CN106520988B - Application of the single nucleotide polymorphism rs76418789 in screening leper - Google Patents
Application of the single nucleotide polymorphism rs76418789 in screening leper Download PDFInfo
- Publication number
- CN106520988B CN106520988B CN201611117682.XA CN201611117682A CN106520988B CN 106520988 B CN106520988 B CN 106520988B CN 201611117682 A CN201611117682 A CN 201611117682A CN 106520988 B CN106520988 B CN 106520988B
- Authority
- CN
- China
- Prior art keywords
- genotype
- individual
- leper
- ratio
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Pathology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses application of the single nucleotide polymorphism rs76418789 in screening leper.The technical solution that the present invention is protected is to detect the substance application of the polymorphism of rs76418789 or the substance of genotype in the product that preparation detects single nucleotide polymorphism relevant to leprosy in preparing application and detection human genome in screening leper product of the polymorphism or genotype of rs76418789 in human genome.The substance of polymorphism or genotype that rs76418789 can be will test is united the product of preparation screening leper to other materials (substance as detected other single nucleotide polymorphism relevant with leprosy or genotype).
Description
Technical field
The present invention relates to single nucleotide polymorphism rs76418789 answering in screening leper in field of biotechnology
With.
Background technique
Leprosy also known as Hansen ' s disease, are a kind of communicable diseases as caused by Mycobacterium leprae (M.Leprae), main
Invade skin and peripheral nerve.2014, there were 213,889 new cases in the whole world.Although presently, there are effective treatment sides
Method, but in some countries, especially developing country, leprosy is still teratogenesis and the main reason for leading to some social concerns.For
Understand the genetic base of vulnerability to leprosy, the whole-genome association (GWAS) of leprosy located 17 common variation positions
Point discloses the effect of inherent immunity and adaptive immunity in leprosy morbidity.However, these common risk variant sites are big
Part is located at noncoding region, is only capable of the onset risk of partial interpretation leprosy.Currently, the change to protein encoding regions not yet
Different, especially low frequency variation and rare variation carries out system research.And these variations have proven to the inheritance susceptible with some diseases
Property it is related.
Summary of the invention
The technical problem to be solved by the present invention is to how screening leper and detection vulnerability to leprosy.
In order to solve the above technical problems, present invention firstly provides following any purposes:
A1 the substance for) detecting the polymorphism (i.e. allele) or genotype of rs76418789 in human genome is sieved in preparation
Look into the application in leper's product;
A2 the substance for) detecting the polymorphism (i.e. allele) or genotype of rs76418789 in human genome is examined in preparation
Survey the application in vulnerability to leprosy product;
A3 the substance for) detecting the polymorphism (i.e. allele) or genotype of rs76418789 in human genome is examined in preparation
Survey the application in the product of single nucleotide polymorphism relevant to leprosy;
A4 the substance for) detecting the polymorphism (i.e. allele) or genotype of rs76418789 in human genome reflects in preparation
Fixed or auxiliary identifies the application in the product of single nucleotide polymorphism relevant to leprosy;
B1) polymorphism (i.e. allele) or genotype of rs76418789 are preparing screening leper in human genome
Application in product;
B2) polymorphism (i.e. allele) or genotype of rs76418789 detect vulnerability to leprosy in preparation in human genome
Application in property product;
B3 the substance of the polymorphism (i.e. allele) or genotype of rs76418789 in human genome) is detected in screening fiber crops
Application in wind patient;
B4 the substance of the polymorphism (i.e. allele) or genotype of rs76418789 in human genome) is detected in detection fiber crops
Application in wind neurological susceptibility;
B5) detect human genome in rs76418789 polymorphism (i.e. allele) or genotype substance detection with
Application in the relevant single nucleotide polymorphism of leprosy;
B6) detect human genome in rs76418789 polymorphism (i.e. allele) or genotype substance identification or
Auxiliary identifies the application in single nucleotide polymorphism relevant to leprosy;
B7) in human genome the polymorphism (i.e. allele) or genotype of rs76418789 in screening leper
Using;
B8) in human genome rs76418789 polymorphism (i.e. allele) or genotype detection vulnerability to leprosy in
Application.
Rs76418789 is the SNP site of a two equipotential polymorphisms on human chromosome 1p31.3, belongs to low frequency variation
(MAF=4.32%), in the exon of IL23R gene, which is conversion (A/G is then T/C on its complementary strand).
The rs76418789 genotype is AA, AG or GG.The AA is that the site rs76418789 is the homozygous of A, and the GG is
The site rs76418789 is the homozygous of G, and the AG is the heterozygous that the site rs76418789 is A and G.The detection people's gene
The polymorphism (i.e. allele) or genotype of rs76418789 concretely detects the nucleotide type of rs76418789 in group.
In such use, the substance of the polymorphism or genotype of rs76418789 can be amplification in the detection human genome
The PCR primer and/or Single base extension primer of genomic DNA fragment including rs76418789.The product may include
The PCR primer and/or the Single base extension primer.
In such use, ratio of the individual of the AA and the AG genotype in leper group is respectively higher than pair
Ratio of the genotype answered in normal person group.
In such use, the leprosy concretely Chinese population leprosy.
In order to solve the above technical problems, the present invention also provides the polymorphisms containing rs76418789 in detection human genome
Or the product of the substance of genotype.
Production provided by the present invention containing the substance of the polymorphism or genotype of rs76418789 in detection human genome
Product, for any product in a)-d):
A) product of single nucleotide polymorphism (i.e. allele) relevant to leprosy or genotype is detected;
B) identify or assist the product of identification single nucleotide polymorphism (i.e. allele) relevant to leprosy or genotype;
C) screening leper product;
D) vulnerability to leprosy product is detected.
In the said goods, the substance of the polymorphism or genotype of rs76418789 can be amplification in the detection human genome
The PCR primer and/or Single base extension primer of genomic DNA fragment including rs76418789.
In the said goods, the leprosy concretely Chinese population leprosy.
In order to solve the above technical problems, the present invention also provides following M1) or method M2):
M1) the method for screening leper, comprising: detect the gene in the site rs76418789 in object genome to be measured
Type, if the genotype in the site rs76418789 is AA genotype, the object to be measured is or candidate is leper;Such as
The genotype in the site rs76418789 is AG genotype, and the object to be measured is or candidate is leper;Such as rs76418789
The genotype in site is GG genotype, and the object to be measured is or candidate is non-leper;
M2 the method for vulnerability to leprosy) is detected, comprising: detect the gene in the site rs76418789 in object genome to be measured
Type, if the genotype in the site rs76418789 is AA genotype, the object to be measured is susceptible or candidate susceptible leprosy;Such as
The genotype in the site rs76418789 is AG genotype, and the object to be measured is susceptible or candidate susceptible leprosy;Such as rs76418789
The genotype in site is GG genotype, and the object to be measured is susceptible or candidate not susceptible leprosy.
In the above method, the leprosy concretely Chinese population leprosy.
In the above method, the detection is can be used in the genotype for detecting the site rs76418789 in object genome to be measured
The polymorphism of rs76418789 or the substance of genotype carry out.
It is demonstrated experimentally that the risk allele of rs76418789 is A, ratio of the allele in leper group
It is higher by 41.20% than ratio of the allele in normal health crowd.The P value of rs76418789 is 1.03 × 10-10, and
The relative risk of rs76418789 is 1.36, illustrates that rs76418789 is single nucleotide polymorphism relevant to leprosy.
In three genotype of rs76418789, the ratio of the individual of AA genotype and the individual of AG genotype in leper group
Ratio of the individual of respectively higher than corresponding genotype in normal person group, the individual of GG genotype is in leper group
Ratio lower than the genotype ratio of the individual in normal person group.
The present invention in practical applications, can will test the polymorphism (i.e. allele) of rs76418789 or the object of genotype
Matter is united to other materials (substance as detected other single nucleotide polymorphism relevant with leprosy or genotype)
Prepare the product of screening leper.
Wherein, the substance for detecting the polymorphism or genotype of rs76418789 in human genome can be to pass through following at least one
Reagent and/or instrument needed for kind method determines the polymorphism or genotype of rs76418789: DNA sequencing, restriction enzyme slice
Segment length polymorphism, single-strand conformation polymorphism, denaturing high-performance chromatography, SNP chip, TaqMan probe technology and Sequenom
MassArray technology.Wherein, polymorphism or the genotype institute of rs76418789 are determined using Sequenom MassArray technology
The reagent and/or instrument needed include PCR primer to, the extension primer based on single base extension, phosphatase, resin, chip,
MALDI-TOF (matrix-assisted laser desorption/ionization-time of fligh, Matrix-assisted
Laser desorption ionization flight time mass spectrum) and/or Sequenom MassArray technology required for other reagents and instrument;
Reagent needed for determining the polymorphism or genotype of rs76418789 using TaqMan probe technology and/or instrument include TaqMan
Probe, PCR primer to, quantitative PCR apparatus, carry out required for the module and/or TaqMan probe technology of Genotyping other and try
Agent;SNP chip includes the chip based on nucleic acid hybridization reaction, the chip based on single base extension, based on allele spy
The chip of specific primer extension, the chip based on primer connection reaction, is based on limitation at the chip based on " one-step method " reaction
Chip, the chip based on protein D NA association reaction and/or the core based on fluorescent molecule DNA association reaction of property inscribe enzyme reaction
Piece.In one embodiment of the invention, that utilize is the Infinium Human Exome BeadChip of Illumina company
Chip.
The product can be reagent or kit, can be also the system being made of reagent or kit and instrument, such as by drawing
The system of object and DNA sequencer composition, the system being made of PCR reagent and DNA sequencing reagent and DNA sequencer, by TaqMan
Probe, PCR primer are to, quantitative PCR apparatus and carry out required for the module and TaqMan probe technology of Genotyping other and try
The system of agent composition, other reagents required for probe, PCR primer pair and Ligase detection reaction (LDR) and instrument group
At system, by PCR primer to, Single base extension primer, chip, PCR instrument, carry out Genotyping module and/or
The system of other reagents required for Sequenom MassArray technology and instrument composition.
Genomic DNA fragment including rs76418789 is expanded using PCR primer, with obtained pcr amplification product
For template, single base extension is carried out using Single base extension primer, the sequence of obtained extension products is detected, really
Determine the polymorphism (i.e. allele) and genotype of rs76418789.The PCR primer does not have particular/special requirement in sequence, as long as
The genomic DNA fragment including rs76418789 can be amplified.The extension primer is according in human genome
Last 1 nucleotide of the upstream rs76418789 (not including the SNP site) design, the extension primer corresponds to human genome
Preceding 1 nucleotide of middle rs76418789.The extension primer can also (not include according to the downstream rs76418789 in human genome
The SNP site) design, rear 1 nucleosides of the 1st nucleotide of the extension primer corresponding to rs76418789 in human genome
Acid.
In the present invention, the PCR primer can be made of rs76418789-F and rs76418789-R;
The rs76418789-F is following a1) any single stranded DNA into a4):
A1) single stranded DNA shown in sequence 7 in sequence table;
A2) in a1) 5 ' ends and/or 3 ' ends add the single stranded DNA that one or several nucleotide obtain;
A3) and a1) or a2) single stranded DNA that limits with 85% or more identity single stranded DNA;
A4) the single stranded DNA that the single stranded DNA limited under strict conditions with a1) or a2) hybridizes;
The rs76418789-R is following b1) any single stranded DNA into b4):
B1) single stranded DNA shown in sequence 8 in sequence table;
B2) in b1) 5 ' ends and/or 3 ' ends add the single stranded DNA that one or several nucleotide obtain;
B3) and b1) or b2) single stranded DNA that limits with 85% or more identity single stranded DNA;
B4) the single stranded DNA that the single stranded DNA limited under strict conditions with b1) or b2) hybridizes.
The Single base extension primer (rs76418789-E) can be following c1) any single stranded DNA into c4):
C1) single stranded DNA shown in sequence 9 in sequence table;
C2) in c1) 5 ' ends and/or 3 ' ends add the single stranded DNA that one or several nucleotide obtain;
C3) and c1) or c2) single stranded DNA that limits with 85% or more identity single stranded DNA;
C4) the single stranded DNA that the single stranded DNA limited under strict conditions with c1) or c2) hybridizes.
A2) described in a1) 5 ' ends and/or to add the single stranded DNA that one or several nucleotide obtain be in sequence 7 at 3 ' ends
Shown in single stranded DNA 5 ' ends and/or the 3 ' obtained single stranded DNAs of end one to ten nucleotide of addition.B2) described in b1) 5 '
End and/or 3 ' ends add the 5 ' ends that the single stranded DNA that one or several nucleotide obtain is the single stranded DNA shown in sequence 8 and/or
The single stranded DNA that 3 ' end one to ten nucleotide of addition obtain.C2) described in c1) 5 ' ends and/or 3 ' end additions it is one or several
The single stranded DNA that nucleotide obtains is that 5 ' ends of the single stranded DNA shown in sequence 9 and/or 3 ' end one to ten nucleotide of addition obtain
The single stranded DNA arrived.
Term " identity " used herein refers to the sequence similarity with native sequence nucleic acid." identity " includes and this hair
Nucleotide sequence shown in bright sequence 7, sequence 8 or sequence 9 has 85% or higher or 90% or higher or 95% or more
The nucleotide sequence of high identity.Identity can with the naked eye or computer software is evaluated.Using computer software, two
Or the identity between multiple sequences can be indicated with percentage (%), can be used to evaluate same between correlated series
Property.
The stringent condition is to hybridize at 68 DEG C in 2 × SSC, the solution of 0.1%SDS and wash film 2 times, every time
5min, but in 0.5 × SSC, the solution of 0.1%SDS, hybridize at 68 DEG C and washes film 2 times, each 15min;Or, 0.1 ×
SSPE (or 0.1 × SSC), 0.1%SDS solution in, hybridize under the conditions of 65 DEG C and wash film.
Above-mentioned 85% or more identity can be 85%, 90% or 95% or more identity.
In an embodiment of the present invention, rs76418789 application SEQUENOM genotyping platform isPoint
Son amount array technique, SequenomSNP detection process combination multiple PCR technique, MassARRAY iPLEX are mono-
Base elongation technology and matrix solid-dispersion flying time mass spectrum analysis mass-spectrometric technique (matrix-assisted
Laser desorption/ionization-time of flight, MALDI-TOF) carry out parting detection.It will include SNP
The DNA profiling in point region is expanded by round pcr, and it is anti-to reuse special extension primer and PCR product progress Single base extension
It answers.Since polymorphic site base is different, the different terminal bases of extension products will lead to the difference of the molecular weight of product after extending
It is different, therefore the base difference as caused by SNP polymorphism is embodied by the difference of molecular weight, passes through matrix assisted laser desorption ionization
Ionization time of flight mass spectrometry analyzes mass-spectrometric technique, detects the size of extension products molecular weight, and the analysis software of application specific passes through
Judge the difference of molecular weight and carries out SNP parting detection.
Present invention discovery in a sample (7048 lepers and 14398 healthy persons) from Chinese population
Rs76418789 is single nucleotide polymorphism relevant to leprosy.The polymorphism (i.e. allele) of rs76418789 can be will test
Or the substance of genotype and other materials (as detect other single nucleotide polymorphism (i.e. allele) relevant with leprosy or
The substance of genotype) it is united the product of preparation screening leper.
Detailed description of the invention
Fig. 1 is to carry out using fixed effect model to all samples (7,048 cases and 14,398 normal healthy controls)
The result of meta analysis.
Specific embodiment
The present invention is further described in detail With reference to embodiment, and the embodiment provided is only for explaining
The bright present invention, the range being not intended to be limiting of the invention.
Experimental method in following embodiments is unless otherwise specified conventional method.
The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.
Embodiment 1, rs145562243, rs149308743, rs76418789, rs146466242, rs55882956,
Rs780668 and rs181206 is single nucleotide polymorphism relevant to leprosy
Method: inventor by three phases in Chinese population 7,048 lepers and 14,398 it is normal right
Shine into the whole-genome association research of row protein encoding regions.Firstly, by Exon chip to 1,648 leper
(first stage) is analyzed with the SNP site (MAF > 0.1%) of 40,491 coding regions of 2,318 normal controls.So
34 candidate SNP locus are verified in north of China crowd (3,169 lepers and 9,814 normal controls) afterwards
(second stage).Finally in the southern china crowd (2,231 lepers and 2,266 normal controls) in addition chosen and
(phase III) is verified to 8 candidate locus in all samples in the first and second stage.
Research object
The research object of Exon chip discovery phase (first stage) is 1,670 lepers of Northern Part of China
With 2,321 normal controls.Qualify Phase (second stage) by 39 variant sites Northern Part of China other 3,169
It is verified in example leper and 9,814 normal controls.Finally to the repeated authentication stage of 8 variant sites filtered out
The research object that (phase III) selects is three independent samples of southern area of China and all samples in the first and second stage
This: (1) Sichuan Province 906 leper and 878 normal controls;(2) 829, Yunnan Province leper and 589 are normal right
According to;(3) 496, Guizhou Province leper and 799 normal controls.Leper and normal control are Chinese han population,
And geographically match.The clinical information of research object is shown in Table 1.
Table 1, research object information
Wherein, the diagnostic criteria of leper is 2 or 2 or more met in following 4, or to meet the 3rd article of person true
Vertical diagnosis: 1, skin lesion with sensory disturbance and closes sweat, or has numb area;2, peripheral nerve is involved, and shows as the coarse companion of nerve cord
Corresponding function obstacle;3, skin lesion histotomy or tissue fluid smear find Mycobacterium leprae;4, pathology visible features sexually revise.
The diagnostic criteria of normal control (normal healthy people): family history (including the leper without History of Leprosy and without leprosy
Level-one, second level and third degree relative);Without animal infectious diease medical history;Without other autoimmune disease medical histories, systemic disease disease
History and family history.
This research has passed through Shandong Academy of Medical Sciences, Shandong Dermatopathy Cypridopathy Prevention and Cure Institute's Institutional Review Board
Approval.
Parting and Quality Control
Select the Infinium Human Exome BeadChip chip of Illumina company to 1,670 lepers
And 2,321 normal controls carry out parting, share on chip and carry out full sequencing of extron group identification to 1,998 sample of Chinese
The coding region variation non-synonymous of 27,089 (existing in > 1 sample) out.Exclude noncoding region variation and MAF < 0.1%
Variation, analysis is associated to the variation of 40,491 coding regions.In Qualify Phase and repeated authentication stage, select
Sequenom MassARRAY system (Agena Bioscience), QuantStudioTM 12K Flex Real-Time
PCR (Applied Biosystems) and 7900HT Fasr Real-Time PCR System (Applied Biosystems)
Carry out parting research.Quality Control filter criteria is as follows: excluding not knowing the variation of group, recall rate < 90% and does not meet Hardy-
Weinberg equilibrium law (P < 1 × 10-3), sample recall rate < 95% the case where.
Statistical analysis
In the first stage, the association analysis between phenotype and single mutant gene type is carried out by GMMAT-v0.7.?
Second and third stage is analyzed by SNPs being associated property of the linear regression model (LRM) in PLINK to MAF > 1%, utilizes PLINK
Middle Fisher's exact propability is associated analysis to the SNPs of MAF < 1%.(pass through META- using fixed effect model
V7.0 software uses inverse variance method to the SNPs of MAF>1%, is divided using z- statistic combined method the SNPs of MAF<1%
Analysis).Meta analysis is carried out to the data that discovery phase, Qualify Phase, repeated authentication stage three parts combine.Meet simultaneously
p<1.23×10-6(0.05/40,491) variation is the variation of statistically significant exon group.For second and third rank
The association analysis of section, p < 0.05 and the variation with discovery phase with same effect are the site with statistical significance.Benefit
The heterogeneity of independent sample is analyzed with Cochran ' s Q inspection, p < 0.05 is thought with statistical significance.
The analysis of exon group discovery phase
Parting is carried out to 273,028 variant sites of 1,670 lepers and 2,321 normal controls.Pass through master
Constituent analysis determines that all samples are of Chinese origin, and it was found that has preferable gene in leper and normal control
The matching of type.By a series of filtering of samples and variant sites, the code area variation position of 40,491 MAF > 0.1% is found altogether
Point (38,068 nonsynonymous mutations and 2,423 same sense mutations), after by it in 1,648 leper and 2,318 health
It is analyzed in control.
Full exon analysis discovery has stronger relevance in the region MHC.Remove all variant sites in the region MHC
Afterwards, the Q-Q icon of remaining SNP site closes zero cloth, shows exon association analysis result caused by crowd's Confounding Factor
Possibility is preferably minimized (lambda value=0.99).Meanwhile to different MAF threshold values (MAF > 0.5%, MAF > 1% and MAF >
5%) SNP site carries out the analysis of Q-Q figure, consistent with the above results.
By the study found that relevant property (P < 1.0 × 10 of five prompts-3) coding region variant sites (four often
See variation and a low frequency variation) it is also included in the site for the GWAS discovery reported before.Four common variant sites are therewith
The SNP site of preceding report has stronger linkage disequilibrium, and only low frequency variation (IL-23R gene rs76418789) is independent.
In addition, the Q-Q figure of (SNP site in the removal region MHC) the tail end distribution of Q-Q figure and standard zero distribution there are deviation, shows exist
New association site, has the variant sites in 38 new coding regions to be found to have relevance (P < 1.0 × 10-3)。
For the effect for further studying low frequency variation and rare variation, pass through the method pair of SKAT-O and berden-test
Exclude the variant sites and 38 new coding regions of 5 coding regions in the variant sites and known site in the region MHC
Interior variant sites (P < 1.0 × 10-3) after SNP site analyzed.Two methods prove that gene association is not accidental.
Qualify Phase analysis
To 38 newfound volumes in 3,169 lepers and 9,814 normal healthy controls in north of China region
The variant sites in one low frequency coding region of the variant sites in code region and GWAS discovery before carry out parting.There are 34 variations
Site can succeed parting, wherein 15 sites are consistent in discovery phase and Qualify Phase (in Qualify Phase, P < 0.05, OR
The effect of value is consistent with discovery phase), 6 sites all have the statistics of exon group analysis in discovery phase and Qualify Phase
Meaning (P < 1.23 × 10-6) and there is no genetic heterogeneity, this 6 sites are respectively as follows: NCKIPSD gene rs145562243 (P=
1.44×10-8, OR=4.35), (P=4.99 × 10 CARD9 gene rs149308743-10, OR=4.75), IL23R gene
(P=6.28 × 10 rs76418789-9, OR=1.37), (P=1.44 × 10 FLG gene rs146466242-10, OR=1.45),
(P=2.89 × 10 SLC29A3 gene rs780668-7, OR=1.14) and (P=5.92 × 10 IL27 gene rs181206-7,OR
=0.83) (table 3).
In addition, the variant sites of two coding regions: (P=2.75 × 10 TYK2 gene rs55882956-5, OR=1.29)
With (P=3.45 × 10 USP49 gene rs75746803-6, OR=1.28) and it is all had in discovery phase and Qualify Phase with leprosy
Consistency and relevance, but only just reached statistical significance (P < 5.0 × 10 of exon group analysis-5) (table 3).
Wherein, to rs145562243, rs149308743, rs76418789, rs146466242, rs55882956,
Rs780668 and rs181206 parting uses Sequenom MassARRAY system (Agena Bioscience),
QuantStudioTM12K Flex Real-Time PCR (Applied Biosystems) and 7900HT Fasr Real-
Time PCR System (Applied Biosystems) is carried out, and the specific method is as follows:
1.rs181206, rs780668, rs76418789, rs149308743, rs145562243 and rs55882956's
Parting
Rs181206, rs780668, rs76418789, rs149308743, rs145562243 and rs55882956 this 6
SNP application SEQUENOM genotyping platform isMolecular weight array technique, Sequenom
SNP detection process combination multiple PCR technique, MassARRAY iPLEX Single base extension technology and matrix assisted laser desorption ionization
Ionization time of flight mass spectrometry analyzes mass-spectrometric technique (matrix-assisted laser desorption/ionization-time
Of flight, MALDI-TOF) carry out parting detection.DNA profiling comprising SNP site region is expanded by round pcr, then
Single base extension is carried out using special extension primer and PCR product (table 2).Since polymorphic site base is different, prolong
Stretch the difference for the molecular weight of product that the different terminal bases of product will lead to after extending, therefore the base as caused by SNP polymorphism
Difference is embodied by the difference of molecular weight, passes through matrix solid-dispersion flying time mass spectrum analysis mass spectrum skill
Art detects the size of extension products molecular weight, the analysis software of application specific, by judging that the difference of molecular weight carries out SNP
Parting detection.
2,6 SNP serotype specific primers of table
Operating procedure is as follows:
6 SNP use Sequenom MassArray (SanDiego, USA) platform validation, and each sample is about used
15ngDNA.The genomic DNA for extracting peripheral blood first, after standardization, sample DNA includes SNP through multi-PRC reaction amplification
Genomic DNA fragment including point, amplified production carry out the extension of the single chain of SNP site specificity, and extension products desalination simultaneously turns
It moves on on the chip in 384 holes.Mass spectrograph (MALDI-TOFMS) carries out the detection of allele, using Sequenom
MassARRAY parting software analyzes testing result.
1.1, whole blood sample acquires
Research object peripheric venous blood 5ml is acquired in informed consent and in the case where signing written consent form, is placed in
EDTANa2In anticoagulant tube, sets -80 DEG C of refrigerator-freezers and store for future use.
1.2, DNA concentration standardization includes the following steps:
1) using NanoDrop-1000 concentration tester Accurate Determining it is every it is a need standardized sample DNA concentration and
OD ratio (A260/A280, A260/A230).
2) electrical form is established, the DNA number that each sample aperture that is ranked needs to be added.
The sample of Sequenom MassArray parting is carried out, there are blank controls and repeated sample pair on every 96 orifice plate
According to.
3) according to the sequence of electrical form, the DNA for having measured concentration is added.
For carry out Sequenom MassArray parting sample require experimental concentration be 12-30ng/ μ l, generally with
18ng/ μ l is preferred.And A260/A280 ratio is between 1.5-2.0, A260/230 is between 1.5-2.3, such as DNA concentration height
Appropriate FG3 is then added in 18ng/ μ l, by concentration mark to 18ng/ μ l;If DNA concentration is lower than 12ng/ μ l, then again from blood
Extract qualified DNA.Concentration is directly added between 12-18ng/ μ l.
Sticky masking foil is sticked after centrifugation, and puts on the information such as sample plate mark, sample type, source place with marker pen.
4) on plate centrifuge, 3000g be centrifuged 3 minutes, deposit in -20 DEG C it is spare.
1.3, multiplex PCR is carried out using the forward primer and reverse primer of each SNP
1.4, the extension of the single chain of SNP site specificity
Wherein, extension primer is designed according to SNP site upstream in human genome (not including the SNP site), the extension
Last 1 nucleotide of primer corresponds to preceding 1 nucleotide of the SNP site in human genome.
1.5, data quality control
1) call rate calculating is carried out to the SNP of parting, remove call rate < 95% SNP or gene frequency <
0.01 SNPs;
2) genetic equilibrium inspection is carried out to SNP, removal deviates the SNP (Hardy- in check sample of the law of genetic equilibrium
P≤0.001 of Weinberg balance check).
3) the parting dendrogram of SNP is checked in Sequenom MassArray system, removal dendrogram stacking is unclear
SNP。
4) sample Quality Control: the directly sample of removal parting failure.
It will be for statistical analysis by the sample of Quality Control and SNP.
1.6, data statistic analysis
Succeeded using 1.07 software of Plink to parting and the SNP for passing through Quality Control does gene phenotype in case group and control group
Correlation analysis is examined the genotype of each sample and the relevance of phenotype with Cochran-Armitage trend, is then used
The genotype of all samples of Cochran-Mantel-Haenszel comprehensive analysis and the correlation of phenotype.It is evaluated with Q inspection a
Heterogeneity between body, this experiment in, using p < 0.05 as inspection level.Multiple logistic regression analysis is used for detection zone
The independence of interior signal.Inspection level α using 0.05 divided by the SNP number controlled by quality as inspection level.Q inspection is used for
The conspicuousness for assessing genetic heterogeneity, being considered as to P value after SNP correction detection less than 0.05 has significant genetic heterogeneity.
The parting of 2.rs146466242
Rs146466242 application 7900HT/Taqman genotyping system carries out SNP parting.
Primer and probe sequence are as follows:
Forward primer rs146466242-F:CCACATAAACCTGGGTCCTTATTAA (sequence 19)
Reverse primer rs146466242-R:GGAAAGATCTGATATCTGTAAAGCAAGTG (sequence 20)
Probe 1rs146466242-P1:CTTGGATGATCTTTAC (sequence 21), 5 ' ends are marked by reporter fluorescence dyestuff FAM
Note, 3 ' ends are marked by quencher fluorescent dye NFQ
Probe 2rs146466242-P2:CTTGGATGATCTTAAC (sequence 22), 5 ' ends are marked by reporter fluorescence dyestuff VIC
Note, 3 ' ends are marked by quencher fluorescent dye NFQ
Operating procedure is as follows:
The peripheric venous blood 5ml of each object is extracted respectively, extracts genomic DNA, (DNA concentration is equal for genomic DNA respectively
Between 50-100ng/ microlitres).
The reaction system of real-time fluorescence quantitative PCR reaction are as follows: 1 μ L of genomic DNA, 2 × TaqMan GT master mix
(Life technology company) 2.5 μ L, 20 × TaqMan probe mixture, 0.65 μ L, 0.85 μ L of deionized water.It will be above-mentioned anti-
Answer system be added 96 hole PCR plates in, using 7900 real-time fluorescence quantitative PCR instrument of ABI (Applied Biosystems company) into
Row reaction.Reaction condition are as follows: 95 DEG C are denaturalized 30 seconds, and 60 DEG C are annealed 1 minute, 40 circulations.
In above-mentioned reaction system, 20 × TaqMan probe mixture is including expanding the gene including rs146466242
Group DNA fragmentation PCR primer to complete probe, wherein PCR primer is formed to by above-mentioned forward primer and reverse primer, complete
Probe is made of probe 1 and probe 2.
After reaction, genotyping is carried out using 7900System SDS software, determines each research object
The genotype in the site rs146466242.
Repeated authentication analysis
In order to further verify 8 variant sites non-synonymous (6 exon group analysis have statistical significance site and
2 prompts may relevant site) whether there is relevance, and three independent samples totally 2,231 are chosen in southern china region
Example leper and 2,266 normal controls.Then all samples (7,048 cases and 14,398 normal healthy controls) are carried out
Parting, wherein to rs145562243, rs149308743, rs76418789, rs146466242, rs55882956,
The same Qualify Phase of specific method that rs780668 and rs181206 parting uses.
Then meta is carried out to all samples (7,048 cases and 14,398 normal healthy controls) using fixed effect model
Analysis.7 encoding mutants show that the consistency in three phases is associated with, and have without heterogeneous evidence, and in all samples
Significant difference (P < 0.05/40,491=1.23 × 10 of exon-6): two rare mutation, positioned at 3p21.31's
NCKIPSD gene rs145562243 (MAF=0.4%, P=1.71 × 10-9, OR=4.35) and positioned at 9q34.3 CARD9 base
Because of rs149308743 (MAF=0.5%, P=2.09 × 10-8, OR=4.75);Three low frequency variations, positioned at 1p31.3's
IL23R gene rs76418789 (MAF=4.32%, P=1.03 × 10-10, OR=1.36), positioned at the FLG gene of 1q21.3
Rs146466242 (MAF=3.54%, P=3.39 × 10-12, OR=1.45) and positioned at 19p13.2 TYK2 gene
Rs55882956 (MAF=3.63%, P=1.04 × 10-6, OR=1.30);Two common variations, positioned at 10q22.1's
SLC29A3 gene rs780668 (MAF=42%, P=2.17 × 10-9, OR=1.14) and positioned at 16p11.2 IL27 gene
Rs181206 (MAF=15%, P=1.08 × 10-7, OR=0.83).Although being located in all independence sample analyses
The USP49 gene rs75746803 of 6p21.1 shows consistency, but the site is lower than exon significance (MAF=
4.8%, P=3.57 × 10-6, OR=1.25) and (table 3 and Fig. 1).
7 SNP are in the genotype frequency in 7048 lepers and 14398 normal controls as shown in table 4 and table 5.
The result shows that: in three genotype of rs145562243, ratio of the individual in leper group of TC genotype is higher than pair
Ratio of the individual for the genotype answered in normal person group, ratio of the individual of CC genotype in leper group are lower than
Ratio of the individual of the genotype in normal person group;
In three genotype of rs149308743, ratio of the individual in leper group of TC genotype is higher than pair
Ratio of the individual for the genotype answered in normal person group, ratio of the individual of CC genotype in leper group are lower than
Ratio of the individual of the genotype in normal person group;
In three genotype of rs76418789, the individual of AA genotype and the individual of AG genotype are in leper group
In ratio be respectively higher than ratio of the individual in normal person group of corresponding genotype, the individual of GG genotype is suffered from leprosy
Ratio in person group is lower than ratio of the individual of the genotype in normal person group;
In three genotype of rs146466242, the individual of AA genotype and the individual of AT genotype are in leper group
Ratio in body is respectively higher than ratio of the individual of corresponding genotype in normal person group, and the individual of TT genotype is in leprosy
Ratio in PATIENT POPULATION is lower than ratio of the individual of the genotype in normal person group;
In three genotype of rs55882956, the individual of AA genotype and the individual of AG genotype are in leper group
In ratio be respectively higher than ratio of the individual in normal person group of corresponding genotype, the individual of GG genotype is suffered from leprosy
Ratio in person group is lower than ratio of the individual of the genotype in normal person group;
In three genotype of rs780668, the individual of TT genotype and the individual of TC genotype are in leper group
Ratio be respectively higher than ratio of the individual in normal person group of corresponding genotype, the individual of CC genotype is in leper
Ratio in group is lower than ratio of the individual of the genotype in normal person group;
In three genotype of rs181206, ratio of the individual of AA genotype in leper group is higher than corresponding
Ratio of the individual of ratio of the individual of genotype in normal person group, GG genotype and AG genotype in leper group
Ratio of the individual of the respectively lower than corresponding genotype of example in normal person group.
The genotype individuals number of table 4, SNP in leper and normal population
The genotype frequency of table 5, SNP in leper and normal population
The gene frequency (%) of table 6, SNP in leper group and variable quantity compared with the control
It infuses in table 4 and table 5, in the genotype of rs145562243, A1*A1 indicates that CC, A1*A2 indicate that TC, A2*A2 are indicated
TT;
In the genotype of rs149308743, A1*A1 indicates that CC, A1*A2 indicate that TC, A2*A2 indicate TT;
In the genotype of rs76418789, A1*A1 indicates that AA, A1*A2 indicate that AG, A2*A2 indicate GG;
In the genotype of rs146466242, A1*A1 indicates that AA, A1*A2 indicate that AT, A2*A2 indicate TT;
In the genotype of rs55882956, A1*A1 indicates that AA, A1*A2 indicate that AG, A2*A2 indicate GG;
In the genotype of rs780668, A1*A1 indicates that TT, A1*A2 indicate that TC, A2*A2 indicate CC;
In the genotype of rs181206, A1*A1 indicates that GG, A1*A2 indicate that AG, A2*A2 indicate AA.
Leper group and normal is calculated using the logistic regression model (log-additive model) of two classification
Gene frequency difference P value in crowd's body, determining SNP, whether there is or not significants, and wherein genotype is united using additive models
Meter.As a result, it has been found that rs145562243, rs149308743, rs76418789, rs146466242, rs55882956,
The gene frequency of each allele of rs780668 and rs181206 has significantly in normal person group and leper group
Sex differernce.
As shown in Table 6, the risk allele of rs145562243 is T, gene frequency of the allele in leper
Rate is 0.0039, and the gene frequency in normal control is 0.0004, and compared with normal control, the allele is in leper
In increase 875.00%;The risk allele of rs149308743 is T, gene frequency of the allele in leper
Rate is 0.0055, and the gene frequency in normal control is 0.0006, and compared with normal control, the allele is in leper
In increase 816.67%;The risk allele of rs76418789 is A, gene frequency of the allele in leper
It is 0.0610, the gene frequency in normal control is 0.0432, and compared with normal control, the allele is in leper
Increase 41.20%;The risk allele of rs146466242 is A, and gene frequency of the allele in leper is
0.0558, the gene frequency in normal control is 0.0354, and compared with normal control, which increases in leper
Add 57.63%;The risk allele of rs55882956 is A, and gene frequency of the allele in leper is
0.0529, the gene frequency in normal control is 0.0363, and compared with normal control, which increases in leper
Add 45.73%;The risk allele of rs780668 is T, and gene frequency of the allele in leper is
0.4648, the gene frequency in normal control is 0.4213, and compared with normal control, which increases in leper
Add 10.33%;The risk allele of rs181206 is A, and gene frequency of the allele in leper is
0.8829, the gene frequency in normal control is 0.8503, and compared with normal control, which increases in leper
Add 3.83%.
The experimental results showed that rs145562243, rs149308743, rs76418789, rs146466242,
The polymorphism or genotype or gene frequency of rs55882956, rs780668 and rs181206 can be used for the sieve of leper
It looks into.
In addition, analyzing the shadow of age and sex ratio by carrying out joint survey to age in sample and gender information
It rings.(age and gender) unadjusted and adjusted closely similar (table of ORs in two common mutations and three low frequency mutation SNPs
7) in the association analysis for, disclosing these SNPs, there are lesser effect at gender and age.
The analysis result that table 7, gender and age influence two common mutations and three low frequency mutation SNP
Secondary allele/main allele;
OR, OR are calculated according to inferior for gene;
(f) refer to fixed-effect model
<110>Shandong Dermatopathy Cypridopathy Prevention and Cure Institute
<160> 22
<170> PatentIn version 3.5
<210> 1
<211> 30
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 1
acgttggatg accactccca gaggccatca 30
<210> 2
<211> 29
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 2
acgttggatg ttcccagatc ccaccacag 29
<210> 3
<211> 17
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 3
ttcaccacag cctcgcc 17
<210> 4
<211> 30
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 4
acgttggatg cctgcggtag ttctcaaaac 30
<210> 5
<211> 29
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 5
acgttggatg ttcccccttc tccaggacg 29
<210> 6
<211> 20
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 6
gctcaaaact ctctttgagg 20
<210> 7
<211> 30
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 7
acgttggatg tcaggcaaca tgacttgcac 30
<210> 8
<211> 30
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 8
acgttggatg gaggaagtga cctacctctt 30
<210> 9
<211> 18
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 9
ctatgtaggt gagcttcc 18
<210> 10
<211> 30
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 10
acgttggatg atcttccaag ccatgggcac 30
<210> 11
<211> 30
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 11
acgttggatg tggtgacaga gtacgtggag 30
<210> 12
<211> 20
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 12
atgtttggct gcggagggag 20
<210> 13
<211> 30
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 13
acgttggatg gccatcttca tggtgataac 30
<210> 14
<211> 30
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 14
acgttggatg tgaggatcac catgcagaca 30
<210> 15
<211> 16
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 15
gtgaaggtgg acactt 16
<210> 16
<211> 28
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 16
acgttggatg ccctgggtcc ccagccct 28
<210> 17
<211> 30
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 17
acgttggatg gagcgtctct gcttcatctc 30
<210> 18
<211> 15
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 18
agcccttcca tgccc 15
<210> 19
<211> 25
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 19
ccacataaac ctgggtcctt attaa 25
<210> 20
<211> 29
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 20
ggaaagatct gatatctgta aagcaagtg 29
<210> 21
<211> 16
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 21
cttggatgat ctttac 16
<210> 22
<211> 16
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 22
cttggatgat cttaac 16
Claims (4)
1. detecting the substance of the polymorphism or genotype of rs76418789 in human genome in preparation screening leper product
Application;
It includes that rs76418789 exists that the substance of the polymorphism or genotype of rs76418789, which is amplification, in the detection human genome
The PCR primer and Single base extension primer of interior genomic DNA fragment;The PCR primer by rs76418789-F and
Rs76418789-R composition;
The rs76418789-F is single stranded DNA shown in sequence 7 in sequence table;
The rs76418789-R is single stranded DNA shown in sequence 8 in sequence table;
The Single base extension primer is single stranded DNA shown in sequence 9 in sequence table;
The rs76418789 genotype is AA, AG or GG;The AA is homozygous, the GG that the site rs76418789 is A
It is the site rs76418789 for the homozygous of G, the AG is the heterozygous that the site rs76418789 is A and G;Of AA genotype
The ratio of body and the individual of AG genotype in leper group is respectively higher than the individual of corresponding genotype in normal population
Ratio in body, ratio of the individual of GG genotype in leper group are individual in normal person group lower than the genotype
In ratio.
2. the substance for detecting the polymorphism or genotype of rs76418789 in human genome detects vulnerability to leprosy product in preparation
In application;
It includes that rs76418789 exists that the substance of the polymorphism or genotype of rs76418789, which is amplification, in the detection human genome
The PCR primer and Single base extension primer of interior genomic DNA fragment;The PCR primer by rs76418789-F and
Rs76418789-R composition;
The rs76418789-F is single stranded DNA shown in sequence 7 in sequence table;
The rs76418789-R is single stranded DNA shown in sequence 8 in sequence table;
The Single base extension primer is single stranded DNA shown in sequence 9 in sequence table;
The rs76418789 genotype is AA, AG or GG;The AA is homozygous, the GG that the site rs76418789 is A
It is the site rs76418789 for the homozygous of G, the AG is the heterozygous that the site rs76418789 is A and G;Of AA genotype
The ratio of body and the individual of AG genotype in leper group is respectively higher than the individual of corresponding genotype in normal population
Ratio in body, ratio of the individual of GG genotype in leper group are individual in normal person group lower than the genotype
In ratio.
3. the substance for detecting the polymorphism or genotype of rs76418789 in human genome detects list relevant to leprosy in preparation
Application in the product of nucleotide polymorphisms;
It includes that rs76418789 exists that the substance of the polymorphism or genotype of rs76418789, which is amplification, in the detection human genome
The PCR primer and Single base extension primer of interior genomic DNA fragment;The PCR primer by rs76418789-F and
Rs76418789-R composition;
The rs76418789-F is single stranded DNA shown in sequence 7 in sequence table;
The rs76418789-R is single stranded DNA shown in sequence 8 in sequence table;
The Single base extension primer is single stranded DNA shown in sequence 9 in sequence table;
The rs76418789 genotype is AA, AG or GG;The AA is homozygous, the GG that the site rs76418789 is A
It is the site rs76418789 for the homozygous of G, the AG is the heterozygous that the site rs76418789 is A and G;Of AA genotype
The ratio of body and the individual of AG genotype in leper group is respectively higher than the individual of corresponding genotype in normal population
Ratio in body, ratio of the individual of GG genotype in leper group are individual in normal person group lower than the genotype
In ratio.
4. detecting the substance of the polymorphism or genotype of rs76418789 in human genome in preparation identification or auxiliary identification and fiber crops
Application in the product of the relevant single nucleotide polymorphism of wind;
It includes that rs76418789 exists that the substance of the polymorphism or genotype of rs76418789, which is amplification, in the detection human genome
The PCR primer and Single base extension primer of interior genomic DNA fragment;The PCR primer by rs76418789-F and
Rs76418789-R composition;
The rs76418789-F is single stranded DNA shown in sequence 7 in sequence table;
The rs76418789-R is single stranded DNA shown in sequence 8 in sequence table;
The Single base extension primer is single stranded DNA shown in sequence 9 in sequence table;
The rs76418789 genotype is AA, AG or GG;The AA is homozygous, the GG that the site rs76418789 is A
It is the site rs76418789 for the homozygous of G, the AG is the heterozygous that the site rs76418789 is A and G;Of AA genotype
The ratio of body and the individual of AG genotype in leper group is respectively higher than the individual of corresponding genotype in normal population
Ratio in body, ratio of the individual of GG genotype in leper group are individual in normal person group lower than the genotype
In ratio.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201611117682.XA CN106520988B (en) | 2016-12-07 | 2016-12-07 | Application of the single nucleotide polymorphism rs76418789 in screening leper |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201611117682.XA CN106520988B (en) | 2016-12-07 | 2016-12-07 | Application of the single nucleotide polymorphism rs76418789 in screening leper |
Publications (2)
Publication Number | Publication Date |
---|---|
CN106520988A CN106520988A (en) | 2017-03-22 |
CN106520988B true CN106520988B (en) | 2019-09-06 |
Family
ID=58341970
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201611117682.XA Active CN106520988B (en) | 2016-12-07 | 2016-12-07 | Application of the single nucleotide polymorphism rs76418789 in screening leper |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN106520988B (en) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN108330196B (en) * | 2018-02-06 | 2021-07-27 | 首都医科大学附属北京佑安医院 | Application of rs12252 polymorphism in detection of influenza virus antibody |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR20140130639A (en) * | 2014-09-18 | 2014-11-11 | 울산대학교 산학협력단 | Polynucleotide Marker Composition for Diagnosis of Susceptibility to Crohn's Disease |
CN104293946A (en) * | 2014-10-10 | 2015-01-21 | 山东省皮肤病性病防治研究所 | Application of single nucleotide polymorphism rs663743 in detection of lepriasis susceptibility gene |
CN104293952A (en) * | 2014-10-10 | 2015-01-21 | 山东省皮肤病性病防治研究所 | Application of single nucleotide polymorphism rs10817758 in detection of a lepriasis susceptibility gene |
-
2016
- 2016-12-07 CN CN201611117682.XA patent/CN106520988B/en active Active
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR20140130639A (en) * | 2014-09-18 | 2014-11-11 | 울산대학교 산학협력단 | Polynucleotide Marker Composition for Diagnosis of Susceptibility to Crohn's Disease |
CN104293946A (en) * | 2014-10-10 | 2015-01-21 | 山东省皮肤病性病防治研究所 | Application of single nucleotide polymorphism rs663743 in detection of lepriasis susceptibility gene |
CN104293952A (en) * | 2014-10-10 | 2015-01-21 | 山东省皮肤病性病防治研究所 | Application of single nucleotide polymorphism rs10817758 in detection of a lepriasis susceptibility gene |
Non-Patent Citations (3)
Title |
---|
Association of IL10 Polymorphisms and Leprosy: A Meta-Analysis;Alvarado-Arnez LE等;《PLoS One》;20150904;第10卷(第9期);e0136282 |
HumanOmni25Exome8v1_A;ILLUMINA;《dbSNP》;20130530;ss780866162 |
Low-Frequency IL23R Coding Variant Associated with Crohn’s Disease Susceptibility in Japanese Subjects Identified by Personal Genomics Analysis;Kei Onodera等;《PLOS ONE》;20150916;第10卷(第9期);摘要,表S1 |
Also Published As
Publication number | Publication date |
---|---|
CN106520988A (en) | 2017-03-22 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
EP2161334A1 (en) | Method for determination of progression risk of glaucoma | |
Tesoriero et al. | Molecular characterization and cancer risk associated with BRCA1 and BRCA2 splice site variants identified in multiple‐case breast cancer families | |
CN104293946A (en) | Application of single nucleotide polymorphism rs663743 in detection of lepriasis susceptibility gene | |
CN104293952A (en) | Application of single nucleotide polymorphism rs10817758 in detection of a lepriasis susceptibility gene | |
Emmerson et al. | Characterizing mutations in samples with low‐level mosaicism by collection and analysis of DHPLC fractionated heteroduplexes | |
Riveiro-Alvarez et al. | Frequency of ABCA4 mutations in 278 Spanish controls: an insight into the prevalence of autosomal recessive Stargardt disease | |
Radvanszky et al. | Uninterrupted CCTG tracts in the myotonic dystrophy type 2 associated locus | |
CN106701924B (en) | Application of the single nucleotide polymorphism rs55882956 in screening leper | |
CN106520987B (en) | Application of the single nucleotide polymorphism rs3888722 in screening pemphigus foliaceus patient | |
Sharma et al. | Association of toll-like receptor 2 gene polymorphism (rs3804099) with susceptibility to Schizophrenia risk in the Dogra population of Jammu region, North India | |
CN106520988B (en) | Application of the single nucleotide polymorphism rs76418789 in screening leper | |
CN106399571B (en) | Application of the single nucleotide polymorphism rs181206 in screening leper | |
CN106399572B (en) | Application of the single nucleotide polymorphism rs149308743 in screening leper | |
CN106520985B (en) | Application of the single nucleotide polymorphism rs2178077 in screening pemphigus foliaceus patient | |
CN106399573B (en) | Application of the single nucleotide polymorphism rs145562243 in screening leper | |
CN106755365B (en) | Application of the single nucleotide polymorphism rs780668 in screening leper | |
CN106435001B (en) | Application of the single nucleotide polymorphism rs146466242 in screening leper | |
JPWO2007032496A1 (en) | Method for determining the risk of developing type 2 diabetes | |
de Sousa Dias et al. | New COL6A6 variant detected by whole-exome sequencing is linked to break points in intron 4 and 3′-UTR, deleting exon 5 of RHO, and causing adRP | |
CN107287342B (en) | Application of the mononucleotide polymorphism site rs3129716 in screening dermatitis herpetiformis patient | |
CN107299148B (en) | Application of the mononucleotide polymorphism site rs2523607 in screening dermatitis herpetiformis patient | |
CN109694911B (en) | Screening kit for primary open-angle glaucoma | |
JP2022150707A (en) | METHODS IN WHICH PRESENCE OR ABSENCE OF AMYLOID β ACCUMULATION RISK IS USED AS INDICATOR AS WELL AS METHODS, COMPOSITIONS, AND KITS FOR DETECTING PRESENCE OR ABSENCE OF SINGLE NUCLEOTIDE POLYMORPHISMS (SNPS) | |
CN104293950A (en) | Application of single nucleotide polymorphism rs77061563 in detecting leprosy susceptibility genes | |
CN114427002A (en) | Kit for evaluating type 1 diabetes mellitus risk based on 22 SNP susceptibility sites |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |