CN106399572B - Application of the single nucleotide polymorphism rs149308743 in screening leper - Google Patents

Abstract

The invention discloses application of the single nucleotide polymorphism rs149308743 in screening leper.The technical solution that the present invention is protected is to detect the substance application of the polymorphism of rs149308743 or the substance of genotype in the product that preparation detects single nucleotide polymorphism relevant to leprosy in preparing application and detection human genome in screening leper product of the polymorphism or genotype of rs149308743 in human genome.The substance of polymorphism or genotype that rs149308743 can be will test is united the product of preparation screening leper to other materials (substance as detected other single nucleotide polymorphism relevant with leprosy or genotype).

Description

Application of the single nucleotide polymorphism rs149308743 in screening leper

Technical field

The present invention relates to single nucleotide polymorphism rs149308743 answering in screening leper in field of biotechnology With.

Background technique

Leprosy also known as Hansen ' s disease, are a kind of communicable diseases as caused by Mycobacterium leprae (M.Leprae), main Invade skin and peripheral nerve.2014, there were 213,889 new cases in the whole world.Although presently, there are effective treatment sides Method, but in some countries, especially developing country, leprosy is still teratogenesis and the main reason for leading to some social concerns.For Understand the genetic base of vulnerability to leprosy, the whole-genome association (GWAS) of leprosy located 17 common variation positions Point discloses the effect of inherent immunity and adaptive immunity in leprosy morbidity.However, these common risk variant sites are big Part is located at noncoding region, is only capable of the onset risk of partial interpretation leprosy.Currently, the change to protein encoding regions not yet Different, especially low frequency variation and rare variation carries out system research.And these variations have proven to the inheritance susceptible with some diseases Property it is related.

Summary of the invention

The technical problem to be solved by the present invention is to how screening leper and detection vulnerability to leprosy.

In order to solve the above technical problems, present invention firstly provides following any purposes:

A1 the polymorphism (i.e. allele) of rs149308743 or the substance of genotype in human genome) is detected to prepare Application in screening leper's product；

A2 the polymorphism (i.e. allele) of rs149308743 or the substance of genotype in human genome) is detected to prepare Detect the application in vulnerability to leprosy product；

A3 the polymorphism (i.e. allele) of rs149308743 or the substance of genotype in human genome) is detected to prepare Detect the application in the product of single nucleotide polymorphism relevant to leprosy；

A4 the polymorphism (i.e. allele) of rs149308743 or the substance of genotype in human genome) is detected to prepare Identification or auxiliary identify the application in the product of single nucleotide polymorphism relevant to leprosy；

B1) polymorphism (i.e. allele) or genotype of rs149308743 are suffered from preparation screening leprosy in human genome Application in person's product；

B2) polymorphism (i.e. allele) or genotype of rs149308743 are easy in preparation detection leprosy in human genome Application in Perceptual product；

B3) detect human genome in rs149308743 polymorphism (i.e. allele) or genotype substance in screening Application in leper；

B4 the polymorphism (i.e. allele) of rs149308743 or the substance of genotype in human genome) is detected to detect Application in vulnerability to leprosy；

B5 the polymorphism (i.e. allele) of rs149308743 or the substance of genotype in human genome) is detected to detect Application in single nucleotide polymorphism relevant to leprosy；

B6 the polymorphism (i.e. allele) of rs149308743 or the substance of genotype in human genome) is detected to identify Or auxiliary identifies the application in single nucleotide polymorphism relevant to leprosy；

B7) in human genome the polymorphism (i.e. allele) or genotype of rs149308743 in screening leper Application；

B8) polymorphism (i.e. allele) or genotype of rs149308743 are detecting vulnerability to leprosy in human genome In application.

Rs149308743 is the SNP site of a two equipotential polymorphisms on human chromosome 9q34.3, belongs to rare mutation (MAF=0.5%), in the exon of CARD9 gene, which is conversion (C/T is then G/A on its complementary strand).Institute Stating rs149308743 genotype is CC, TC or TT.The CC is that the site rs149308743 is the homozygous of C, and the TT is The site rs149308743 is the homozygous of T, and the TC is the heterozygous that the site rs149308743 is C and T.Detection people's base Because the polymorphism (i.e. allele) or genotype of rs149308743 in group concretely detect the nucleotide of rs149308743 Type.

In such use, the substance of the polymorphism or genotype of rs149308743 can be expansion in the detection human genome Increase the PCR primer and/or Single base extension primer of the genomic DNA fragment including rs149308743.The product can wrap Include the PCR primer and/or the Single base extension primer.

In such use, ratio of the individual of the TC genotype in leper group is higher than corresponding genotype and exists Ratio in normal person group.

In such use, the leprosy concretely Chinese population leprosy.

In order to solve the above technical problems, the present invention also provides containing detection human genome in rs149308743 it is polymorphic The product of the substance of property or genotype.

Production provided by the present invention containing the substance of the polymorphism or genotype of rs149308743 in detection human genome Product, for any product in a)-d):

A) product of single nucleotide polymorphism (i.e. allele) relevant to leprosy or genotype is detected；

B) identify or assist the product of identification single nucleotide polymorphism (i.e. allele) relevant to leprosy or genotype；

C) screening leper product；

D) vulnerability to leprosy product is detected.

In the said goods, the substance of the polymorphism or genotype of rs149308743 can be expansion in the detection human genome Increase the PCR primer and/or Single base extension primer of the genomic DNA fragment including rs149308743.

In the said goods, the leprosy concretely Chinese population leprosy.

In order to solve the above technical problems, the present invention also provides following M1) or method M2):

M1) the method for screening leper, comprising: detect the gene in the site rs149308743 in object genome to be measured Type, if the genotype in the site rs149308743 is TT genotype, the object to be measured is or candidate is leper；Such as The genotype in the site rs149308743 is TC genotype, and the object to be measured is or candidate is leper；Such as The genotype in the site rs149308743 is CC genotype, and the object to be measured is or candidate is non-leper；

M2 the method for vulnerability to leprosy) is detected, comprising: detect the base in the site rs149308743 in object genome to be measured Because of type, if the genotype in the site rs149308743 is TT genotype, the object to be measured is susceptible or candidate susceptible leprosy；Such as The genotype in the site rs149308743 is TC genotype, and the object to be measured is susceptible or candidate susceptible leprosy；Such as The genotype in the site rs149308743 is CC genotype, and the object to be measured is susceptible or candidate not susceptible leprosy.

In the above method, the leprosy concretely Chinese population leprosy.

In the above method, the detection is can be used in the genotype for detecting the site rs149308743 in object genome to be measured The polymorphism of rs149308743 or the substance of genotype carry out.

It is demonstrated experimentally that the risk allele of rs149308743 is T, ratio of the allele in leper group Example is higher by 816.67% than ratio of the allele in normal health crowd.The P value of rs149308743 is 2.09 × 10^-8, and The relative risk of rs149308743 is 4.75, illustrates that rs149308743 is single nucleotide polymorphism relevant to leprosy. In three genotype of rs149308743, ratio of the individual of TC genotype in leper group is higher than corresponding gene Ratio of the individual of type in normal person group, ratio of the individual of CC genotype in leper group are lower than the genotype Ratio of the individual in normal person group.

The present invention in practical applications, can will test the polymorphism (i.e. allele) or genotype of rs149308743 Substance is combined to other materials (substance as detected other single nucleotide polymorphism relevant with leprosy or genotype) one Play the product of preparation screening leper.

Wherein, detect human genome in rs149308743 polymorphism or genotype substance can for by it is following at least Reagent and/or instrument needed for a kind of method determines the polymorphism or genotype of rs149308743: DNA sequencing, restricted digestion Fragment length polymorphism, single-strand conformation polymorphism, denaturing high-performance chromatography, SNP chip, TaqMan probe technology and Sequenom MassArray technology.Wherein, the polymorphism of rs149308743 is determined using Sequenom MassArray technology Or reagent needed for genotype and/or instrument include PCR primer to, the extension primer based on single base extension, phosphatase, Resin, chip, MALDI-TOF (matrix-assisted laser desorption/ionization-time of Fligh, matrix solid-dispersion flight time mass spectrum) and/or Sequenom MassArray technology required for Other reagents and instrument；Reagent needed for determining the polymorphism or genotype of rs149308743 using TaqMan probe technology and/ Or instrument include TaqMan probe, PCR primer to, quantitative PCR apparatus, carry out the module and/or TaqMan probe skill of Genotyping Other reagents required for art；SNP chip includes the chip based on nucleic acid hybridization reaction, the core based on single base extension Piece, the chip based on " one-step method " reaction, is based on primer connection instead at the chip based on allele-specific primers extension The chip answered, the chip based on restriction enzyme reaction, the chip based on protein D NA association reaction and/or based on fluorescence point The chip of sub- DNA association reaction.In one embodiment of the invention, that utilize is the Infinium of Illumina company Human Exome BeadChip chip.

The product can be reagent or kit, can be also the system being made of reagent or kit and instrument, such as by drawing The system of object and DNA sequencer composition, the system being made of PCR reagent and DNA sequencing reagent and DNA sequencer, by TaqMan Probe, PCR primer are to, quantitative PCR apparatus and carry out required for the module and TaqMan probe technology of Genotyping other and try The system of agent composition, other reagents required for probe, PCR primer pair and Ligase detection reaction (LDR) and instrument group At system, by PCR primer to, Single base extension primer, chip, PCR instrument, carry out Genotyping module and/or The system of other reagents required for Sequenom MassArray technology and instrument composition.

Genomic DNA fragment including rs149308743 is expanded using PCR primer, with obtained pcr amplification product For template, single base extension is carried out using Single base extension primer, the sequence of obtained extension products is detected, really Determine the polymorphism (i.e. allele) and genotype of rs149308743.The PCR primer does not have particular/special requirement in sequence, only It wants that the genomic DNA fragment including rs149308743 can be amplified.The extension primer is according in human genome Last 1 nucleotide of the upstream rs149308743 (not including the SNP site) design, the extension primer corresponds to people's gene Preceding 1 nucleotide of rs149308743 in group.The extension primer can also be according to the downstream rs149308743 in human genome (no Including the SNP site) it designs, the 1st nucleotide of the extension primer corresponds to rear 1 of rs149308743 in human genome Position nucleotide.

In the present invention, the PCR primer can be made of rs149308743-F and rs149308743-R；

The rs149308743-F is following a1) any single stranded DNA into a4):

A1) single stranded DNA shown in sequence 4 in sequence table；

A2) in a1) 5 ' ends and/or 3 ' ends add the single stranded DNA that one or several nucleotide obtain；

A3) and a1) or a2) single stranded DNA that limits with 85% or more identity single stranded DNA；

A4) the single stranded DNA that the single stranded DNA limited under strict conditions with a1) or a2) hybridizes；

The rs149308743-R is following b1) any single stranded DNA into b4):

B1) single stranded DNA shown in sequence 5 in sequence table；

B2) in b1) 5 ' ends and/or 3 ' ends add the single stranded DNA that one or several nucleotide obtain；

B3) and b1) or b2) single stranded DNA that limits with 85% or more identity single stranded DNA；

B4) the single stranded DNA that the single stranded DNA limited under strict conditions with b1) or b2) hybridizes.

The Single base extension primer (rs149308743-E) can be following c1) any single stranded DNA into c4):

C1) single stranded DNA shown in sequence 6 in sequence table；

C2) in c1) 5 ' ends and/or 3 ' ends add the single stranded DNA that one or several nucleotide obtain；

C3) and c1) or c2) single stranded DNA that limits with 85% or more identity single stranded DNA；

C4) the single stranded DNA that the single stranded DNA limited under strict conditions with c1) or c2) hybridizes.

A2) described in a1) 5 ' ends and/or to add the single stranded DNA that one or several nucleotide obtain be in sequence 4 at 3 ' ends Shown in single stranded DNA 5 ' ends and/or the 3 ' obtained single stranded DNAs of end one to ten nucleotide of addition.B2) described in b1) 5 ' End and/or 3 ' ends add the 5 ' ends that the single stranded DNA that one or several nucleotide obtain is the single stranded DNA shown in sequence 5 and/or The single stranded DNA that 3 ' end one to ten nucleotide of addition obtain.C2) described in c1) 5 ' ends and/or 3 ' end additions it is one or several The single stranded DNA that nucleotide obtains is that 5 ' ends of the single stranded DNA shown in sequence 6 and/or 3 ' end one to ten nucleotide of addition obtain The single stranded DNA arrived.

Term " identity " used herein refers to the sequence similarity with native sequence nucleic acid." identity " includes and this hair Nucleotide sequence shown in bright sequence 4, sequence 5 or sequence 6 has 85% or higher or 90% or higher or 95% or more The nucleotide sequence of high identity.Identity can with the naked eye or computer software is evaluated.Using computer software, two Or the identity between multiple sequences can be indicated with percentage (%), can be used to evaluate same between correlated series Property.

The stringent condition is to hybridize at 68 DEG C in 2 × SSC, the solution of 0.1%SDS and wash film 2 times, every time 5min, but in 0.5 × SSC, the solution of 0.1%SDS, hybridize at 68 DEG C and washes film 2 times, each 15min；Or, 0.1 × SSPE (or 0.1 × SSC), 0.1%SDS solution in, hybridize under the conditions of 65 DEG C and wash film.

Above-mentioned 85% or more identity can be 85%, 90% or 95% or more identity.

In an embodiment of the present invention, rs149308743 application SEQUENOM genotyping platform isPoint Son amount array technique, SequenomDetection process combination multiple PCR technique, MassARRAY iPLEX are mono- Base elongation technology and matrix solid-dispersion flying time mass spectrum analysis mass-spectrometric technique (matrix-assisted Laser desorption/ionization-time of flight, MALDI-TOF) carry out parting detection.It will include SNP The DNA profiling in point region is expanded by round pcr, and it is anti-to reuse special extension primer and PCR product progress Single base extension It answers.Since polymorphic site base is different, the different terminal bases of extension products will lead to the difference of the molecular weight of product after extending It is different, therefore the base difference as caused by SNP polymorphism is embodied by the difference of molecular weight, passes through matrix assisted laser desorption ionization Ionization time of flight mass spectrometry analyzes mass-spectrometric technique, detects the size of extension products molecular weight, and the analysis software of application specific passes through Judge the difference of molecular weight and carries out SNP parting detection.

Present invention discovery in a sample (7048 lepers and 14398 healthy persons) from Chinese population Rs149308743 is single nucleotide polymorphism relevant to leprosy.Polymorphism (the i.e. equipotential base of rs149308743 can be will test Cause) or genotype substance and other materials (as detected other single nucleotide polymorphism (i.e. equipotential bases relevant with leprosy Cause) or genotype substance) be united preparation screening leper product.

Detailed description of the invention

Fig. 1 is to carry out using fixed effect model to all samples (7,048 cases and 14,398 normal healthy controls) The result of meta analysis.

Specific embodiment

The present invention is further described in detail With reference to embodiment, and the embodiment provided is only for explaining The bright present invention, the range being not intended to be limiting of the invention.

Experimental method in following embodiments is unless otherwise specified conventional method.

The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.

Embodiment 1, rs145562243, rs149308743, rs76418789, rs146466242, rs55882956, Rs780668 and rs181206 is single nucleotide polymorphism relevant to leprosy

Method: inventor by three phases in Chinese population 7,048 lepers and 14,398 it is normal right Shine into the whole-genome association research of row protein encoding regions.Firstly, by Exon chip to 1,648 leper (first stage) is analyzed with the SNP site (MAF > 0.1%) of 40,491 coding regions of 2,318 normal controls.So 34 candidate SNP locus are verified in north of China crowd (3,169 lepers and 9,814 normal controls) afterwards (second stage).Finally in the southern china crowd (2,231 lepers and 2,266 normal controls) in addition chosen and (phase III) is verified to 8 candidate locus in all samples in the first and second stage.

Research object

The research object of Exon chip discovery phase (first stage) is 1,670 lepers of Northern Part of China With 2,321 normal controls.Qualify Phase (second stage) by 39 variant sites Northern Part of China other 3,169 It is verified in example leper and 9,814 normal controls.Finally to the repeated authentication stage of 8 variant sites filtered out The research object that (phase III) selects is three independent samples of southern area of China and all samples in the first and second stage This: (1) Sichuan Province 906 leper and 878 normal controls；(2) 829, Yunnan Province leper and 589 are normal right According to；(3) 496, Guizhou Province leper and 799 normal controls.Leper and normal control are Chinese han population, And geographically match.The clinical information of research object is shown in Table 1.

Table 1, research object information

Wherein, the diagnostic criteria of leper is 2 or 2 or more met in following 4, or to meet the 3rd article of person true Vertical diagnosis: 1, skin lesion with sensory disturbance and closes sweat, or has numb area；2, peripheral nerve is involved, and shows as the coarse companion of nerve cord Corresponding function obstacle；3, skin lesion histotomy or tissue fluid smear find Mycobacterium leprae；4, pathology visible features sexually revise.

The diagnostic criteria of normal control (normal healthy people): family history (including the leper without History of Leprosy and without leprosy Level-one, second level and third degree relative)；Without animal infectious diease medical history；Without other autoimmune disease medical histories, systemic disease disease History and family history.

This research has passed through Shandong Academy of Medical Sciences, Shandong Dermatopathy Cypridopathy Prevention and Cure Institute's Institutional Review Board Approval.

Parting and Quality Control

Select the Infinium Human Exome BeadChip chip of Illumina company to 1,670 lepers And 2,321 normal controls carry out parting, share on chip and carry out full sequencing of extron group identification to 1,998 sample of Chinese The coding region variation non-synonymous of 27,089 (existing in > 1 sample) out.Exclude noncoding region variation and MAF < 0.1% Variation, analysis is associated to the variation of 40,491 coding regions.In Qualify Phase and repeated authentication stage, select Sequenom MassARRAY system (Agena Bioscience), QuantStudio^TM12K Flex Real-Time PCR (Applied Biosystems) and 7900HT Fasr Real-Time PCR System (Applied Biosystems) Carry out parting research.Quality Control filter criteria is as follows: excluding not knowing the variation of group, recall rate < 90% and does not meet Hardy- Weinberg equilibrium law (P < 1 × 10^-3), sample recall rate < 95% the case where.

Statistical analysis

In the first stage, the association analysis between phenotype and single mutant gene type is carried out by GMMAT-v0.7.? Second and third stage is analyzed by SNPs being associated property of the linear regression model (LRM) in PLINK to MAF > 1%, utilizes PLINK Middle Fisher's exact propability is associated analysis to the SNPs of MAF < 1%.(pass through META- using fixed effect model V7.0 software uses inverse variance method to the SNPs of MAF>1%, is divided using z- statistic combined method the SNPs of MAF<1% Analysis).Meta analysis is carried out to the data that discovery phase, Qualify Phase, repeated authentication stage three parts combine.Meet simultaneously p<1.23×10^-6(0.05/40,491) variation is the variation of statistically significant exon group.For second and third rank The association analysis of section, p < 0.05 and the variation with discovery phase with same effect are the site with statistical significance.Benefit The heterogeneity of independent sample is analyzed with Cochran ' s Q inspection, p < 0.05 is thought with statistical significance.

The analysis of exon group discovery phase

Parting is carried out to 273,028 variant sites of 1,670 lepers and 2,321 normal controls.Pass through master Constituent analysis determines that all samples are of Chinese origin, and it was found that has preferable gene in leper and normal control The matching of type.By a series of filtering of samples and variant sites, the code area variation position of 40,491 MAF > 0.1% is found altogether Point (38,068 nonsynonymous mutations and 2,423 same sense mutations), after by it in 1,648 leper and 2,318 health It is analyzed in control.

Full exon analysis discovery has stronger relevance in the region MHC.Remove all variant sites in the region MHC Afterwards, the Q-Q icon of remaining SNP site closes zero cloth, shows exon association analysis result caused by crowd's Confounding Factor Possibility is preferably minimized (lambda value=0.99).Meanwhile to different MAF threshold values (MAF > 0.5%, MAF > 1% and MAF > 5%) SNP site carries out the analysis of Q-Q figure, consistent with the above results.

By the study found that relevant property (P < 1.0 × 10 of five prompts^-3) coding region variant sites (four often See variation and a low frequency variation) it is also included in the site for the GWAS discovery reported before.Four common variant sites are therewith The SNP site of preceding report has stronger linkage disequilibrium, and only low frequency variation (IL-23R gene rs76418789) is independent. In addition, the Q-Q figure of (SNP site in the removal region MHC) the tail end distribution of Q-Q figure and standard zero distribution there are deviation, shows exist New association site, has the variant sites in 38 new coding regions to be found to have relevance (P < 1.0 × 10^-3)。

For the effect for further studying low frequency variation and rare variation, pass through the method pair of SKAT-O and berden-test Exclude the variant sites and 38 new coding regions of 5 coding regions in the variant sites and known site in the region MHC Interior variant sites (P < 1.0 × 10^-3) after SNP site analyzed.Two methods prove that gene association is not accidental.

Qualify Phase analysis

To 38 newfound volumes in 3,169 lepers and 9,814 normal healthy controls in north of China region The variant sites in one low frequency coding region of the variant sites in code region and GWAS discovery before carry out parting.There are 34 variations Site can succeed parting, wherein 15 sites are consistent in discovery phase and Qualify Phase (in Qualify Phase, P < 0.05, OR The effect of value is consistent with discovery phase), 6 sites all have the statistics of exon group analysis in discovery phase and Qualify Phase Meaning (P < 1.23 × 10^-6) and there is no genetic heterogeneity, this 6 sites are respectively as follows: NCKIPSD gene rs145562243 (P= 1.44×10^-8, OR=4.35), (P=4.99 × 10 CARD9 gene rs149308743^-10, OR=4.75), IL23R gene (P=6.28 × 10 rs76418789^-9, OR=1.37), (P=1.44 × 10 FLG gene rs146466242^-10, OR=1.45), (P=2.89 × 10 SLC29A3 gene rs780668^-7, OR=1.14) and (P=5.92 × 10 IL27 gene rs181206^-7,OR =0.83) (table 3).

In addition, the variant sites of two coding regions: (P=2.75 × 10 TYK2 gene rs55882956^-5, OR=1.29) With (P=3.45 × 10 USP49 gene rs75746803^-6, OR=1.28) and it is all had in discovery phase and Qualify Phase with leprosy Consistency and relevance, but only just reached statistical significance (P < 5.0 × 10 of exon group analysis^-5) (table 3).

Wherein, to rs145562243, rs149308743, rs76418789, rs146466242, rs55882956, Rs780668 and rs181206 parting uses Sequenom MassARRAY system (Agena Bioscience), QuantStudio^TM12K Flex Real-Time PCR (Applied Biosystems) and 7900HT Fasr Real- Time PCR System (Applied Biosystems) is carried out, and the specific method is as follows:

1.rs181206, rs780668, rs76418789, rs149308743, rs145562243 and rs55882956's Parting

Rs181206, rs780668, rs76418789, rs149308743, rs145562243 and rs55882956 this 6 SNP application SEQUENOM genotyping platform isMolecular weight array technique, SequenomDetection process combination multiple PCR technique, MassARRAY iPLEX Single base extension technology and matrix are auxiliary Help laser desorption ionization flying time mass spectrum analysis mass-spectrometric technique (matrix-assisted laser desorption/ Ionization-time of flight, MALDI-TOF) carry out parting detection.DNA profiling comprising SNP site region is led to Round pcr amplification is crossed, special extension primer and PCR product (table 2) is reused and carries out single base extension.Due to polymorphism Site base is different, and the different terminal bases of extension products will lead to the difference of the molecular weight of product after extending, therefore more by SNP Base difference caused by state property is embodied by the difference of molecular weight, passes through matrix solid-dispersion flight time matter Spectrum analysis mass-spectrometric technique detects the size of extension products molecular weight, the analysis software of application specific, by the difference for judging molecular weight It is different and carry out SNP

Parting detection.

2,6 SNP serotype specific primers of table

Operating procedure is as follows:

6 SNP use Sequenom MassArray (San Diego, USA) platform validation, and each sample is about used 15ngDNA.The genomic DNA for extracting peripheral blood first, after standardization, sample DNA includes SNP through multi-PRC reaction amplification Genomic DNA fragment including point, amplified production carry out the extension of the single chain of SNP site specificity, and extension products desalination simultaneously turns It moves on on the chip in 384 holes.Mass spectrograph (MALDI-TOF MS) carries out the detection of allele, using Sequenom MassARRAY parting software analyzes testing result.

1.1, whole blood sample acquires

Research object peripheric venous blood 5ml is acquired in informed consent and in the case where signing written consent form, is placed in EDTANa₂In anticoagulant tube, sets -80 DEG C of refrigerator-freezers and store for future use.

1.2, DNA concentration standardization includes the following steps:

1) using NanoDrop-1000 concentration tester Accurate Determining it is every it is a need standardized sample DNA concentration and OD ratio (A260/A280, A260/A230).

2) electrical form is established, the DNA number that each sample aperture that is ranked needs to be added.

The sample of Sequenom MassArray parting is carried out, there are blank controls and repeated sample pair on every 96 orifice plate According to.

3) according to the sequence of electrical form, the DNA for having measured concentration is added.

For carry out Sequenom MassArray parting sample require experimental concentration be 12-30ng/ μ l, generally with 18ng/ μ l is preferred.And A260/A280 ratio is between 1.5-2.0, A260/230 is between 1.5-2.3, such as DNA concentration height Appropriate FG3 is then added in 18ng/ μ l, by concentration mark to 18ng/ μ l；If DNA concentration is lower than 12ng/ μ l, then again from blood Extract qualified DNA.Concentration is directly added between 12-18ng/ μ l.

Sticky masking foil is sticked after centrifugation, and puts on the information such as sample plate mark, sample type, source place with marker pen.

4) on plate centrifuge, 3000g be centrifuged 3 minutes, deposit in -20 DEG C it is spare.

1.3, multiplex PCR is carried out using the forward primer and reverse primer of each SNP

1.4, the extension of the single chain of SNP site specificity

Wherein, extension primer is designed according to SNP site upstream in human genome (not including the SNP site), the extension Last 1 nucleotide of primer corresponds to preceding 1 nucleotide of the SNP site in human genome.

1.5, data quality control

1) call rate calculating is carried out to the SNP of parting, remove call rate < 95% SNP or gene frequency < 0.01 SNPs；

2) genetic equilibrium inspection is carried out to SNP, removal deviates the SNP (Hardy- in check sample of the law of genetic equilibrium P≤0.001 of Weinberg balance check).

3) the parting dendrogram of SNP is checked in Sequenom MassArray system, removal dendrogram stacking is unclear SNP。

4) sample Quality Control: the directly sample of removal parting failure.

It will be for statistical analysis by the sample of Quality Control and SNP.

1.6, data statistic analysis

Succeeded using 1.07 software of Plink to parting and the SNP for passing through Quality Control does gene phenotype in case group and control group Correlation analysis is examined the genotype of each sample and the relevance of phenotype with Cochran-Armitage trend, is then used The genotype of all samples of Cochran-Mantel-Haenszel comprehensive analysis and the correlation of phenotype.It is evaluated with Q inspection a Heterogeneity between body, this experiment in, using p < 0.05 as inspection level.Multiple logistic regression analysis is used for detection zone The independence of interior signal.Inspection level α using 0.05 divided by the SNP number controlled by quality as inspection level.Q inspection is used for The conspicuousness for assessing genetic heterogeneity, being considered as to P value after SNP correction detection less than 0.05 has significant genetic heterogeneity.

The parting of 2.rs146466242

Rs146466242 application 7900HT/Taqman genotyping system carries out SNP parting.

Primer and probe sequence are as follows:

Forward primer rs146466242-F:CCACATAAACCTGGGTCCTTATTAA (sequence 19)

Reverse primer rs146466242-R:GGAAAGATCTGATATCTGTAAAGCAAGTG (sequence 20)

Probe 1rs146466242-P1:CTTGGATGATCTTTAC (sequence 21), 5 ' ends are marked by reporter fluorescence dyestuff FAM Note, 3 ' ends are marked by quencher fluorescent dye NFQ

Probe 2rs146466242-P2:CTTGGATGATCTTAAC (sequence 22), 5 ' ends are marked by reporter fluorescence dyestuff VIC Note, 3 ' ends are marked by quencher fluorescent dye NFQ

Operating procedure is as follows:

The peripheric venous blood 5ml of each object is extracted respectively, extracts genomic DNA, (DNA concentration is equal for genomic DNA respectively Between 50-100ng/ microlitres).

The reaction system of real-time fluorescence quantitative PCR reaction are as follows: 1 μ L of genomic DNA, 2 × TaqMan GT master mix (Life technology company) 2.5 μ L, 20 × TaqMan probe mixture, 0.65 μ L, 0.85 μ L of deionized water.It will be above-mentioned anti- Answer system be added 96 hole PCR plates in, using 7900 real-time fluorescence quantitative PCR instrument of ABI (Applied Biosystems company) into Row reaction.Reaction condition are as follows: 95 DEG C are denaturalized 30 seconds, and 60 DEG C are annealed 1 minute, 40 circulations.

In above-mentioned reaction system, 20 × TaqMan probe mixture is including expanding the gene including rs146466242 Group DNA fragmentation PCR primer to complete probe, wherein PCR primer is formed to by above-mentioned forward primer and reverse primer, complete Probe is made of probe 1 and probe 2.

After reaction, genotyping is carried out using 7900System SDS software, determines each research object The genotype in the site rs146466242.

Repeated authentication analysis

In order to further verify 8 variant sites non-synonymous (6 exon group analysis have statistical significance site and 2 prompts may relevant site) whether there is relevance, and three independent samples totally 2,231 are chosen in southern china region Example leper and 2,266 normal controls.Then all samples (7,048 cases and 14,398 normal healthy controls) are carried out Parting, wherein to rs145562243, rs149308743, rs76418789, rs146466242, rs55882956, The same Qualify Phase of specific method that rs780668 and rs181206 parting uses.

Then meta is carried out to all samples (7,048 cases and 14,398 normal healthy controls) using fixed effect model Analysis.7 encoding mutants show that the consistency in three phases is associated with, and have without heterogeneous evidence, and in all samples Significant difference (P < 0.05/40,491=1.23 × 10 of exon^-6): two rare mutation, positioned at 3p21.31's NCKIPSD gene rs145562243 (MAF=0.4%, P=1.71 × 10^-9, OR=4.35) and positioned at 9q34.3 CARD9 base Because of rs149308743 (MAF=0.5%, P=2.09 × 10^-8, OR=4.75)；Three low frequency variations, positioned at 1p31.3's IL23R gene rs76418789 (MAF=4.32%, P=1.03 × 10^-10, OR=1.36), positioned at the FLG gene of 1q21.3 Rs146466242 (MAF=3.54%, P=3.39 × 10^-12, OR=1.45) and positioned at 19p13.2 TYK2 gene Rs55882956 (MAF=3.63%, P=1.04 × 10^-6, OR=1.30)；Two common variations, positioned at 10q22.1's SLC29A3 gene rs780668 (MAF=42%, P=2.17 × 10^-9, OR=1.14) and positioned at 16p11.2 IL27 gene Rs181206 (MAF=15%, P=1.08 × 10^-7, OR=0.83).Although being located in all independence sample analyses The USP49 gene rs75746803 of 6p21.1 shows consistency, but the site is lower than exon significance (MAF= 4.8%, P=3.57 × 10^-6, OR=1.25) and (table 3 and Fig. 1).

7 SNP are in the genotype frequency in 7048 lepers and 14398 normal controls as shown in table 4 and table 5. The result shows that: in three genotype of rs145562243, ratio of the individual in leper group of TC genotype is higher than pair Ratio of the individual for the genotype answered in normal person group, ratio of the individual of CC genotype in leper group are lower than Ratio of the individual of the genotype in normal person group；

In three genotype of rs149308743, ratio of the individual in leper group of TC genotype is higher than pair Ratio of the individual for the genotype answered in normal person group, ratio of the individual of CC genotype in leper group are lower than Ratio of the individual of the genotype in normal person group；

In three genotype of rs76418789, the individual of AA genotype and the individual of AG genotype are in leper group In ratio be respectively higher than ratio of the individual in normal person group of corresponding genotype, the individual of GG genotype is suffered from leprosy Ratio in person group is lower than ratio of the individual of the genotype in normal person group；

In three genotype of rs146466242, the individual of AA genotype and the individual of AT genotype are in leper group Ratio in body is respectively higher than ratio of the individual of corresponding genotype in normal person group, and the individual of TT genotype is in leprosy Ratio in PATIENT POPULATION is lower than ratio of the individual of the genotype in normal person group；

In three genotype of rs55882956, the individual of AA genotype and the individual of AG genotype are in leper group In ratio be respectively higher than ratio of the individual in normal person group of corresponding genotype, the individual of GG genotype is suffered from leprosy Ratio in person group is lower than ratio of the individual of the genotype in normal person group；

In three genotype of rs780668, the individual of TT genotype and the individual of TC genotype are in leper group Ratio be respectively higher than ratio of the individual in normal person group of corresponding genotype, the individual of CC genotype is in leper Ratio in group is lower than ratio of the individual of the genotype in normal person group；

In three genotype of rs181206, ratio of the individual of AA genotype in leper group is higher than corresponding Ratio of the individual of ratio of the individual of genotype in normal person group, GG genotype and AG genotype in leper group Ratio of the individual of the respectively lower than corresponding genotype of example in normal person group.

The genotype individuals number of table 4, SNP in leper and normal population

The genotype frequency of table 5, SNP in leper and normal population

The gene frequency (%) of table 6, SNP in leper group and variable quantity compared with the control

It infuses in table 4 and table 5, in the genotype of rs145562243, A1*A1 indicates that CC, A1*A2 indicate that TC, A2*A2 are indicated TT；

In the genotype of rs149308743, A1*A1 indicates that CC, A1*A2 indicate that TC, A2*A2 indicate TT；

In the genotype of rs76418789, A1*A1 indicates that AA, A1*A2 indicate that AG, A2*A2 indicate GG；

In the genotype of rs146466242, A1*A1 indicates that AA, A1*A2 indicate that AT, A2*A2 indicate TT；

In the genotype of rs55882956, A1*A1 indicates that AA, A1*A2 indicate that AG, A2*A2 indicate GG；

In the genotype of rs780668, A1*A1 indicates that TT, A1*A2 indicate that TC, A2*A2 indicate CC；

In the genotype of rs181206, A1*A1 indicates that GG, A1*A2 indicate that AG, A2*A2 indicate AA.

Leper group and normal is calculated using the logistic regression model (log-additive model) of two classification Gene frequency difference P value in crowd's body, determining SNP, whether there is or not significants, and wherein genotype is united using additive models Meter.As a result, it has been found that rs145562243, rs149308743, rs76418789, rs146466242, rs55882956, The gene frequency of each allele of rs780668 and rs181206 has significantly in normal person group and leper group Sex differernce.

As shown in Table 6, the risk allele of rs145562243 is T, gene frequency of the allele in leper Rate is 0.0039, and the gene frequency in normal control is 0.0004, and compared with normal control, the allele is in leper In increase 875.00%；The risk allele of rs149308743 is T, gene frequency of the allele in leper Rate is 0.0055, and the gene frequency in normal control is 0.0006, and compared with normal control, the allele is in leper In increase 816.67%；The risk allele of rs76418789 is A, gene frequency of the allele in leper It is 0.0610, the gene frequency in normal control is 0.0432, and compared with normal control, the allele is in leper Increase 41.20%；The risk allele of rs146466242 is A, and gene frequency of the allele in leper is 0.0558, the gene frequency in normal control is 0.0354, and compared with normal control, which increases in leper Add 57.63%；The risk allele of rs55882956 is A, and gene frequency of the allele in leper is 0.0529, the gene frequency in normal control is 0.0363, and compared with normal control, which increases in leper Add 45.73%；The risk allele of rs780668 is T, and gene frequency of the allele in leper is 0.4648, the gene frequency in normal control is 0.4213, and compared with normal control, which increases in leper Add 10.33%；The risk allele of rs181206 is A, and gene frequency of the allele in leper is 0.8829, the gene frequency in normal control is 0.8503, and compared with normal control, which increases in leper Add 3.83%.

The experimental results showed that rs145562243, rs149308743, rs76418789, rs146466242, The polymorphism or genotype or gene frequency of rs55882956, rs780668 and rs181206 can be used for the sieve of leper It looks into.

In addition, analyzing the shadow of age and sex ratio by carrying out joint survey to age in sample and gender information It rings.(age and gender) unadjusted and adjusted closely similar (table of ORs in two common mutations and three low frequency mutation SNPs 7) in the association analysis for, disclosing these SNPs, there are lesser effect at gender and age.

The analysis result that table 7, gender and age influence two common mutations and three low frequency mutation SNP

Secondary allele/main allele；

OR, OR are calculated according to inferior for gene；

(f) refer to fixed-effect model.

<110>Shandong Dermatopathy Cypridopathy Prevention and Cure Institute

<160> 22

<170> PatentIn version 3.5

<210> 1

<211> 30

<212> DNA

<213>artificial sequence

<220>

<223>

<400> 1

acgttggatg accactccca gaggccatca 30

<210> 2

<211> 29

<212> DNA

<213>artificial sequence

<220>

<223>

<400> 2

acgttggatg ttcccagatc ccaccacag 29

<210> 3

<211> 17

<212> DNA

<213>artificial sequence

<220>

<223>

<400> 3

ttcaccacag cctcgcc 17

<210> 4

<211> 30

<212> DNA

<213>artificial sequence

<220>

<223>

<400> 4

acgttggatg cctgcggtag ttctcaaaac 30

<210> 5

<211> 29

<212> DNA

<213>artificial sequence

<220>

<223>

<400> 5

acgttggatg ttcccccttc tccaggacg 29

<210> 6

<211> 20

<212> DNA

<213>artificial sequence

<220>

<223>

<400> 6

gctcaaaact ctctttgagg 20

<210> 7

<211> 30

<212> DNA

<213>artificial sequence

<220>

<223>

<400> 7

acgttggatg tcaggcaaca tgacttgcac 30

<210> 8

<211> 30

<212> DNA

<213>artificial sequence

<220>

<223>

<400> 8

acgttggatg gaggaagtga cctacctctt 30

<210> 9

<211> 18

<212> DNA

<213>artificial sequence

<220>

<223>

<400> 9

ctatgtaggt gagcttcc 18

<210> 10

<211> 30

<212> DNA

<213>artificial sequence

<220>

<223>

<400> 10

acgttggatg atcttccaag ccatgggcac 30

<210> 11

<211> 30

<212> DNA

<213>artificial sequence

<220>

<223>

<400> 11

acgttggatg tggtgacaga gtacgtggag 30

<210> 12

<211> 20

<212> DNA

<213>artificial sequence

<220>

<223>

<400> 12

atgtttggct gcggagggag 20

<210> 13

<211> 30

<212> DNA

<213>artificial sequence

<220>

<223>

<400> 13

acgttggatg gccatcttca tggtgataac 30

<210> 14

<211> 30

<212> DNA

<213>artificial sequence

<220>

<223>

<400> 14

acgttggatg tgaggatcac catgcagaca 30

<210> 15

<211> 16

<212> DNA

<213>artificial sequence

<220>

<223>

<400> 15

gtgaaggtgg acactt 16

<210> 16

<211> 28

<212> DNA

<213>artificial sequence

<220>

<223>

<400> 16

acgttggatg ccctgggtcc ccagccct 28

<210> 17

<211> 30

<212> DNA

<213>artificial sequence

<220>

<223>

<400> 17

acgttggatg gagcgtctct gcttcatctc 30

<210> 18

<211> 15

<212> DNA

<213>artificial sequence

<220>

<223>

<400> 18

agcccttcca tgccc 15

<210> 19

<211> 25

<212> DNA

<213>artificial sequence

<220>

<223>

<400> 19

ccacataaac ctgggtcctt attaa 25

<210> 20

<211> 29

<212> DNA

<213>artificial sequence

<220>

<223>

<400> 20

ggaaagatct gatatctgta aagcaagtg 29

<210> 21

<211> 16

<212> DNA

<213>artificial sequence

<220>

<223>

<400> 21

cttggatgat ctttac 16

<210> 22

<211> 16

<212> DNA

<213>artificial sequence

<220>

<223>

<400> 22

cttggatgat cttaac 16

Claims (4)

1. detecting the substance of the polymorphism or genotype of rs149308743 in human genome in preparation screening leper product Application；

It includes rs149308743 that the substance of the polymorphism or genotype of rs149308743, which is amplification, in the detection human genome The PCR primer and Single base extension primer of genomic DNA fragment inside；

The PCR primer is made of rs149308743-F and rs149308743-R；

The rs149308743-F is single stranded DNA shown in sequence 4 in sequence table；

The rs149308743-R is single stranded DNA shown in sequence 5 in sequence table；

The Single base extension primer is single stranded DNA shown in sequence 6 in sequence table；

The rs149308743 genotype is CC, TC or TT；The CC is that the site rs149308743 is the homozygous of C, described TT is that the site rs149308743 is the homozygous of T, and the TC is the heterozygous that the site rs149308743 is C and T；TC genotype Individual be higher than ratio of the individual in normal person group of corresponding genotype, CC gene in the ratio in leper group The individual of type is in individual ratio in normal person group of the ratio in leper group lower than the genotype.

2. the substance for detecting the polymorphism or genotype of rs149308743 in human genome detects vulnerability to leprosy product in preparation In application；The substance of the polymorphism or genotype of rs149308743 is that amplification includes in the detection human genome The PCR primer and Single base extension primer of genomic DNA fragment including rs149308743；

The PCR primer is made of rs149308743-F and rs149308743-R；

The rs149308743-F is single stranded DNA shown in sequence 4 in sequence table；

The rs149308743-R is single stranded DNA shown in sequence 5 in sequence table；

The Single base extension primer is single stranded DNA shown in sequence 6 in sequence table；

The rs149308743 genotype is CC, TC or TT；The CC is that the site rs149308743 is the homozygous of C, described TT is that the site rs149308743 is the homozygous of T, and the TC is the heterozygous that the site rs149308743 is C and T；TC genotype Individual be higher than ratio of the individual in normal person group of corresponding genotype, CC gene in the ratio in leper group The individual of type is in individual ratio in normal person group of the ratio in leper group lower than the genotype.

3. the substance for detecting the polymorphism or genotype of rs149308743 in human genome detects list relevant to leprosy in preparation Application in the product of nucleotide polymorphisms；

It includes rs149308743 that the substance of the polymorphism or genotype of rs149308743, which is amplification, in the detection human genome The PCR primer and Single base extension primer of genomic DNA fragment inside；

The PCR primer is made of rs149308743-F and rs149308743-R；

The rs149308743-F is single stranded DNA shown in sequence 4 in sequence table；

The rs149308743-R is single stranded DNA shown in sequence 5 in sequence table；

The Single base extension primer is single stranded DNA shown in sequence 6 in sequence table；

The rs149308743 genotype is CC, TC or TT；The CC is that the site rs149308743 is the homozygous of C, described TT is that the site rs149308743 is the homozygous of T, and the TC is the heterozygous that the site rs149308743 is C and T；TC genotype Individual be higher than ratio of the individual in normal person group of corresponding genotype, CC gene in the ratio in leper group The individual of type is in individual ratio in normal person group of the ratio in leper group lower than the genotype.

4. detecting the substance of the polymorphism or genotype of rs149308743 in human genome in preparation identification or auxiliary identification and fiber crops Application in the product of the relevant single nucleotide polymorphism of wind；

It includes rs149308743 that the substance of the polymorphism or genotype of rs149308743, which is amplification, in the detection human genome The PCR primer Single base extension primer of genomic DNA fragment inside；

The PCR primer is made of rs149308743-F and rs149308743-R；

The rs149308743-F is single stranded DNA shown in sequence 4 in sequence table；

The rs149308743-R is single stranded DNA shown in sequence 5 in sequence table；

The Single base extension primer is single stranded DNA shown in sequence 6 in sequence table；

The rs149308743 genotype is CC, TC or TT；The CC is that the site rs149308743 is the homozygous of C, described TT is that the site rs149308743 is the homozygous of T, and the TC is the heterozygous that the site rs149308743 is C and T；TC genotype Individual be higher than ratio of the individual in normal person group of corresponding genotype, CC gene in the ratio in leper group The individual of type is in individual ratio in normal person group of the ratio in leper group lower than the genotype.