, 72 DEG C of 60s 3 circulations, the 3rd, 95 DEG C of 45s, 59 DEG C of 65s,
72 DEG C of 60s 5 circulations, the 4th, 94 DEG C of 45s, 57 DEG C of 60s, 72 DEG C of 60s, 32 circulations, the 5th, 72 DEG C of 10min, take PCR primer 5ul and use
1.5% agarose gel electrophoresis, with DNAmarker as molecular weight standards, amplification.
6th, digestion with restriction enzyme identifies genotype
Endonuclease reaction system is 20ul, wherein 10ulPCR product, restriction enzyme TaqI 0.5ul, enzyme cutting buffering liquid
2ul, puts 37 DEG C of degree incubators 4 hours, through 3% agarose gel electrophoresis, judges genotype according to restriction enzyme mapping.
7th, result judges
The individuality that rs1800497 base is (T) is schizophrenia susceptibility crowd.
Further, in the above-mentioned methods, the method for the nucleotide sequence obtaining from testing sample also includes that fluorescence is fixed
Amount PCR, denaturing high-performance chromatography, RFLP or ligase detection, gene sequencing.
Due to gene pleiomorphism, restriction enzyme digestion sites is caused to change, disappear or produce new site, if using certain
Middle digestion with restriction enzyme genomic DNA, then produce and the DNA fragmentation of normal gene group different length after being digested, through with enzyme
Cut detection, can detect that these pillar locations and size.PCR machine is analyzed
(PCR-RFLP) Method And Principle is：When designing PCR amplification experiment, primer is positioned at the both sides at gene pleiomorphism position, by purpose
Gene magnification so that it is be easy to detection, owing to polymorphism causes existing restriction endonuclease sites to change, then can be first with accordingly
Restriction enzyme is digested amplified production, then enters row agarose gel electrophoresis and observe, according to product sheet degree size and number, and normally
Contrast is made in comparison.
The present invention, by above-mentioned experiment, sets up Pedigree genetic analysis database, application goodness of fit Chi-square Test and
Transmission disequilibrium is checked, and application UNPHASED analyzes software and carries out monoploid transmission Chi-square Test, utilizes GraphPadprism to divide
Analysis data.
Transmission disequilibrium inspection display, SNP significantly associates (P with hebephrenia<0.001). utilize PCR-
RFLP technology, detects that rs1800497 base is (T) (P related to hebephrenia clinical symptoms total score<0.05).
The rs1800497 (T) of DAD2 and hebephrenia positive symptom, cognitive function, the related (P of negative symptoms<0.05).
The calculating genotype frequency distribution of online genetic statistics SHEsis software is applied to meet Hardy-Weinberg balance fixed
Rule；Analyze candidate gene SNPs site and schizoid relevance；Analyze linkage disequilibrium journey between each site of gene
Degree and haplotype；Application MDR software analysis gene-intergenic reciprocation；Application GraphPadprism software analysis candidate
Gene SNP s site and schizophrenia clinical symptoms.
The statistical analysis by large sample for the present invention, the rs1800497 pleomorphism site that have studied DRD2 gene order exists
The gene frequency of hebephrenia patient, and according to transmission situation in ill children for the genotype, pass
Pass disequilibrium test and haplotyping, it was found that the genotype distribution of whole sample and gene frequency all meet
Hardy-Weinburg balances, and corrects through Bonferroni, and transmission disequilibrium check analysis has significant statistics difference, logical
Cross large sample experiment to be proved.
Judge the method for the Susceptible population of hebephrenia according to the present invention by DRD2 gene base mutation characteristic,
The examination of following method can be carried out to the crowd not showing clinical symptoms, rs1800497 base be C be not susceptible to hebephrenictype
Schizophrenia.Rs1800497 base is the easily generation hebephrenia of T.Susceptible for hebephrenia
Crowd's risk factor to be reduced as far as possible in daily life, such as the stimulation in environment；Simultaneously hebephrenia have send out
Sick anxious, the features such as process is fast, after therefore early diagnosing, to treat in time, have the family of this type of disease, must not hide one's sickness for fear for the treatment of,
Cause the state of an illness day by day to deteriorate, delay, cause the result being difficult to rehabilitation.It based on this disease is with drug therapy, is aided with psychotherapy.Right
This disease is prevented and treated early, is an important use of the present invention.
Compared with prior art, beneficial effects of the present invention is embodied in：
1st, hebephrenia associated gene is found in the invention, and schizophrenia is according to different clinical tables
The factors such as existing, morbidity form, clinical characters, the course of disease, therapeutic scheme, therapeutic response and prognosis, can be divided into simple form, bigoted
Type, hebephrenictype, catatonic type, undifferentiated type and Residual-type.Current research is only entered for schizoid tumor susceptibility gene general
Row detection, but the tumor susceptibility gene involved by different types of schizophrenia is different, if not to certain type of disease
Disease carries out specific detection, and inevitable poor specificity, Detection results is bad.
2nd, hebephrenia is in schizophreniac, and ratio accounts for about 20%；Regular incidence puberty,
Hurried, disease is very fast, and symptom is notable, and content is absurd, and the early stage detection to hebephrenia patient is particularly important,
Detection in early days, early treatment can effectively suppress course advancement, and result for the treatment of is good.
3rd, the kit of the present invention is simple to operate, belongs to the operation that those skilled in the art can easily realize, can easily realize.
Detailed description of the invention
Embodiment 1
1st, candidate gene and SNPs are selected
The present inventor's consulting literatures, computer internet and bioinformatics is utilized to obtain each side schizophrenia candidate
Gene studies, carries out the chain injustice of Single nuclear polymorphism (SNP) at No. 11 chromosomes by linkage disequilibrium value method
Weighing apparatus is analyzed, and passes through NCBI
(http://www.ncbi.nlm.nih.gov/mapviewer) database, it is thus achieved that DRD2 gene, and pass through
http://www.ncbi.nlm.nih.gov/SNP, http://snp.cshl.org/ database, searches out and meets its condition
Candidate gene SNPs.Its inclusion criteria：1st, existing pertinent literature is reported；
2nd, the minimum gene frequency in site should be greater than 10%；3rd, selected SNPs allows for meeting primer-design software
Require；4th, selected site can not affect Genotyping experiment
2nd, materials and methods
2.1 research object
The present invention with 320 case hebephrenias and 380 case normal healthy controls (healthy, without physical disease, houselessness
Race's genetic disease history, be a cup too low history of disease, without drug abuse) it is research object.All research objects are Chinese han population,
And sign the Informed Consent Form of Ethics Committee's approval voluntarily.
2.2 hebephrenias enter group and exclusion standard
2.2.1 enter group standard
(1) meeting hebephrenia diagnostic criteria, PANSS marks >=60 points；
(2) age 15-25 year, the course of disease be less than 24 months, do not took any antipsychotics；
(3) voluntary participation sign Informed Consent Form.
2.2.2 exclusion standard
(1) it is diagnosed as non-hebephrenia patient；
(2) clear and definite central nervous system disease, such as apoplexy, Parkinson and epilepsy etc.
(3) severe physical disease, such as infection, diabetes and hypertension etc.；
2.3 diagnostic criteria and Measuring scale assessing
2.3.1 diagnostic criteria
(1) international disease fragmentation criterion the 10th edition：Schizophrenia diagnostic criteria (ICD-10)；
(2)《The sick classification of Chinese Spirit and diagnostic criteria》(second edition) revised edition schizophrenia standard
(CCMD-2-R)；
(3) all cases all meet above-mentioned two diagnostic criteria, just can enter group.
2.3.2 psychotic state Measuring scale assessing
2 psychiatrists through training are carried out PANSS scoring to patient simultaneously.
PANSS includes positive symptom subscale, negative symptoms subscale and general pathology subscale.Participate in measuring scale
2 doctors are all through PANSS scale uniformity training.
2.3.3 cognitive function
The complete neuropsychological Status Exam (RBANS) of repeatability be one simple and clear, by the test of one man operation, be currently
The Cognitive Assessment instrument commonly used in the world, including 12 subtests, can be summarized in 5 groups of neuropsychological states：Immediate memory
(immediate memory), attention (attention), vision range (visuospatial/constructional), language
And delay memory (delayed memory) (language).Operated by the examiner through training, complete entirely to detect typically
Requiring time for 20-30 minute, RBANS has been translated into Chinese edition by Zhang Baohua et al., and test schizophreniac and
Normal person organizes reliability and the validity of RBANS, and result shows that this scale is that the preferable and briefly easy evaluation of a reliability, validity is recognized
Know the scale of function.
3rd, blood and clinical data are collected
Experimenter is after the project Informed Consent Form conscientiously reading, understand and signing voluntarily Ethics Committee's approval, outside taking
In week venous blood 5ml ,-20 degree preserve to extraction genomic DNA.Collect schizophreniac's age, sex, family history, nationality
With schooling, be admitted to hospital and the data related with disease such as the time of making a definite diagnosis, clinical symptoms, cognitive function first；Normal person collects
General demographic data and cognitive function measuring scale.
3.1 extracting genome DNA
Use the special DNA kit that extracts, the DNA of full-length genome in the leucocyte of extraction peripheral blood.Operating procedure is as follows：
Blood thaws, mark 1.5mlEppendorf centrifuge tube → cell pyrolysis liquid 900uL add in centrifuge tube → add thaw after complete
After blood 200uL, mix, under normal temperature, act on 20min, and reverse 4-6 time → 10,000rpm centrifugation time 4min, remove supernatant, so
Rear vibration, makes sediment again suspend → 300uL karyorhexis liquid, then vibrates lightly so that it is mix, then 37 DEG C of water-baths
30min → RNA digestive enzyme 1.5 μ L, vibration mixes, and water-bath 15min, 37 DEG C → albumen precipitation liquid 100uL flick at the bottom of pipe, normal temperature
Effect 20min → 12,000rpm centrifuges 4min, transfers to have added in the centrifuge tube of isopropanol 300uL by supernatant, 20min
Overturning → 12 gently, 000rpm centrifuges 4min, abandons supernatant, adds 70% ethanol 300uL, shakes up → 12 gently, and 000rpm centrifuges
4min, abandons supernatant, by centrifuge tube oblique inverted, waits airing → DNA lysate 100uL to mix, water-bath 1h, 65 DEG C (or 4 DEG C of mistakes
Night), DNA has prepared in centrifuge tube and has finished.
3.2 genomic DNA quality testings
Take 1-2 μ L genomic DNA stoste, whether meet PCR-by the extracted DNA sample of agarose electrophoresis method detection
The quality criteria requirements of ALFP and Sequenom；This DNA sample of light tone font representation meets genotyping technique and requires；Red word
Body (no specimen or sample size are few) represents that this DNA does not meets genotyping technique and requires, needs again to extract.
3.3 Genome DNA contents and the detection of purity
With NanoDrop-1000 all-wave every part of sample DNA content of long ultraviolet/visible light scanning spectrophotometer Accurate Determining
With OD ratio (A260/A230, A260/A280).A260/A230 ratio is low：The salt of small molecular weight impurity or remaining pollutes, if too high
There is the impurity of the unknown.Ratio (A260/A280) is low：Caused by albumen or phenol have residual；Ratio (A260/A280) ratio is high：
Caused by RNA has residual；Usual A260/A280 ≈ 1.8 representative sample DNA is pure
3.4 design primers
The primer of amplification DRD2 gene rs1800497 polymorphism is respectively：
ACGTTGGATGTGTGCAGCTCACTCCATCCT
ACGTTGGATGCAACACAGCCATCCTCAAAG
3.5PCR expands purpose fragment
Applying above primer to enter performing PCR amplification, PCR reaction system is 20ul, wherein Tris-HCl containing 10mM (PH8.4),
50mM KCl, 1.5mM MgCl2,200uM dNTP, each 0.4uM of upstream and downstream primer, Taq polymerase 1U, DNA profiling 30-50ng,
PCR amplification condition is：1st, 94 DEG C of 5min, the 2nd, 96 DEG C of 45s, 60 DEG C of 60s, 72 DEG C of 60s 3 circulations, the 3rd, 95 DEG C of 45s, 59 DEG C of 65s,
72 DEG C of 60s 5 circulations, the 4th, 94 DEG C of 45s, 57 DEG C of 60s, 72 DEG C of 60s, 32 circulations, the 5th, 72 DEG C of 10min, take PCR primer 5ul and use
1.5% agarose gel electrophoresis, with DNAmarker as molecular weight standards, amplification.
3.6 digestion with restriction enzyme identify genotype
Endonuclease reaction system is 20ul, wherein 10ulPCR product, restriction enzyme TaqI 0.5ul, enzyme cutting buffering liquid
2ul, puts 37 DEG C of degree incubators 4 hours, through 3% agarose gel electrophoresis, judges genotype according to restriction enzyme mapping.
It is digested and take over：Rs1800497 (C) can be cut by restriction enzyme TaqI, and rs1800497 (T) can not be cut open.
4th, result judges
The individuality that rs1800497 base is (T) is schizophrenia susceptibility crowd.
320 case hebephrenia patients are detected in this site altogether, the healthy normal control subjects of 380 cases；
Rs1800497 site is two condition SNP；Through being digested detection, colony occurs different genotype results.Use online heredity system
Genotype and gene frequency, the genotype of SNPs of patient and normal healthy controls experimenter analyzed respectively by meter SHEsis software
Frequency distribution all meets H-W balance, illustrates that the sampling colony of this research meets H-W balance.Detection rs1800497 loci gene type
With the correlation of hebephrenia cognitive function of patients, result shows to be had significantly with positive symptom, negative symptoms, cognition
Difference (P<0.05).Illustrate that this site is tumor susceptibility gene.
Embodiment 2
1st, research object
The present invention with the 50 case hebephrenias made a definite diagnosis and 50 case normal healthy controls (healthy, without physical disease,
The history of genetic disease without family, be a cup too low history of disease, without drug abuse) it is research object.All research objects are Chinese Han
Clansman, and sign the Informed Consent Form of Ethics Committee's approval voluntarily.
2nd, blood and clinical data are collected
Experimenter is after the project Informed Consent Form conscientiously reading, understand and signing voluntarily Ethics Committee's approval, outside taking
In week venous blood 5ml ,-20 degree preserve to extraction genomic DNA.Collect schizophreniac's age, sex, family history, nationality
With schooling, be admitted to hospital and the data related with disease such as the time of making a definite diagnosis, clinical symptoms, cognitive function first；Normal person collects
General demographic data and cognitive function measuring scale.
3rd, extracting genome DNA
Use the special DNA kit that extracts, the DNA of full-length genome in the leucocyte of extraction peripheral blood.Operating procedure is as follows：
Blood thaws, mark 1.5mlEppendorf centrifuge tube → cell pyrolysis liquid 900uL add in centrifuge tube → add thaw after complete
After blood 200uL, mix, under normal temperature, act on 20min, and reverse 4-6 time → 10,000rpm centrifugation time 4min, remove supernatant, so
Rear vibration, makes sediment again suspend → 300uL karyorhexis liquid, then vibrates lightly so that it is mix, then 37 DEG C of water-baths
30min → RNA digestive enzyme 1.5 μ L, vibration mixes, and water-bath 15min, 37 DEG C → albumen precipitation liquid 100uL flick at the bottom of pipe, normal temperature
Effect 20min → 12,000rpm centrifuges 4min, transfers to have added in the centrifuge tube of isopropanol 300uL by supernatant, 20min
Overturning → 12 gently, 000rpm centrifuges 4min, abandons supernatant, adds 70% ethanol 300uL, shakes up → 12 gently, and 000rpm centrifuges
4min, abandons supernatant, by centrifuge tube oblique inverted, waits airing → DNA lysate 100uL to mix, water-bath 1h, 65 DEG C (or 4 DEG C of mistakes
Night), DNA has prepared in centrifuge tube and has finished.
4th, genomic DNA quality testing
Take 1-2 μ L genomic DNA stoste, whether meet PCR-by the extracted DNA sample of agarose electrophoresis method detection
The quality criteria requirements of ALFP and Sequenom；This DNA sample of light tone font representation meets genotyping technique and requires；Red word
Body (no specimen or sample size are few) represents that this DNA does not meets genotyping technique and requires, needs again to extract.
5th, the detection of Genome DNA content and purity
With NanoDrop-1000 all-wave every part of sample DNA content of long ultraviolet/visible light scanning spectrophotometer Accurate Determining
With OD ratio (A260/A230, A260/A280).A260/A230 ratio is low：The salt of small molecular weight impurity or remaining pollutes, if too high
There is the impurity of the unknown.Ratio (A260/A280) is low：Caused by albumen or phenol have residual；Ratio (A260/A280) ratio is high：
Caused by RNA has residual；Usual A260/A280 ≈ 1.8 representative sample DNA is pure
6th, primer is designed
The primer of amplification DRD2 gene rs1800497 polymorphism is respectively：
ACGTTGGATGTGTGCAGCTCACTCCATCCT
ACGTTGGATGCAACACAGCCATCCTCAAAG
7th, PCR amplification purpose fragment
Applying above primer to enter performing PCR amplification, PCR reaction system is 20ul, wherein Tris-HCl containing 10mM (PH8.4),
50mM KCl, 1.5mM MgCl2,200uM dNTP, each 0.4uM of upstream and downstream primer, Taq polymerase 1U, DNA profiling 30-50ng,
PCR amplification condition is：1st, 94 DEG C of 5min, the 2nd, 96 DEG C of 45s, 60 DEG C of 60s, 72 DEG C of 60s 3 circulations, the 3rd, 95 DEG C of 45s, 59 DEG C of 65s,
72 DEG C of 60s 5 circulations, the 4th, 94 DEG C of 45s, 57 DEG C of 60s, 72 DEG C of 60s, 32 circulations, the 5th, 72 DEG C of 10min, take PCR primer 5ul and use
1.5% agarose gel electrophoresis, with DNAmarker as molecular weight standards, amplification.
8th, digestion with restriction enzyme identifies genotype
Endonuclease reaction system is 20ul, wherein 10ulPCR product, restriction enzyme TaqI 0.5ul, enzyme cutting buffering liquid
2ul, puts 37 DEG C of degree incubators 4 hours, through 3% agarose gel electrophoresis, judges genotype according to restriction enzyme mapping.
It is digested result：Rs1800497 (C) can be cut by restriction enzyme TaqI, and rs1800497 (T) can not be cut open.
9th, result judges
The individuality that rs1800497 base is (T) is hebephrenia Susceptible population.Rs1800497 base is (C)
Individuality be non-hebephrenia Susceptible population
Ill group and control group accuracy rate respectively reach the 94%th, 96%
Embodiment 3
1st, research object
The present invention with the 40 case hebephrenias made a definite diagnosis and 40 case normal healthy controls (healthy, without physical disease,
The history of genetic disease without family, be a cup too low history of disease, without drug abuse) it is research object.All research objects are Chinese Han
Clansman, and sign the Informed Consent Form of Ethics Committee's approval voluntarily.
2nd, blood and clinical data are collected
Experimenter is after the project Informed Consent Form conscientiously reading, understand and signing voluntarily Ethics Committee's approval, outside taking
In week venous blood 5ml ,-20 degree preserve to extraction genomic DNA.Collect schizophreniac's age, sex, family history, nationality
With schooling, be admitted to hospital and the data related with disease such as the time of making a definite diagnosis, clinical symptoms, cognitive function first；Normal person collects
General demographic data and cognitive function measuring scale.
3rd, extracting genome DNA
Use the special DNA kit that extracts, the DNA of full-length genome in the leucocyte of extraction peripheral blood.Operating procedure is as follows：
Blood thaws, mark 1.5mlEppendorf centrifuge tube → cell pyrolysis liquid 900uL add in centrifuge tube → add thaw after complete
After blood 200uL, mix, under normal temperature, act on 20min, and reverse 4-6 time → 10,000rpm centrifugation time 4min, remove supernatant, so
Rear vibration, makes sediment again suspend → 300uL karyorhexis liquid, then vibrates lightly so that it is mix, then 37 DEG C of water-baths
30min → RNA digestive enzyme 1.5 μ L, vibration mixes, and water-bath 15min, 37 DEG C → albumen precipitation liquid 100uL flick at the bottom of pipe, normal temperature
Effect 20min → 12,000rpm centrifuges 4min, transfers to have added in the centrifuge tube of isopropanol 300uL by supernatant, 20min
Overturning → 12 gently, 000rpm centrifuges 4min, abandons supernatant, adds 70% ethanol 300uL, shakes up → 12 gently, and 000rpm centrifuges
4min, abandons supernatant, by centrifuge tube oblique inverted, waits airing → DNA lysate 100uL to mix, water-bath 1h, 65 DEG C (or 4 DEG C of mistakes
Night), DNA has prepared in centrifuge tube and has finished.
4th, genomic DNA quality testing
Take 1-2uL genomic DNA stoste, whether meet PCR-by the extracted DNA sample of agarose electrophoresis method detection
The quality criteria requirements of ALFP and Sequenom；This DNA sample of light tone font representation meets genotyping technique and requires；Red word
Body (no specimen or sample size are few) represents that this DNA does not meets genotyping technique and requires, needs again to extract.
5th, the detection of Genome DNA content and purity
With NanoDrop-1000 all-wave every part of sample DNA content of long ultraviolet/visible light scanning spectrophotometer Accurate Determining
With OD ratio (A260/A230, A260/A280).A260/A230 ratio is low：The salt of small molecular weight impurity or remaining pollutes, if too high
There is the impurity of the unknown.Ratio (A260/A280) is low：Caused by albumen or phenol have residual；Ratio (A260/A280) ratio is high：
Caused by RNA has residual；Usual A260/A280 ≈ 1.8 representative sample DNA is pure
6th, primer is designed
The primer of amplification DRD2 gene rs1800497 polymorphism is respectively SEQ ID No.1, SEQ ID No.2：
ACGTTGGATGTGTGCAGCTCACTCCATCCT
ACGTTGGATGCAACACAGCCATCCTCAAAG
7th, PCR amplification purpose fragment
Applying above primer to enter performing PCR amplification, PCR reaction system is 20ul, wherein Tris-HCl containing 10mM (PH8.4),
50mM KCl, 1.5mM MgCl2,200uM dNTP, each 0.4uM of upstream and downstream primer, Taq polymerase 1U, DNA profiling 30-50ng,
PCR amplification condition is：1st, 94 DEG C of 5min, the 2nd, 96 DEG C of 45s, 60 DEG C of 60s, 72 DEG C of 60s 3 circulations, the 3rd, 95 DEG C of 45s, 59 DEG C of 65s,
72 DEG C of 60s 5 circulations, the 4th, 94 DEG C of 45s, 57 DEG C of 60s, 72 DEG C of 60s, 32 circulations, the 5th, 72 DEG C of 10min, take PCR primer 5ul and use
1.5% agarose gel electrophoresis, with DNAmarker as molecular weight standards, amplification.
8th, order-checking judges genotype
PCR primer detects through 8% polyacrylamide gel electrophoresis, send Hua Da gene to survey after gel imaging system observation is qualified
Prelude carries out sequence verification.
9th, result judges
The individuality that rs1800497 base is (T) is hebephrenia Susceptible population.Rs1800497 base is (C)
Individuality be non-hebephrenia Susceptible population.
Ill group and control group accuracy rate respectively reach the 96%th, 98%.
The above, the only present invention preferably detailed description of the invention, but protection scope of the present invention is not limited thereto,
Any those familiar with the art in the technical scope that the invention discloses, the change that can readily occur in or replacement,
All should cover within protection scope of the present invention.Therefore, protection scope of the present invention should be with the protection model of claims
Enclose and be as the criterion.
Claims (1)
1. a hebephrenia associated gene, is in 11q23, and SNP rs1800497 base C is dashed forward
Become the DRD2 gene of T.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610766045.9A CN106434678A (en) | 2016-08-30 | 2016-08-30 | Hebephrenic type schizophrenia associated gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610766045.9A CN106434678A (en) | 2016-08-30 | 2016-08-30 | Hebephrenic type schizophrenia associated gene |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106434678A true CN106434678A (en) | 2017-02-22 |
Family
ID=58091684
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610766045.9A Pending CN106434678A (en) | 2016-08-30 | 2016-08-30 | Hebephrenic type schizophrenia associated gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106434678A (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005007871A2 (en) * | 2003-07-08 | 2005-01-27 | The Regents Of The University Of California | Genetic marker of response to atypical antipsychotics and antidepressants and methods for use thereof |
| WO2010132866A1 (en) * | 2009-05-15 | 2010-11-18 | Vanda Pharmaceuticals Inc. | Antipsychotic treatment based on drd2 or ankk1 snp genotype |
| RU2012118224A (en) * | 2012-05-04 | 2013-11-10 | Федеральное государственное бюджетное учреждение науки Институт молекулярной биологии им. В.А. Энгельгардта Российской академии наук | METHOD FOR ANALYSIS OF GENETIC POLYMORPHISM FOR DETERMINING POSITION FOR SCHIZOPHRENIA AND ALCOHOLISM, SET OF PRIMERS AND OLIGONUCLEOTIDE BIOCHIP FOR ITS IMPLEMENTATION |
| CN105506164A (en) * | 2016-02-04 | 2016-04-20 | 青岛市肿瘤医院 | Kit for detecting susceptibility of hebephrenic schizophrenia |
-
2016
- 2016-08-30 CN CN201610766045.9A patent/CN106434678A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005007871A2 (en) * | 2003-07-08 | 2005-01-27 | The Regents Of The University Of California | Genetic marker of response to atypical antipsychotics and antidepressants and methods for use thereof |
| WO2010132866A1 (en) * | 2009-05-15 | 2010-11-18 | Vanda Pharmaceuticals Inc. | Antipsychotic treatment based on drd2 or ankk1 snp genotype |
| RU2012118224A (en) * | 2012-05-04 | 2013-11-10 | Федеральное государственное бюджетное учреждение науки Институт молекулярной биологии им. В.А. Энгельгардта Российской академии наук | METHOD FOR ANALYSIS OF GENETIC POLYMORPHISM FOR DETERMINING POSITION FOR SCHIZOPHRENIA AND ALCOHOLISM, SET OF PRIMERS AND OLIGONUCLEOTIDE BIOCHIP FOR ITS IMPLEMENTATION |
| CN105506164A (en) * | 2016-02-04 | 2016-04-20 | 青岛市肿瘤医院 | Kit for detecting susceptibility of hebephrenic schizophrenia |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Davis et al. | The correlation between reading and mathematics ability at age twelve has a substantial genetic component | |
| Xu et al. | Association of specific haplotypes of D2 dopamine receptorgene with vulnerability to heroin dependence in 2 distinct populations | |
| Sheng-Yuan et al. | Molecular characterization of SMN copy number derived from carrier screening and from core families with SMA in a Chinese population | |
| CN105861716B (en) | circRNA marker, kit and gene chip for depression diagnosis | |
| Roos et al. | Genome-wide association study identifies a locus associated with rotator cuff injury | |
| Krzyzewska et al. | Genetic variant in CACNA1C is associated with PTSD in traumatized police officers | |
| Shah et al. | A genome-wide association study of corneal astigmatism: The CREAM Consortium | |
| D’Aguillo et al. | Genetic screening as an adjunct to universal newborn hearing screening: literature review and implications for non-congenital pre-lingual hearing loss | |
| Wang et al. | Mitochondrial tRNAThr G15927A mutation may modulate the phenotypic manifestation of ototoxic 12S rRNA A1555G mutation in four Chinese families | |
| CN105506164A (en) | Kit for detecting susceptibility of hebephrenic schizophrenia | |
| CN110699446B (en) | SNP marker rs3174298 related to non-syndrome cleft lip and palate diagnosis and application thereof | |
| Ma et al. | Multiple gene polymorphisms associated with exfoliation syndrome in the Uygur population | |
| WO2009150221A1 (en) | A method for autism prediction | |
| Lin et al. | The distinct manifestation of young-onset amyotrophic lateral sclerosis in China | |
| WO2009150218A1 (en) | A combination of risk alleles associated with autism | |
| CN105543390A (en) | Primer and kit for detecting susceptibility of paranoia schizophrenia | |
| Wang et al. | Clinical findings and a DNA methylation signature in kindreds with alterations in ZNF711 | |
| CN113444838A (en) | Molecular marker for detecting COVID-19 susceptibility, kit and application | |
| Na et al. | Whole-genome analysis in Korean patients with autoimmune myasthenia gravis | |
| Kanemaki et al. | Study of association of PAX6 polymorphisms with susceptibility to high myopia in a Japanese population | |
| Rao et al. | A case-control study of the association between polymorphisms in the fibrinogen alpha chain gene and schizophrenia | |
| Yellore et al. | Replication and refinement of linkage of posterior polymorphous corneal dystrophy to the posterior polymorphous corneal dystrophy 1 locus on chromosome 20 | |
| CN106434678A (en) | Hebephrenic type schizophrenia associated gene | |
| Zhao et al. | An autosomal dominant cataract locus mapped to 19q13-qter in a Chinese family | |
| CN106520985A (en) | Application of single nucleotide polymorphism rs2178077 to screening of pemphigus foliaceus patients |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20170222 |
|
| WD01 | Invention patent application deemed withdrawn after publication |