CN107287342B - Application of the mononucleotide polymorphism site rs3129716 in screening dermatitis herpetiformis patient - Google Patents
Application of the mononucleotide polymorphism site rs3129716 in screening dermatitis herpetiformis patient Download PDFInfo
- Publication number
- CN107287342B CN107287342B CN201710722584.7A CN201710722584A CN107287342B CN 107287342 B CN107287342 B CN 107287342B CN 201710722584 A CN201710722584 A CN 201710722584A CN 107287342 B CN107287342 B CN 107287342B
- Authority
- CN
- China
- Prior art keywords
- genotype
- sequence
- polymorphism
- dermatitis herpetiformis
- site
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Pathology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses application of the mononucleotide polymorphism site rs3129716 in screening dermatitis herpetiformis patient.The technical solution that the present invention is protected is to detect the substance application of the polymorphism of rs3129716 or the substance of genotype in the product that preparation detects single nucleotide polymorphism relevant to dermatitis herpetiformis in preparing application and detection human genome in screening dermatitis herpetiformis patient product of the polymorphism or genotype of rs3129716 in human genome.The substance of polymorphism or genotype that rs3129716 can be will test is united screening dermatitis herpetiformis patient to other materials (substance as detected other single nucleotide polymorphism relevant with dermatitis herpetiformis or genotype).
Description
Technical field
The present invention relates in field of biotechnology, mononucleotide polymorphism site rs3129716 is in screening dermatitis herpetiformis
Application in patient.
Background technique
Dermatitis herpetiformis (Dermatitis herpetiformis, DH) is that a kind of one kind caused by gluten intake is lacked
The autoimmune bullous diseases seen are mainly characterized by the deposition of pruritic multiform skin lesion and papilla IgA.Closely
Come, DH is considered as the specific skin performance of coeliac disease, the reason is that there is circulation IgA antibody, epidermises to turn for DH patient's body
Glutamine enzyme antibody and the typical histologic characteristics similar with intestinal villi atrophy.In different crowds, the morbidity of DH
Rate and prevalence rate difference.Wherein, DH is relatively conventional in white people, and rarer in asian population.For of Chinese origin
Crowd only reports some Sporadic cases in China's Mainland, Hong Kong and Singapore.
The heredity of DH is recognized well not yet, but reported HLA I class and II class in multiple crowds
Molecule research shows that the genetic predisposition of DH.The case-control study of DH patient's early stage shows DH and HLA-B8,
DR3, it is closely related with DQw2.In clone's grace disease of white race crowd, the patient more than 90% has HLA-DQ2 haplotype,
Remaining most of expression HLA-DQ8, NODMouse model confirms this association.Opposite, the document studied before is
The apparent difference of white people and Asian DH are disclosed, this difference perhaps can be by HLA-B8/ occur in Japanese population
DR3/DQ2 haplotype is explained.So far, an only genetics research about Chinese population DH finds HLA-
B*0801 and HLA-DRB1*0301 may be the relevant risks and assumptions of dermatitis herpetiformis, but not provide reliable detection method
Predict the risk that DH occurs.
Summary of the invention
The technical problem to be solved by the present invention is to how screening dermatitis herpetiformis patient and detection dermatitis herpetiformis it is susceptible
Property.
In order to solve the above technical problems, present invention firstly provides following As 1)-B6) at least one of purposes:
A1 the substance for) detecting the polymorphism (i.e. allele) or genotype of rs3129716 in human genome is sieved in preparation
Look into the application in dermatitis herpetiformis patient product；
A2 the substance for) detecting the polymorphism (i.e. allele) or genotype of rs3129716 in human genome is examined in preparation
Survey the application in dermatitis herpetiformis neurological susceptibility product；
A3 the substance for) detecting the polymorphism (i.e. allele) or genotype of rs3129716 in human genome is examined in preparation
Survey the application in the product of single nucleotide polymorphism relevant to dermatitis herpetiformis；
A4 the substance for) detecting the polymorphism (i.e. allele) or genotype of rs3129716 in human genome reflects in preparation
Fixed or auxiliary identifies the application in the product of single nucleotide polymorphism relevant to dermatitis herpetiformis；
A5) polymorphism (i.e. allele) or genotype of rs3129716 are preparing screening bleb sample skin in human genome
Application in scorching patient product；
A6) polymorphism (i.e. allele) or genotype of rs3129716 detect bleb sample skin in preparation in human genome
Application in scorching neurological susceptibility product；
B1) detect human genome in rs3129716 polymorphism (i.e. allele) or genotype substance in screening blister
Application in rash sample dermatitis patients；
B2 the substance of the polymorphism (i.e. allele) or genotype of rs3129716 in human genome) is detected in detection blister
Application in rash sample dermatitis neurological susceptibility；
B3) detect human genome in rs3129716 polymorphism (i.e. allele) or genotype substance detection with
Application in the relevant single nucleotide polymorphism of dermatitis herpetiformis；
B4) detect human genome in rs3129716 polymorphism (i.e. allele) or genotype substance identification or
Auxiliary identifies the application in single nucleotide polymorphism relevant to dermatitis herpetiformis；
B5) polymorphism (i.e. allele) or genotype of rs3129716 are suffered from screening dermatitis herpetiformis in human genome
Application in person；
B6) polymorphism (i.e. allele) or genotype of rs3129716 are easy in detection dermatitis herpetiformis in human genome
The polymorphism (i.e. allele) of application in perception or the substance of genotype detect dermatitis herpetiformis neurological susceptibility product in preparation
In application.
Rs3129716 is the SNP site of a two equipotential polymorphisms on human chromosome 6p21.32, which is conversion
(C/T is then G/A on its complementary strand).The rs3129716 genotype is CC, CT or TT.The CC is rs3129716
Point is the homozygous of C, and the TT is that the site rs3129716 is the homozygous of T, and the CT is that the site rs3129716 is C and T
Heterozygous.The polymorphism (i.e. allele) or genotype of rs3129716 concretely detects in the detection human genome
The nucleotide type of rs3129716.
In such use, the substance of the polymorphism or genotype of rs3129716 can be amplification in the detection human genome
The PCR primer pair and/or Single base extension primer of genomic DNA fragment including rs3129716.
In such use, ratio difference of the individual of the CC and the CT genotype in dermatitis herpetiformis PATIENT POPULATION
Higher than ratio of the corresponding genotype in normal person group.
In such use, the dermatitis herpetiformis concretely Chinese population dermatitis herpetiformis.
In order to solve the above technical problems, the present invention also provides the polymorphisms containing rs3129716 in detection human genome
Or the product of the substance of genotype, the product are a)-d) in any product:
A) product of single nucleotide polymorphism (i.e. allele) relevant to dermatitis herpetiformis or genotype is detected；
B) it identifies or assists to identify single nucleotide polymorphism (i.e. allele) relevant to dermatitis herpetiformis or genotype
Product；
C) screening dermatitis herpetiformis patient product；
D) dermatitis herpetiformis neurological susceptibility product is detected.
In the said goods, the substance of the polymorphism or genotype of rs3129716 can be amplification in the detection human genome
The PCR primer pair and/or Single base extension primer of genomic DNA fragment including rs3129716.
In the said goods, the dermatitis herpetiformis concretely Chinese population dermatitis herpetiformis.
In order to solve the above technical problems, the present invention also provides following M1) or method M2):
M1) the method for screening dermatitis herpetiformis patient, comprising: detect the site rs3129716 in object genome to be measured
Genotype, if the genotype in the site rs3129716 is CC genotype, the object to be measured is or candidate is that dermatitis herpetiformis is suffered from
Person；If the genotype in the site rs3129716 is CT genotype, the object to be measured is or candidate is dermatitis herpetiformis patient；Such as
The genotype in the site rs3129716 is TT genotype, and the object to be measured is or candidate is or non-dermatitis herpetiformis patient；
M2 the method for dermatitis herpetiformis neurological susceptibility) is detected, comprising: detect the site rs3129716 in object genome to be measured
Genotype, if the genotype in the site rs3129716 is CC genotype, the object to be measured is susceptible or candidate susceptible bleb sample skin
It is scorching；If the genotype in the site rs3129716 is CT genotype, the object to be measured is susceptible or candidate susceptible dermatitis herpetiformis；Such as
The genotype in the site rs3129716 is TT genotype, and the object to be measured is susceptible or candidate not susceptible dermatitis herpetiformis.
In the above method, the detection is can be used in the genotype for detecting the site rs3129716 in object genome to be measured
The polymorphism of rs3129716 or the substance of genotype carry out.
In the above method, the dermatitis herpetiformis concretely Chinese population dermatitis herpetiformis.
It is demonstrated experimentally that the risk allele of rs3129716 is C, the allele is in dermatitis herpetiformis PATIENT POPULATION
Ratio be significantly higher than ratio of the allele in normal health crowd.The P value of rs3129716 is 2.10 × 10-13, and
The relative risk of rs3129716 is 9.7, illustrates that rs3129716 is single nucleotide polymorphism relevant to dermatitis herpetiformis.
In three genotype of rs3129716, ratio of the individual of CT genotype in dermatitis herpetiformis PATIENT POPULATION is higher than the gene
Ratio of the individual of type in normal person group, ratio of the individual of TT genotype in dermatitis herpetiformis PATIENT POPULATION is lower than should
Ratio of the individual of genotype in normal person group.
The present invention in practical applications, can will test the polymorphism (i.e. allele) of rs3129716 or the object of genotype
Matter is combined to other materials (substance as detected other single nucleotide polymorphism relevant with dermatitis herpetiformis or genotype)
The product of screening dermatitis herpetiformis patient is prepared together.
Wherein, the substance for detecting the polymorphism or genotype of rs3129716 in human genome can be to pass through following at least one
Reagent and/or instrument needed for kind method determines the polymorphism or genotype of rs3129716: DNA sequencing, restriction fragment
Length polymorphism, single-strand conformation polymorphism, denaturing high-performance chromatography, SNP chip, TaqMan probe technology and Sequenom
MassArray technology.Wherein, polymorphism or the genotype institute of rs3129716 are determined using Sequenom MassArray technology
The reagent and/or instrument needed include PCR primer to, the extension primer based on single base extension, phosphatase, resin, chip,
MALDI-TOF (matrix-assisted laser desorption/ionization-time of fligh, Matrix-assisted
Laser desorption ionization flight time mass spectrum) and/or Sequenom MassArray technology required for other reagents and instrument；
Reagent needed for determining the polymorphism or genotype of rs3129716 using TaqMan probe technology and/or instrument include TaqMan
Probe, PCR primer to, quantitative PCR apparatus, carry out required for the module and/or TaqMan probe technology of Genotyping other and try
Agent；SNP chip includes the chip based on nucleic acid hybridization reaction, the chip based on single base extension, based on allele spy
The chip of specific primer extension, the chip based on primer connection reaction, is based on limitation at the chip based on " one-step method " reaction
Chip, the chip based on protein D NA association reaction and/or the core based on fluorescent molecule DNA association reaction of property inscribe enzyme reaction
Piece.In one embodiment of the invention, that utilize is the Infinium Human Exome BeadChip of Illumina company
Chip.
The product can be reagent or kit, can be also the system being made of reagent or kit and instrument, such as by drawing
The system of object and DNA sequencer composition, the system being made of PCR reagent and DNA sequencing reagent and DNA sequencer, by TaqMan
Probe, PCR primer are to, quantitative PCR apparatus and carry out required for the module and TaqMan probe technology of Genotyping other and try
The system of agent composition, other reagents required for probe, PCR primer pair and Ligase detection reaction (LDR) and instrument group
At system, by PCR primer to, Single base extension primer, chip, PCR instrument, carry out Genotyping module and/or
The system of other reagents required for Sequenom MassArray technology and instrument composition.
Genomic DNA fragment including rs3129716 is expanded using PCR primer, is with obtained pcr amplification product
Template carries out single base extension using Single base extension primer, detects to the sequence of obtained extension products, determines
The polymorphism (i.e. allele) and genotype of rs3129716.The PCR primer does not have particular/special requirement in sequence, as long as energy
The genomic DNA fragment including rs3129716 is amplified, concretely in sequence table shown in sequence 1 and sequence 2
Single stranded DNA.The extension primer is designed according to the upstream rs3129716 in human genome (not including the SNP site), the extension
Last 1 nucleotide of primer corresponds to preceding 1 nucleotide of rs3129716 in human genome.
In the present invention, the PCR primer rs3129716_W1_F and rs3129716_W1_R to can be made of；
The rs3129716_W1_F is following a1) any single stranded DNA into a4):
A1) single stranded DNA shown in sequence 1 in sequence table；
A2) in a1) 5 ' ends and/or 3 ' ends add the single stranded DNA that one or several nucleotide obtain；
A3) and a1) or a2) single stranded DNA that limits with 85% or more identity single stranded DNA；
A4) the single stranded DNA that the single stranded DNA limited under strict conditions with a1) or a2) hybridizes；
The rs3129716_W1_R is following b1) any single stranded DNA into b4):
B1) single stranded DNA shown in sequence 2 in sequence table；
B2) in b1) 5 ' ends and/or 3 ' ends add the single stranded DNA that one or several nucleotide obtain；
B3) and b1) or b2) single stranded DNA that limits with 85% or more identity single stranded DNA；
B4) the single stranded DNA that the single stranded DNA limited under strict conditions with b1) or b2) hybridizes.
The Single base extension primer (rs3129716_W1_E) can be following c1) any single stranded DNA into c4):
C1) single stranded DNA shown in sequence 3 in sequence table；
C2) in c1) 5 ' ends and/or 3 ' ends add the single stranded DNA that one or several nucleotide obtain；
C3) and c1) or c2) single stranded DNA that limits with 85% or more identity single stranded DNA；
C4) the single stranded DNA that the single stranded DNA limited under strict conditions with c1) or c2) hybridizes.
The single stranded DNA that one or several nucleotide of addition obtain can obtain single-stranded for one to ten nucleotide of addition
DNA。
Term " identity " used herein refers to the sequence similarity with native sequence nucleic acid." identity " includes and this hair
Nucleotide sequence shown in bright sequence 1, sequence 2 or sequence 3 has 85% or higher or 90% or higher or 95% or more
The nucleotide sequence of high identity.Identity can with the naked eye or computer software is evaluated.Using computer software, two
Or the identity between multiple sequences can be indicated with percentage (%), can be used to evaluate same between correlated series
Property.
The stringent condition is to hybridize at 68 DEG C in 2 × SSC, the solution of 0.1%SDS and wash film 2 times, every time
5min, but in 0.5 × SSC, the solution of 0.1%SDS, hybridize at 68 DEG C and washes film 2 times, each 15min；Or, 0.1 ×
SSPE (or 0.1 × SSC), 0.1%SDS solution in, hybridize under the conditions of 65 DEG C and wash film.
Above-mentioned 85% or more identity can be 85%, 90% or 95% or more identity.
In an embodiment of the present invention, rs3129716 application SEQUENOM genotyping platform isMolecule
Measure array technique, SequenomSNP detection process combination multiple PCR technique, the mono- alkali of MassARRAY iPLEX
Base elongation technology and matrix solid-dispersion flying time mass spectrum analysis mass-spectrometric technique (matrix-assisted
Laser desorption/ionization-time of flight, MALDI-TOF) carry out parting detection.It will include SNP
The DNA profiling in point region is expanded by round pcr, and it is anti-to reuse special extension primer and PCR product progress Single base extension
It answers.Since polymorphic site base is different, the different terminal bases of extension products will lead to the difference of the molecular weight of product after extending
It is different, therefore the base difference as caused by SNP polymorphism is embodied by the difference of molecular weight, passes through matrix assisted laser desorption ionization
Ionization time of flight mass spectrometry analyzes mass-spectrometric technique, detects the size of extension products molecular weight, and the analysis software of application specific passes through
Judge the difference of molecular weight and carries out SNP parting detection.
Present invention discovery in a sample (36 dermatitis herpetiformis patients and 720 healthy persons) from Chinese population
Rs3129716 is single nucleotide polymorphism relevant to dermatitis herpetiformis.Polymorphism (the i.e. equipotential of rs3129716 can be will test
Gene) or genotype substance and other materials (as detected other single nucleotide polymorphism relevant with dermatitis herpetiformis (i.e.
Allele) or genotype substance) be united preparation screening dermatitis herpetiformis patient product.
Specific embodiment
The present invention is further described in detail With reference to embodiment, and the embodiment provided is only for explaining
The bright present invention, the range being not intended to be limiting of the invention.
Experimental method in following embodiments is unless otherwise specified conventional method.
The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.
Embodiment 1, rs3129716 are single nucleotide polymorphism relevant to dermatitis herpetiformis
Research object
The research pair of whole-genome association (Genome-wide association study, GWAS) discovery phase
As including 24 dermatitis herpetiformis patients (DH patient) and 480 normal controls, Qualify Phase includes that 12 dermatitis herpetiformis are suffered from
Person (DH patient) and 244 normal controls.All research objects are both from Chinese population.
All dermatitis herpetiformis patients of case group meet following 3: 1) clinical characters: the small water of gathering on the basis of erythema
Blister；2) immunologic test includes that the direct immunofluorescence of skin biopsies and the indirect immunofluorescence of plasma sample are confirmed that it is
Dermatitis herpetiformis patient；3) elisa assay is confirmed that it is dermatitis herpetiformis patient.
All normal controls of control group are all confirmed by clinic without autoimmune disease.
All patients are shown in Table 1 with the characteristics of control.Age distribution, sex ratio are in case group and control group without significant
Difference.
The sample clinical data of table 1, researching and designing
Note: NA is indicated without the corresponding course of disease, detection or symptom in table 1.
This research is ratified through Shandong Dermatopathy Cypridopathy Prevention and Cure Institute's Institutional Review Board.All research objects are all
Sign informed consent form.
Sample used is the about 2ml whole blood of every patient, extracts genomic DNA and is used for genotyping.
Discovery phase (first stage)
24 DH patients of discovery phase, 480 normal control applications are covered with the Illumina of 900015 SNPs
Omni Zhonghua chip carries out Genotyping.General gene typing rate < 96% or heterozygote are eliminated in further analysis
Rate is more than the sample (4 objects) of average value ± 3S.D.；It is determining possible by inheriting equivalent assay (IBD) (PI_HAT > 0.25)
Repeated sample or relative's sample be also excluded from.The SNPs for meeting following condition is also excluded from: (i) is not mapped into normal dyeing
Body；(ii) call rate < 90%；(iii)MAF<0.01；(iv) the genotype distribution of SNP and Hardy-Weinberg in control
Predicted value (P < 10 of balance-5) deviate.After carrying out mass filter to sample and SNP, obtained comprising 24 DH patients and
The data set of 43826 common independent SNPs (r2 < 0.1) in 476 controls (comes from by these data and from YRI
Nigeria, the Yorubas of Ibadan；N=90), the CEU (Jew from Northern Europe and West Europe；N=90), CHB (n=45)
PCA analysis is carried out together with the HapMap sample of JPT (n=44), eliminates the sample of 0 exception.Inventor is to remaining disease
Example and check sample have carried out another wheel PCA, and case and control all matchings are fine as the result is shown.By quality control the stage, one
806342 SNPs for sharing 24 DH and 476 controls are included into full-length genome SNP reckoning.Thousand people's groups are based on for those
The benchmark (in March, 2012 publication) of plan and the SNPs of non-parting, inventor using Shapeit (Delaneau et al.,
2013) determine mutually and reckoning with IMPUTE_v2 (Howie et al., 2009).Low reckoning confidence level (score < 0.8 INFO),
Significant Hardy-Weinberg linkage disequilibrium (P < 10-5) or the SNPs of MAF < 5% be excluded from except further analysis.
Finally, 5546030 SNPs in 24 DH and 476 control controls are shared by parting and reckoning in GWAS discovery phase one.
SNP Qualify Phase (second stage)
Inventor has chosen P < 10 in 32 discovery phase association analysis-4SNPs, select 12 in another independent sample
It is verified in the independent sample of example DH patient and 244 normal controls.In 32 SNPs, one shares 21 SNPs by success
Parting, call rate > 90% and without significant HWE deviate (P > 0.0003).
Wherein, the rs3129716 belonged in 21 SNPs be two equipotential polymorphisms on human chromosome 6p21.32
SNP site, the variation be conversion (C/T, on its complementary strand then be G/A), rs3129716 carry out SNP parting the primer
Sequence is as follows:
Rs3129716_W1_F (forward primer): ACGTTGGATGGAAGGTGGATGTATTTTGCC (sequence 1)
Rs3129716_W1_R (reverse primer): ACGTTGGATGGATGCCAGAAATGAGCAACC (sequence 2)
Rs3129716_W1_E (extension primer): CCTCCTACTTTGGGATG (sequence 3)
Rs3129716SNP parting specific steps are as follows:
Using Sequenom MassArray (San Diego, USA) platform validation, each sample about uses 15ngDNA.
The genomic DNA for extracting peripheral blood first, after standardization, sample DNA expands including SNP site through multi-PRC reaction
Genomic DNA fragment, amplified production carry out the extension of the single chain of SNP site specificity, and extension products desalination is simultaneously transferred to 384 holes
Chip on.Mass spectrograph (MALDI-TOF MS) carries out the detection of allele, soft using Sequenom Mass ARRAY parting
Part analyzes testing result.
1, whole blood sample acquires
Research object peripheric venous blood 5ml is acquired in patient's informed consent and in the case where signing written consent form, is placed
In EDTANa2In anticoagulant tube, sets -80 DEG C of refrigerator-freezers and store for future use.
2, DNA concentration standardization includes the following steps:
1) using NanoDrop-1000 concentration tester Accurate Determining it is every it is a need standardized sample DNA concentration and
OD ratio (A260/A280, A260/A230).
2) electrical form is established, the DNA number that each sample aperture that is ranked needs to be added.
The sample of Sequenom MassArray parting is carried out, there are blank controls and repeated sample pair on every 96 orifice plate
According to.
3) according to the sequence of electrical form, the DNA for having measured concentration is added.
For carry out Sequenom MassArray parting sample require experimental concentration be 12-30ng/ μ l, generally with
18ng/ μ l is preferred.And A260/A280 ratio is between 1.5-2.0, A260/230 is between 1.5-2.3, such as DNA concentration height
Appropriate FG3 is then added in 18ng/ μ l, by concentration mark to 18ng/ μ l；If DNA concentration is lower than 12ng/ μ l, then again from blood
Extract qualified DNA.Concentration is directly added between 12-18ng/ μ l.
Sticky masking foil is sticked after centrifugation, and puts on the information such as sample plate mark, sample type, source place with marker pen.
4) on plate centrifuge, 3000g be centrifuged 3 minutes, deposit in -20 DEG C it is spare.
3, PCR is carried out using forward primer and reverse primer.
4, the extension of the single chain of SNP site specificity is carried out using extension primer.
Wherein, extension primer is designed according to SNP site upstream in human genome (not including the SNP site), the extension
Last 1 nucleotide of primer corresponds to preceding 1 nucleotide of the SNP site in human genome.
5, data quality control
1) call rate calculating is carried out to the SNP of parting, remove call rate < 95% SNP or gene frequency <
0.01 SNPs；
2) genetic equilibrium inspection is carried out to SNP, removal deviates the SNP (Hardy- in check sample of the law of genetic equilibrium
P≤0.001 of Weinberg balance check).
3) the parting dendrogram of SNP is checked in Sequenom MassArray system, removal dendrogram stacking is unclear
SNP。
4) sample Quality Control: the directly sample of removal parting failure.
It will be for statistical analysis by the sample of Quality Control and SNP.
6, data statistic analysis
Succeeded using 1.07 software of Plink to parting and the SNP for passing through Quality Control does gene phenotype in case group and control group
Correlation analysis is examined the genotype of each sample and the relevance of phenotype with Cochran-Armitage trend, is then used
The genotype of all samples of Cochran-Mantel-Haenszel comprehensive analysis and the correlation of phenotype.It is evaluated with Q inspection a
Heterogeneity between body, this experiment in, using p < 0.05 as inspection level.Multiple logistic regression analysis is used for detection zone
The independence of interior signal.Inspection level α using 0.05 divided by the SNP number controlled by quality as inspection level.Q inspection is used for
The conspicuousness for assessing genetic heterogeneity, being considered as to P value after SNP correction detection less than 0.05 has significant genetic heterogeneity.
In total 36 dermatitis herpetiformis (DH) patients and 720 normal controls, pass through analysis rs3129716 and bleb
The correlation of sample dermatitis, as a result, it has been found that rs3129716 is risk relevant to dermatitis herpetiformis site, the P value of rs3129716 is
2.10×10-13, OR value is 9.7.
The gene frequency (%) of table 2, SNP in DH patient and normal control group
In table 2, F_A is frequency of the allele A in DH patient, and F_U is frequency of the allele T in DH patient.
As shown in Table 2, in three genotype of rs3129716, ratio of the individual of CT genotype in DH PATIENT POPULATION
Higher than the individual ratio in normal person group of the genotype, ratio of the individual of TT genotype in DH PATIENT POPULATION is lower than
Ratio of the individual of the genotype in normal person group.
The risk allele of rs3129716 is C, and gene frequency of the allele in discovery phase DH patient is
25.0%, the gene frequency in normal control is 3.5%；Gene frequency of the C allele in second stage DH patient be
25.0%, the gene frequency in normal control is 2.9%；Combined analysis finds gene frequency of the C allele in DH patient
Rate is 25.0%, and the gene frequency in normal control is that ratio of 3.3%, the C allele in DH patient is significantly higher than it
Ratio in normal control, significance analysis P value are 2.10E-13, OR 9.7.Retrospective forecast analysis finds that its prediction is quick
Sensitivity is 50.0%, specificity 93.3%.The experimental results showed that rs3129716 polymorphism or genotype or allele frequency
Rate can be used for the screening of DH patient.
<110>Shandong Dermatopathy Cypridopathy Prevention and Cure Institute
<120>application of the mononucleotide polymorphism site rs3129716 in screening dermatitis herpetiformis patient
<160> 3
<170> PatentIn version 3.5
<210> 1
<211> 30
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 1
acgttggatg gaaggtggat gtattttgcc 30
<210> 2
<211> 30
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 2
acgttggatg gatgccagaa atgagcaacc 30
<210> 3
<211> 17
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 3
cctcctactt tgggatg 17
Claims (4)
1. the substance for detecting the polymorphism or genotype of rs3129716 in human genome is produced in preparation screening dermatitis herpetiformis patient
Application in product；The substance of the polymorphism or genotype of rs3129716 is that amplification includes in the detection human genome
The PCR primer of genomic DNA fragment including rs3129716 to and Single base extension primer；
The PCR primer is formed to by rs3129716_W1_F and rs3129716_W1_R；
The rs3129716_W1_F is single stranded DNA shown in sequence 1 in sequence table；
The rs3129716_W1_R is single stranded DNA shown in sequence 2 in sequence table；
The Single base extension primer is single stranded DNA shown in sequence 3 in sequence table；
The rs3129716 genotype is CC, CT or TT；
The CC is that the site rs3129716 is the homozygous of C, and the TT is homozygous, the CT that the site rs3129716 is T
It is the heterozygous that the site rs3129716 is C and T；
The ratio of the CC and the individual of the CT genotype in dermatitis herpetiformis PATIENT POPULATION is respectively higher than corresponding gene
Ratio of the type in normal person group.
2. the substance for detecting the polymorphism or genotype of rs3129716 in human genome detects dermatitis herpetiformis neurological susceptibility in preparation
Application in product；The substance of the polymorphism or genotype of rs3129716 is that amplification includes in the detection human genome
The PCR primer of genomic DNA fragment including rs3129716 to and Single base extension primer；
The PCR primer is formed to by rs3129716_W1_F and rs3129716_W1_R；
The rs3129716_W1_F is single stranded DNA shown in sequence 1 in sequence table；
The rs3129716_W1_R is single stranded DNA shown in sequence 2 in sequence table；
The Single base extension primer is single stranded DNA shown in sequence 3 in sequence table；
The rs3129716 genotype is CC, CT or TT；
The CC is that the site rs3129716 is the homozygous of C, and the TT is homozygous, the CT that the site rs3129716 is T
It is the heterozygous that the site rs3129716 is C and T；
The ratio of the CC and the individual of the CT genotype in dermatitis herpetiformis PATIENT POPULATION is respectively higher than corresponding gene
Ratio of the type in normal person group.
3. the substance for detecting the polymorphism or genotype of rs3129716 in human genome is related to dermatitis herpetiformis in preparation detection
Single nucleotide polymorphism product in application；The polymorphism or genotype of rs3129716 in the detection human genome
Substance be genomic DNA fragment of the amplification including rs3129716 PCR primer to and Single base extension primer；
The PCR primer is formed to by rs3129716_W1_F and rs3129716_W1_R；
The rs3129716_W1_F is single stranded DNA shown in sequence 1 in sequence table；
The rs3129716_W1_R is single stranded DNA shown in sequence 2 in sequence table；
The Single base extension primer is single stranded DNA shown in sequence 3 in sequence table；
The rs3129716 genotype is CC, CT or TT；
The CC is that the site rs3129716 is the homozygous of C, and the TT is homozygous, the CT that the site rs3129716 is T
It is the heterozygous that the site rs3129716 is C and T；
The ratio of the CC and the individual of the CT genotype in dermatitis herpetiformis PATIENT POPULATION is respectively higher than corresponding gene
Ratio of the type in normal person group.
4. detecting the substance of the polymorphism or genotype of rs3129716 in human genome in preparation identification or auxiliary identification and bleb
Application in the product of the relevant single nucleotide polymorphism of sample dermatitis；
The substance of the polymorphism or genotype of rs3129716 is amplification including rs3129716 in the detection human genome
Genomic DNA fragment PCR primer to and Single base extension primer；
The PCR primer is formed to by rs3129716_W1_F and rs3129716_W1_R；
The rs3129716_W1_F is single stranded DNA shown in sequence 1 in sequence table；
The rs3129716_W1_R is single stranded DNA shown in sequence 2 in sequence table；
The Single base extension primer is single stranded DNA shown in sequence 3 in sequence table；
The rs3129716 genotype is CC, CT or TT；
The CC is that the site rs3129716 is the homozygous of C, and the TT is homozygous, the CT that the site rs3129716 is T
It is the heterozygous that the site rs3129716 is C and T；
The ratio of the CC and the individual of the CT genotype in dermatitis herpetiformis PATIENT POPULATION is respectively higher than corresponding gene
Ratio of the type in normal person group.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710722584.7A CN107287342B (en) | 2017-08-22 | 2017-08-22 | Application of the mononucleotide polymorphism site rs3129716 in screening dermatitis herpetiformis patient |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710722584.7A CN107287342B (en) | 2017-08-22 | 2017-08-22 | Application of the mononucleotide polymorphism site rs3129716 in screening dermatitis herpetiformis patient |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107287342A CN107287342A (en) | 2017-10-24 |
| CN107287342B true CN107287342B (en) | 2019-09-06 |
Family
ID=60106505
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710722584.7A Expired - Fee Related CN107287342B (en) | 2017-08-22 | 2017-08-22 | Application of the mononucleotide polymorphism site rs3129716 in screening dermatitis herpetiformis patient |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107287342B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106520985A (en) * | 2016-12-06 | 2017-03-22 | 山东省皮肤病性病防治研究所 | Application of single nucleotide polymorphism rs2178077 to screening of pemphigus foliaceus patients |
| CN106520987A (en) * | 2016-12-06 | 2017-03-22 | 山东省皮肤病性病防治研究所 | Application of single nucleotide polymorphic rs3888722 in screening pemphigus foliaceus patients |
-
2017
- 2017-08-22 CN CN201710722584.7A patent/CN107287342B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106520985A (en) * | 2016-12-06 | 2017-03-22 | 山东省皮肤病性病防治研究所 | Application of single nucleotide polymorphism rs2178077 to screening of pemphigus foliaceus patients |
| CN106520987A (en) * | 2016-12-06 | 2017-03-22 | 山东省皮肤病性病防治研究所 | Application of single nucleotide polymorphic rs3888722 in screening pemphigus foliaceus patients |
Non-Patent Citations (3)
| Title |
|---|
| Genome-Wide Association Study of Celiac Disease in North America Confirms FRMD4B as New Celiac Locus;Garner C等;《PLoS One》;20140707;第9卷(第7期);e101428 |
| HLA-DQB1基因多态性与中国汉族人群系统性红斑狼疮的相关性;李媛;《标记免疫分析与临床》;20150131;第22卷(第1期);第37-41页 |
| HumanOmni54v1_B;ILLUMINA;《dbSNP》;20120622;ss537164359 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107287342A (en) | 2017-10-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20150184248A1 (en) | Method for detecting pancreatic cancer and detection kit | |
| You et al. | Alteration of microRNA expression in cerebrospinal fluid of unconscious patients after traumatic brain injury and a bioinformatic analysis of related single nucleotide polymorphisms | |
| CN104293952A (en) | Application of single nucleotide polymorphism rs10817758 in detection of a lepriasis susceptibility gene | |
| CN104293946A (en) | Application of single nucleotide polymorphism rs663743 in detection of lepriasis susceptibility gene | |
| JP6679486B2 (en) | Genetic markers associated with suicide risk and methods of use thereof | |
| CN106520987B (en) | Application of the single nucleotide polymorphism rs3888722 in screening pemphigus foliaceus patient | |
| CN106520985B (en) | Application of the single nucleotide polymorphism rs2178077 in screening pemphigus foliaceus patient | |
| CN107287342B (en) | Application of the mononucleotide polymorphism site rs3129716 in screening dermatitis herpetiformis patient | |
| CN107299148B (en) | Application of the mononucleotide polymorphism site rs2523607 in screening dermatitis herpetiformis patient | |
| CN106701924B (en) | Application of the single nucleotide polymorphism rs55882956 in screening leper | |
| US10731219B1 (en) | Method for preventing progression to metabolic syndrome | |
| CN106399572B (en) | Application of the single nucleotide polymorphism rs149308743 in screening leper | |
| CN106520988B (en) | Application of the single nucleotide polymorphism rs76418789 in screening leper | |
| CN106399571B (en) | Application of the single nucleotide polymorphism rs181206 in screening leper | |
| EP4036233A1 (en) | Method for detecting brain tumor | |
| KR20220025985A (en) | SNP marker for chronic sensorineural tinnitus diagnosis and diagnosis method using the same | |
| WO2015168252A1 (en) | Mitochondrial dna copy number as a predictor of frailty, cardiovascular disease, diabetes, and all-cause mortality | |
| CN106435001B (en) | Application of the single nucleotide polymorphism rs146466242 in screening leper | |
| CN106399573B (en) | Application of the single nucleotide polymorphism rs145562243 in screening leper | |
| CN106755365B (en) | Application of the single nucleotide polymorphism rs780668 in screening leper | |
| KR101046344B1 (en) | Stroke Diagnosis Method Using SNP2 and Polymorphs as Biomarkers | |
| CN104293950A (en) | Application of single nucleotide polymorphism rs77061563 in detecting leprosy susceptibility genes | |
| CN105765077A (en) | Test method for evaluating the risk of anti-thyroid drug-induced agranulocytosis, and evaluation kit | |
| KR20220028329A (en) | Method for providing information for cardiovascular disease and kits using the same | |
| KR101071081B1 (en) | Polynucleotides comprising single nucleotide polymorphism derived from DEFA4 gene, microarrays and diagnostic kits comprising the same, and detection methods using the same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20190906 Termination date: 20210822 |