CN105543390A - Primer and kit for detecting susceptibility of paranoia schizophrenia - Google Patents
Primer and kit for detecting susceptibility of paranoia schizophrenia Download PDFInfo
- Publication number
- CN105543390A CN105543390A CN201610078972.1A CN201610078972A CN105543390A CN 105543390 A CN105543390 A CN 105543390A CN 201610078972 A CN201610078972 A CN 201610078972A CN 105543390 A CN105543390 A CN 105543390A
- Authority
- CN
- China
- Prior art keywords
- gene
- schizophrenia
- primer
- susceptibility
- paranoia
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/112—Disease subtyping, staging or classification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention discloses a primer and a kit for detecting the susceptibility of paranoia schizophrenia. A method for detecting susceptibility genes of the paranoia schizophrenia relates to the detection the nucleotide sequence of a susceptibility gene GNB1L and particularly relates to an application of the primer and kit by virtue of detection of a polymorphic site rs748806 of the gene sequence of the susceptibility gene GNB1L in early evaluation of the paranoia schizophrenia. By virtue of the primer and the kit, the susceptibility gene of the paranoia schizophrenia can be accurately detected, and a new thought is provided for the deep research, the auxiliary diagnosis, the prevention, the treatment and the new drug research and development of the paranoia schizophrenia.
Description
Technical field
The present invention relates to schizophrenia susceptibility field of gene detection, be specifically related to a kind of primer and the test kit that detect paranoid schizophrenia susceptibility.
Background technology
Schizophrenia (schizophrenia) is a kind of chronic, seriousness, crippling encephalopathic, serious harm HUMAN HEALTH.Be a kind of mental disorder the most serious in mental disorder, within 2009, show according to lancet investigation, schizophreniac's number nearly 10,000,000 of China.Schizophrenia needs life-long therapy, treatment cost is high, according to statistics, the U.S.'s schizoid treatment total cost in 2002 reaches 62,700,000,000 dollars, wherein priming cost 22,700,000,000 dollars, the loss etc. caused because looking after patient with family members of early dying young because of suicide is 32,400,000,000 dollars, and schizophrenia has high crippling, most of schizophreniac can remain some symptom all the life, need life-long therapy, due to schizoid seriousness and chronicity, to patient, family and social influence are very large, consume a large amount of public resource, therefore schizophrenia brings serious burden to society and family.
The sickness rate of schizophrenia in the male sex, women is almost identical, but the male sex occurs comparatively early, occurs in late adolescence and grows up early stage, about 15-25 year onset, and this stage constructs the critical period of life road just, women mainly 20-35 year onset.Patient's positive symptom such as have illusion, vain hope, autonomic movement to increase, has the negative symptomses such as flattening of affect, speech impairments, Social Withdrawal, has Cognitive simultaneously, depressed, the symptoms such as cognitive impairment such as social work's functional lesion.
According to factors such as the different clinical manifestation of schizophrenia, morbidity form, clinical characters, the course of disease, treatment plan, therapeutic response and prognosis, schizophrenia can be divided into simple form, intolerance style, intolerance style, catatonic type, undifferentiated type and Residual-type.
Intolerance style is also known as delusional type, the most common, accounts for more than 50% greatly; Frequently-occurring disease is between twenty and fifty or middle aged, and onset is slow.Its symptom, based on vain hope, is secondly exaggerate, envy vain hope, from guilty and be deeply in love.Patient vainly hopes content and is divorced from reality more, and structure is often messy, and has extensive trend, can with illusion and disturbance of perceptive synthesis.Emotion and behavior are often subject to the domination of illusion or vain hope, occur self inflicted injury or behavior of hurting sb.'s feelings.Intolerance style patient progress is normal slower.
Since oneth century, people are to schizoid physiology, biochemical, image, pharmacological agent and social family, the aspects such as environment are observed, various hypothesis and judgement have been made to the pathogeny of mental disorder, along with scientific-technical progress, people more and more recognize that genetic flaw is the major reason that many severe psychiatric diseases produce, when people run into environmental stress, those people carrying diseases predisposing gene more may suffer from mental health illness than the people not carrying tumor susceptibility gene, through investigation, schizophrenia is the very much higher genopathy of heredity grade, mainly present Familial aggregation, once a family member is ill, the tumor susceptibility gene that other members of this family carry is far away higher than normal people, need to carry out effective prevention and treatment, how schizophrenia is treated in today that science and technology is growing, the disease susceptibility of tumor susceptibility gene and individuality is how detected from hereditary angle, thus carry out further risk profile and diagnosis, become the Tough questions that numerous scientific and technical personnel and health care personnel face,
Although tumor susceptibility gene research is both at home and abroad carried out for many years, but make slow progress, only has minority about the report of qualification inheritance susceptible gene, but not specifically for the schizoid detect delay of certain type, in the world schizophrenia is divided into five types, the tumor susceptibility gene that every type relates to is different, can not be general this five type be all identified with one or several genes, and inevitable like this specificity is poor.Even if diagnose out schizophrenia, but do not know it is which kind of concrete schizophrenia, directive significance is lacked to follow-up treatment.
Utilizing genetic marker to detect gene of curing the disease, is the technology developed in recent years.Genetic marker, namely has one section of specific DNA sequence fragment on chromosome, and has polymorphism, and in generations transmit, follow regularity is separation, independent assortment and chain rule, therefore can obtain genetic material transmission of information.Genetic marker can be different zones gene element, can obtain Disease-causing gene designation of chromosome region, can clone further this ospc gene by chain and association analysis.For various various disease, finding Disease-causing gene with analysis is one of key of research.
The position that third generation genetic marker-SNP (singlenucleotidepolymorphism) refers to certain specific nucleotide in genome can exist two or more different bases, minimum gene frequency >=1% in colony.In the genome of the mankind only there are 2 kinds of allelotrope in most SNP site, so SNP can refer on location usually, diallelic change appears in a certain Nucleotide.SNP is the extremely important method that the Human Genome Project is moved towards to apply.Main because SNP provides a very strong instrument, for the qualification of the discovery of high risk population, diseases predisposing gene, medicinal design and fundamental biological knowledge research etc.Because the mankind exist SNP site in a large number, provide the relation between more opportunity discovery gene and disease.Find that the sudden change of disease related gene is easier than researchs such as familys by SNP.Some SNP is not Disease-causing gene, but the Disease-causing gene that it may be adjacent with some is chain, is vital signs too.
SNP with its density high (average every 1kb just have 1), representative strong (SNP being arranged in gene internal may directly affect protein structure or expression level), genetic stability good (with microsatellite polymorphism comparatively speaking), be easy to the features such as automated analysis (because SNP mostly is biallelic marker crowd, can simply with " +/-or 1/0 " direct somatotype) and become good genetic marker.
Nearest genome scanning result prompting, many karyomit(e)s are had to be associated with schizophrenia susceptibility, wherein No. 22 karyomit(e)s are associated with paranoid schizophrenia susceptibility, but do not find so far to determine the special tumor susceptibility gene relevant to paranoid schizophrenia in this chromosomal region.There is no any result of study be associated with paranoid schizophrenia about GNB1L gene at present, the present invention utilizes SNP technology to detect paranoid schizophrenia tumor susceptibility gene first time, for the further investigation of paranoid schizophrenia and control, diagnosis, treatment provide new thinking.
Summary of the invention
The object of this invention is to provide a kind of primer and the test kit that detect type paranoid schizophrenia susceptibility, thus meet this area for the correct demand identifying paranoid schizophrenia tumor susceptibility gene, for the further investigation of paranoid schizophrenia, prevention, treatment, diagnosis provide new thinking.
Contriver is shown by result of study, No. 22 Chromosome G NB1L genes are positioned at 22q11, GeneID:54584, it is G-protein subunit coding gene, it is the tumor susceptibility gene of paranoid schizophrenia, SNP site by GNB1L gene: rs748806 analyzes, result shows, rs748806 and paranoid schizophrenia height correlation.
The object of the invention is to be achieved through the following technical solutions:
1, detect a primer for paranoid schizophrenia tumor susceptibility gene, it is characterized in that: described primer is the nucleotide sequence of amplification GNB1L gene rs748806, is respectively shown in sequence table SEQ IDNo.1 and sequence table SEQ IDNo.2.
ACGTTGGATGTCCGGTCAAGTTCATCTCTG(SEQIDNo.1)
ACGTTGGATGTGGTGTGTTTGGGAAACAGC(SEQIDNo.2)
2, detect a test kit for paranoid schizophrenia tumor susceptibility gene, it is characterized in that comprising following reagent:
1) primer: be the nucleotide sequence shown in SEQIDNo.1, SEQIDNo.2,
2) pcr amplification damping fluid, Taq DNA polymerase,
3) dNTP mixed solution.
Specifically, the following technical scheme of the present invention realizes:
Detecting a nucleotide sequence of the GNB1L tumor susceptibility gene rs748806 of paranoid schizophrenia, is nucleotide sequence shown in sequence table SEQ IDNo.3.This nucleotide sequence is positioned at GNB1L gene, its variant sites, represents with letter " R ",
When the genotype of described mononucleotide polymorphism site rs748806 is A, the susceptibility of experimenter is minimum, and when carrying G allelotrope, the susceptibility of experimenter raises.
A detection method for vitro detection paranoid schizophrenia tumor susceptibility gene, comprises the steps:
1, extracting genome DNA
Adopt the test kit extracting DNA, extract the DNA of full-length genome in the white corpuscle of peripheral blood.
2, genomic dna quality examination
3, the detection of Genome DNA content and purity
4, primer is designed
The primer of amplification GNB1L gene rs748806 polymorphism is respectively: SEQIDNo.1, SEQIDNo.2
5, pcr amplification object fragment
The Partial Fragment comprising mononucleotide polymorphism site rs748806 of amplification GNB1L gene.
6, the genotype of pleomorphism site is detected.
By PCR primer direct Sequencing, the difference according to fluorescent signal judges genotype.
7, result judges
Rs748806 base is the individuality of (G) is schizophrenia susceptibility crowd.
Measuring method of the present invention determines the genomic dna deriving from people, and sample source is unrestricted, as: body fluid (blood, ascites and urine etc.), histocyte (as hepatic tissue) etc.Genomic dna can be prepared by these samples of Isolation and purification.The concentration of adjustment genomic dna, makes it consistent as much as possible.Take genomic dna as template, the nucleic acid fragment containing GNB1L gene mutation site can be amplified, to obtain the great amount of samples of mensuration.This sample obtained containing the DNA fragmentation of GNB1L genovariation point by amplification, is particularly suitable for as mensuration material.
When carrying out gene auxiliary diagnosis, the present invention is preferably applied in the auxiliary diagnostic measuring and exist according to GNB1L gene mutation type, and auxiliary diagnostic comprises the particular agent as neccessary composition, and it corresponds to the method for measuring gene mutation type.Suitable particular agent is selected, as DNA fragmentation and/or the primer for pcr amplification step by the measuring method adopted.
The present invention is by the statistical study of large sample, have studied the gene frequency of rs748806 pleomorphism site paranoid schizophrenia patient of GNB1L gene order, and according to the transmission situation of genotype in ill children, carry out transmission disequilibrium inspection and haplotyping, found that, the genotype distribution of whole sample and gene frequency all meet Hardy-Weinburg balance, correct through Bonferroni, transmission disequilibrium check analysis has significant statistics difference, is proved by large sample experiment.
Judged the method for the Susceptible population of paranoid schizophrenia by GNB1L gene base mutation characteristic according to the present invention, the examination of following method can be carried out to the crowd not showing clinical symptom, rs748806 base is the not easily generation paranoid schizophrenia of A, rs748806 base is the easy generation paranoid schizophrenia of G, for Susceptible population, risk factor will be reduced in daily life, as the stimulation in environment for paranoid schizophrenia Susceptible population as far as possible; Paranoid schizophrenia has morbidity suddenly simultaneously, and the features such as process is fast, therefore after early diagnosis, will treat in time, have the family of this type of disease, must not hide one's sickness for fear for the treatment of, cause the state of an illness day by day to worsen, delay, cause the result being difficult to rehabilitation.This disease, based on pharmacological agent, is aided with psychotherapeutics.Preventing and treating early this disease, is an important use of the present invention.
Compared with prior art, beneficial effect of the present invention is embodied in:
1, the invention detects paranoid schizophrenia susceptible gene, schizophrenia, according to factors such as different clinical manifestation, morbidity form, clinical characters, the course of disease, treatment plan, therapeutic response and prognosis, can be divided into simple form, intolerance style, intolerance style, catatonic type, undifferentiated type and Residual-type.Existing research only detects for schizoid tumor susceptibility gene general, but the tumor susceptibility gene involved by dissimilar schizophrenia is different, if do not carry out specific detection to the disease of certain type, inevitable poor specificity, Detection results is bad.
2, paranoid schizophrenia is in schizophreniac, and ratio is the highest, accounts for about 50%, therefore paranoid schizophrenia tumor susceptibility gene is detected, significant, early detection simultaneously, early treatment effectively can suppress course advancement, and result for the treatment of is good.
3, test kit of the present invention is simple to operate, belongs to the operation that those skilled in the art utilize prior art easily to realize, simple.
4, the present invention is utilized to set forth the nucleotide variation of GNB1L gene locus, as one of biomarker, can be used as the screening of the molecular target of medicinal design, to help to find the bioactive molecule having and regulate GNB1L to express, be conducive to promoting paranoid schizophrenia new drug development.
Embodiment
Embodiment 1
1, candidate gene and SNPs is selected
The present inventor's By consulting literatures, computer internet and information biology is utilized to obtain each side schizophrenia Candidate Gene Study, Single nuclear polymorphism (SNP) linkage disequilibrium value is carried out by linkage disequilibrium value method at No. 22 karyomit(e)s, by NCBI (http://www.ncbi.nlm.nih.gov/mapviewer) database, obtain GNB1L gene, and by http://www.ncbi.nlm.nih.gov/SNP, http://snp.cshl.org/ database, searches out the candidate gene SNPs meeting its condition.Its inclusion criteria: 1, existing pertinent literature is reported; 2, the minimum gene frequency in site should be greater than 10%; 3, selected SNPs must can meet the requirement of primer-design software; 4, selected site can not affect gene type experiment
2, research object
The present invention is research object with 451 routine paranoid schizophrenias and 460 routine normal healthy controls (healthy, without physical disease, without family's heredopathia history, be a cup too low history of disease, without drug abuse).All research objects are Chinese han population, and sign the Informed Consent Form of Ethics Committee's approval voluntarily.
2.1 paranoid schizophrenias enter group and exclusion standard
2.1.1 enter group standard
(1) paranoid schizophrenia Case definition is met, PANSS scoring >=60 points;
(2) in age 15-50 year, the course of disease is no more than 24 months, does not take any antipsychotics;
(3) voluntary participation sign Informed Consent Form.
2.1.2 exclusion standard
(1) non-paranoid schizophrenia patient is diagnosed as;
(2) clear and definite central nervous system disease, as apoplexy, Parkinson and epilepsy etc.
(3) severe physical disease, as infection, diabetes and hypertension etc.;
2.2 Case definition and Measuring scale assessing
2.2.1 Case definition
(1) international disease fragmentation criterion the 10th edition: schizophrenia Case definition (ICD-10);
(2) " the sick classification and diagnosis standard of Chinese Spirit " (the 2nd edition) revised edition schizophrenia standard (CCMD-2-R);
(3) all cases all meet above-mentioned two Case definition, just can enter group.
2.2.2 psychotic state Measuring scale assessing
PANSS scoring is carried out to patient by 2 psychiatrists through training simultaneously.PANSS comprises positive symptom subscale, negative symptoms subscale and general pathology subscale.Participate in 2 doctors of measuring scale all through the training of PANSS scale consistence.
2.2.3 cognitive function scale
The complete neuropsychological Status Exam (RBANS) of repeatability be one simple and clear, by the test of one man operation, the Cognitive Assessment instrument commonly used in the world at present, comprise 12 subtests, 5 groups of neuropsychological states can be summarized in: immediate memory (immediatememory), attention (attention), vision range (visuospatial/constructional), language (language) and delay memory (delayedmemory).Operated by the examiner through training; complete whole detection and generally need time 20-30 minute; RBANS is translated into Chinese edition by the people such as Zhang Baohua; and test the reliability and validity that schizophreniac and normal people organize RBANS, result show this scale be a reliability, validity better and the scale of briefly easy evaluation cognitive function.
3, blood and clinical data are collected
Experimenter is conscientiously reading, is understanding and the project informed consent postscript of signature Ethics Committee approval voluntarily, and get peripheric venous blood 5ml ,-20 degree are saved to extraction genomic dna.Collect schizophreniac's age, sex, family history, nationality and schooling, be admitted to hospital and make a definite diagnosis the data of time, clinical symptom, cognitive function etc. and disease-related first; Normal people collects general demographic data and cognitive function measuring scale.
3.1 extracting genome DNA
Adopt special extraction DNA test kit, extract the DNA of full-length genome in the white corpuscle of peripheral blood.Operation steps is as follows: blood thaws, mark 1.5mlEppendorf centrifuge tube → cell pyrolysis liquid 900uL to add in centrifuge tube → add thaw after after whole blood 200uL, mixing, 20min is acted under normal temperature, and put upside down 4-6 time → 10, 000rpm centrifugation time 4min, remove supernatant, then vibrate, throw out is suspended → 300uL karyorhexis liquid again, then vibrate lightly, make it mix, 37 DEG C of water-bath 30min → RNA degrading enzyme 1.5 μ L again, vibration mixing, water-bath 15min, 37 DEG C → albumen precipitation liquid 100uL, flick at the bottom of pipe, normal temperature effect 20min → 12, the centrifugal 4min of 000rpm, supernatant liquor is transferred in the centrifuge tube having added Virahol 300uL, 20min puts upside down gently → and 12, the centrifugal 4min of 000rpm, abandon supernatant, add 70% ethanol 300uL, shake up gently → 12, the centrifugal 4min of 000rpm, abandon supernatant, by centrifuge tube oblique inverted, wait for that airing → DNA lysate 100uL mixes, water-bath 1h, 65 DEG C (or 4 DEG C are spent the night), DNA has prepared complete in centrifuge tube.
3.2 genomic dna quality examinations
Get 1-2 μ L genomic dna stoste, by agarose electrophoresis method detect extract the quality criteria requirements whether DNA sample meets PCR-ALFP and Sequenom; This DNA sample of light tone font representation meets genotyping technique requirement; Red font (no specimen or sample size few) represents that this DNA does not meet genotyping technique requirement, needs again to extract.
The detection of 3.3 Genome DNA contents and purity
With NanoDrop-1000 all-wave long ultraviolet/visible light scanning spectrophotometer Accurate Determining this DNA content of every increment and OD ratio (A260/A230, A260/A280).A260/A230 ratio is low: small molecular weight impurity or remaining salt pollute, and have unknown impurity if too high.Ratio (A260/A280) is low: albumen or phenol have residual caused by; Ratio (A260/A280) ratio is high: RNA have residual caused by; Usual A260/A280 ≈ 1.8 representative sample DNA is pure
4, primer is designed
The primer of amplification GNB1L gene rs748806 polymorphism is respectively:
ACGTTGGATGTCCGGTCAAGTTCATCTCTG(SEQIDNo.1)
ACGTTGGATGTGGTGTGTTTGGGAAACAGC(SEQIDNo.2)
Pcr amplification object fragment
Apply above primer and carry out pcr amplification, PCR reaction system is 20ul, wherein containing 10mMTris-HCl (PH8.4), 50mMKCl, 1.5mMMgCl2,200uMdNTP, the each 0.4uM of upstream and downstream primer, Taq polysaccharase 1U, DNA profiling 30-50ng, pcr amplification condition is: PCR reaction conditions is 95 DEG C of denaturation 5min, 95 DEG C of sex change 30s, 65 DEG C of annealing 30s, 72 DEG C extend 25s, altogether 35 circulations, 72 DEG C of total elongation 2min, getting PCR primer 5ul 1.5% agarose gel electrophoresis, take DNAmarker as molecular weight standards, amplification.
5, order-checking judges genotype
PCR primer detects through 8% polyacrylamide gel electrophoresis, send Hua Da gene sequencing portion to carry out sequence verification after gel imaging system observation is qualified.
6, result judges
Rs748806 base is the individuality of (G) is paranoid schizophrenia Susceptible population.
The present invention, by above-mentioned experiment, sets up Pedigree genetic analysis database, application goodness of fit chi square test and transmission disequilibrium inspection, and application UNPHASED analysis software carries out monoploid and transmits chi square test, utilizes GraphPadprism analytical data.
Transmission disequilibrium inspection display, SNP significantly associates with paranoid schizophrenia (P<0.001). and utilize PCR-RFLP technology, detect that rs748806 base is for (G) relevant to paranoid schizophrenia clinical symptom total score (P<0.05).Rs748806 (G) and positive symptom, cognitive function, negative symptoms relevant (P<0.05).
Apply the distribution of online genetic statistics SHEsis computed in software genotype frequency and meet Hardy-Weinberg equilibrium law; Analyze candidate gene SNPs site and schizoid cognation; Linkage disequilibrium degree and haplotype between each site of analyzing gene; Application MDR software analysis gene-intergenic interaction; Application GraphPadprism software analysis candidate gene SNPs site and schizophrenia clinical symptom.
The present invention is by the statistical study of large sample, have studied the gene frequency of rs748806 pleomorphism site paranoid schizophrenia patient of GNB1L gene order, and according to the transmission situation of genotype in ill children, carry out transmission disequilibrium inspection and haplotyping, found that, the genotype distribution of whole sample and gene frequency all meet Hardy-Weinburg balance, correct through Bonferroni, transmission disequilibrium check analysis has significant statistics difference, is proved by large sample experiment.
451 routine paranoid schizophrenia patients are detected in this site altogether, 460 routine healthy normal control subjects; Rs748806 site is two condition SNP; Cut detection through enzyme, in colony, occur different genotype results.Adopt online genetic statistics SHEsis software to analyze genotype and the gene frequency of patient and normal healthy controls experimenter respectively, the genotype frequency distribution of SNPs all meets H-W balance, illustrates that the sampling colony of this research meets H-W balance.Detect the dependency of rs748806 loci gene type and paranoid schizophrenia cognitive function of patients, result display is with positive symptom, negative symptoms, cognitive there were significant differences (P<0.05).Illustrate that this site affects the clinical symptom of patient.
Embodiment 2
Proof test: adopt this test kit, random selecting paranoid schizophrenia clinical samples 20 example, control group sample 20 example, detects GNB1L gene rs748806 loci polymorphism through PCR order-checking.
1, pcr amplification:
By pcr amplification GNB1L gene rs748806 Partial Fragment, PCR reaction system is: 10 × PCR reaction buffer 3 μ L, 10mM/LdNTP0.5 μ L, Taq DNA polymerase 0.5 μ L, 10pM/L primer 0.5 μ L, genomic dna 1 μ L, adds deionized water to 30 μ L.In each system, add 20 μ L paraffin oils during PCR, prevent from evaporating.
PCR reaction conditions is 95 DEG C of denaturation 5min, 95 DEG C of sex change 30s, and 65 DEG C of annealing 30s, 72 DEG C extend 25s, altogether 35 circulations, 72 DEG C of total elongation 2min.
2, order-checking judges genotype
PCR primer detects through 8% polyacrylamide gel electrophoresis, send Hua Da gene sequencing portion to carry out sequence verification after gel imaging system observation is qualified.
3, result
Result shows, clinical samples GNB1L gene rs748806 site, and Genetic polymorphism type is 6 examples of GA, GG14 example; Normal healthy controls group genotype is all AA.Present method effectively can detect paranoid schizophrenia.
Loci polymorphism: during AA, the susceptibility of experimenter is minimum; Carry G allelotrope, the susceptibility of experimenter raises.
The above; be only the present invention's preferably embodiment, but protection scope of the present invention is not limited thereto, is anyly familiar with those skilled in the art in the technical scope that the present invention discloses; the change that can expect easily or replacement, all should be encompassed within protection scope of the present invention.Therefore, protection scope of the present invention should be as the criterion with the protection domain of claims.
<110> Qingdao City Tumour Hospital
<120> mono-kind detects primer and the test kit of type paranoid schizophrenia susceptibility
<160>3
<210>1
<211>30
<212>DNA
<213> artificial sequence
<400>1
ACGTTGGATGTCCGGTCAAGTTCATCTCTG
<210>2
<211>30
<212>DNA
<213> artificial sequence
<400>2
ACGTTGGATGTGGTGTGTTTGGGAAACAGC
<210>3
<211>
<212>DNA
<213> Genus Homo, ethnic group
<220>3
<221> variant sites
<222>(501)..(501)
<223>R＝AorG
<400>3
CATCCGTCAGCTGTCCTGGGGATGGGGGCACAAGGCCCTGATGTAAGCGGCAGAGCTTCT60
CATGTCTCCCCGGGAGGAAGGGTCTCCTAAGGCTTAGCAGGCCTGGGTGGTCGGTGGATG120
TGTCATCATCATGATGCCCGTTCTGAGCAGCTAGAAGCTGAGCTGCTCTGGGCGCTGGGA180
GGCAGAGCCACTCTGGGTGCTGGGTCTGCATGTCTGGAAGGGGCGTCTCCCTTGCACTCC240
CTCCCTCCTCCTCAAGCCTGGCAGGGATCCTGCAGGGCTGCCCCCATGGGGTCCAGTGTT300
CACTTGGCACTGGCTTGTCCTTCACCAGCCTGACAGCAAAGCGCTGAAGACCCAGACAGC360
TTCCCTGAGAGCCCCCGGAGGGCTCTTCTCTGCAGTTTCCACCTCTGTGCCCAGGACCCC420
AGGAAGGGGCCCTCCTGCCGTCCTGGCCCAGATCTGCCTCGTCTCTCCTGGTGTGTTTGG480
GAAACAGCTGCTGGAACTTARGACTGTAATTTATGGGGCATGTTCCAGTCCAGAGATGAA540
CTTGACCGGATTGATGAATTGAAAAGTTAAAGCAAAAGGGGGACCAGGTATTAATGAATT600
GGAAAGTGAGAGCAGAAGGGAGAACCAGGAACAGGGAGTGGTTGGCGTGGCTGTGGCGTG660
TGGGCAGGGCATCGGCCCATGGTGCACATCGAAGGAGAGGCGTTTCCCCTGCTGAGCCCT720
GTGTTGCATGGGCCAGGAGGAGGCCTGGGAGGGGACAGGCGACTCCAGGAACAGGGGACA780
GGGAGCCGGAGAGGCTGATGCGCCACCCTCTGCCCAATGTCACATCTTAACGTTGATCCT860
AGAGGCCCTGGAGATTGCAGGTTCTGTAAAGCCCCAGCCTCAGGGAAAGCCTGTGGGGGC920
GCTTTCGGAGGTGAGCTGCCTGAGAGCGTTCTTGCCACCCGGGAGCAAGCAAGGTGACCG980
AAGGTCCTCAGCACCCACAG1040。
Claims (2)
1. detect a primer for paranoid schizophrenia tumor susceptibility gene, it is characterized in that: described primer is the nucleotide sequence of amplification GNB1L gene rs748806, is respectively shown in sequence table SEQ IDNo.1 and sequence table SEQ IDNo.2.
2. detect a test kit for paranoid schizophrenia tumor susceptibility gene, it is characterized in that comprising following reagent:
1) primer: be the nucleotide sequence shown in SEQIDNo.1, SEQIDNo.2,
2) pcr amplification damping fluid, Taq DNA polymerase,
3) dNTP mixed solution.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610078972.1A CN105543390A (en) | 2016-02-04 | 2016-02-04 | Primer and kit for detecting susceptibility of paranoia schizophrenia |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610078972.1A CN105543390A (en) | 2016-02-04 | 2016-02-04 | Primer and kit for detecting susceptibility of paranoia schizophrenia |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105543390A true CN105543390A (en) | 2016-05-04 |
Family
ID=55822947
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610078972.1A Pending CN105543390A (en) | 2016-02-04 | 2016-02-04 | Primer and kit for detecting susceptibility of paranoia schizophrenia |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105543390A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106434881A (en) * | 2016-08-30 | 2017-02-22 | 张建华 | Primer and kit for detecting catatonic schizophrenia susceptibility |
| CN106434880A (en) * | 2016-08-30 | 2017-02-22 | 张建华 | Primer for detecting simple type schizophrenia susceptibility and kit |
| CN115579056A (en) * | 2022-08-24 | 2023-01-06 | 南方医科大学南方医院 | Gene group for evaluating schizophrenia molecular typing and diagnostic product and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1635142A (en) * | 2003-12-26 | 2005-07-06 | 中国医学科学院基础医学研究所 | Reagent kit for forecasting susceptibility of intolerance type dementia preaecox and primer used thereby |
| WO2008086579A1 (en) * | 2007-01-19 | 2008-07-24 | Queensland University Of Technology | Diagnostic methods and agents |
-
2016
- 2016-02-04 CN CN201610078972.1A patent/CN105543390A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1635142A (en) * | 2003-12-26 | 2005-07-06 | 中国医学科学院基础医学研究所 | Reagent kit for forecasting susceptibility of intolerance type dementia preaecox and primer used thereby |
| WO2008086579A1 (en) * | 2007-01-19 | 2008-07-24 | Queensland University Of Technology | Diagnostic methods and agents |
Non-Patent Citations (4)
| Title |
|---|
| YUE SUN等: "The schizophrenia/bipolar disorder candidate gene GNB1L is", 《NEUROSCIENCE BULLETIN》 * |
| 亓高超: "《新编临床精神病学》", 31 August 2015 * |
| 徐元贞: "《新全实用药物手册 第2版》", 31 May 1999 * |
| 惠李: "精神分裂症候选基因、临床症状及认知功能的相关性研究", 《中国博士学位论文全文数据库 医药卫生科技辑》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106434881A (en) * | 2016-08-30 | 2017-02-22 | 张建华 | Primer and kit for detecting catatonic schizophrenia susceptibility |
| CN106434880A (en) * | 2016-08-30 | 2017-02-22 | 张建华 | Primer for detecting simple type schizophrenia susceptibility and kit |
| CN115579056A (en) * | 2022-08-24 | 2023-01-06 | 南方医科大学南方医院 | Gene group for evaluating schizophrenia molecular typing and diagnostic product and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105861716B (en) | circRNA marker, kit and gene chip for depression diagnosis | |
| D’Aguillo et al. | Genetic screening as an adjunct to universal newborn hearing screening: literature review and implications for non-congenital pre-lingual hearing loss | |
| CN110699446B (en) | SNP marker rs3174298 related to non-syndrome cleft lip and palate diagnosis and application thereof | |
| CN105506164A (en) | Kit for detecting susceptibility of hebephrenic schizophrenia | |
| CN105543390A (en) | Primer and kit for detecting susceptibility of paranoia schizophrenia | |
| Jiang et al. | Common variants in KCNK5 and FHL5 genes contributed to the susceptibility of migraine without aura in Han Chinese population | |
| WO2009150221A1 (en) | A method for autism prediction | |
| US20110091899A1 (en) | Combination of risk alleles associated with autism | |
| JP5721150B2 (en) | Prediction risk of age-related macular degeneration | |
| Rao et al. | A case-control study of the association between polymorphisms in the fibrinogen alpha chain gene and schizophrenia | |
| JP5226256B2 (en) | Prediction risk of age-related macular degeneration | |
| CN103710447B (en) | Method and reagent for predicting susceptibility of ankylosing spondylitis | |
| CN103710448B (en) | Method and kit for predicting susceptibility of ankylosing spondylitis | |
| Ding et al. | Identification of linkage disequilibrium SNPs from a Kidney-yang deficiency syndrome pedigree | |
| CN106434881A (en) | Primer and kit for detecting catatonic schizophrenia susceptibility | |
| CN106434880A (en) | Primer for detecting simple type schizophrenia susceptibility and kit | |
| Latalova et al. | Gene–Environment Interactions in Major Mental Disorders in the Czech Republic | |
| CN104293958B (en) | A kind of test kit predicting susceptibility of ankylosing spondylitis and method | |
| CN113493863B (en) | Molecular marker for detecting COVID-19 susceptibility, kit and application | |
| CN106434678A (en) | Hebephrenic type schizophrenia associated gene | |
| KR102346185B1 (en) | Biomarker for predicting skin pigmentation risk and use thereof | |
| KR102018830B1 (en) | Genetic biomarker for the diagnosis of, and prediction for symptom severity of, fibromyalgia | |
| CN105925684A (en) | IncRNA marker, kit and gene chip for anxiety disorder diagnosis | |
| CN107385076A (en) | A kind of hypothyroidism Disease-causing gene mutation and the diagnostic reagent based on this gene mutation | |
| CN106381330A (en) | Primer and kit for detecting susceptibility of communicating hydrocephalus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20160504 |
|
| RJ01 | Rejection of invention patent application after publication |