CN106399549A - Method for PCR (polymerase chain reaction) detection of and detection kit - Google Patents
Method for PCR (polymerase chain reaction) detection of and detection kit Download PDFInfo
- Publication number
- CN106399549A CN106399549A CN201610969477.XA CN201610969477A CN106399549A CN 106399549 A CN106399549 A CN 106399549A CN 201610969477 A CN201610969477 A CN 201610969477A CN 106399549 A CN106399549 A CN 106399549A
- Authority
- CN
- China
- Prior art keywords
- pcr
- primer
- test kit
- primer pair
- echinococcus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
Abstract
The invention provides a method for PCR (polymerase chain reaction) detection of and a detection kit and relates to the technical field of biological detection. The method includes: designing a primer; selecting PCR amplification conditions. The method can detect samples containing in a targeted manner and is high in accuracy and sensitivity and simple and convenient to operate.
Description
Technical field
The present invention relates to technical field of biological, especially relate to a kind of method that round pcr detects Echinococcus moltilocularis.
Background technology
Echinococcosis (Echinococcosis) are commonly called as echinococcosis (hydatid disease), are by the children of echinococcus
Worm echinococcuss parasitize a kind of infecting both domestic animals and human parasitic disease that the histoorgans such as the liver of animal (including people), lung cause.This disease flows
Row, in global vast pastoral region, is one of global sanitarian major issue.In China, echinococcosis are widely current in north
Side and southwest, are a kind of extremely serious infecting both domestic animals and human parasitic disease of harm.Echinococcuss cestode is recognized at least 9
Kind, it is Echinococcus granulosus (E.granulosus), Echinococcus multilocularis (E.mulitilocularis), Fu Shi spine ball respectively
Cestode (E.vogeli), less section echinococcus (E.oligarthra), Shiqu echinococcus (E.shiquicus), Canadian spine
Ball cestode (E.canadensis), Ovshinsky echinococcus (E.ortleppi) and cat echinococcus (also known as lion echinococcus,
E.felidis).It is alveolitoid spine ball wherein after Echinococcus multilocularis people, also known as alveolar hydatid disease (alveolar
Echinococcosis, AE) or echinococcosis multilocularises, its annual new cases is about 18235, wherein 91% patient in
State.Echinococcus moltilocularis parasitized in intermediate host liver in early stage, caused local liver tissue lesions, hypertrophy, hepatic fibrosis, atrophy, change
Property and necrosis, and clinical symptoms are inconspicuous；Late period shifts like hepatocarcinoma sample, can be transferred to the internal organs such as lung, brain, mammary gland, even if carrying out
Liver divides or the excision treatment of half leaf, and Postoperative recurrent rate is also very high, therefore clinic has the title of " worm cancer ".Untreated AE suffers from according to statistics
10 years case fatality rate of person are up to 94%.Early infection echinococcosis multilocularises patient does not have any symptom, and pastoral area patient is often late
Just it can be seen that so operative treatment can only be carried out.It is currently mainly used the inspection of the iconographys such as B ultrasonic, CT, X-ray and magnetic resonance (MRI)
Look into and the immunological testing such as enzyme-linked immunosorbent assay (ELISA) and Western blotting (Western blotting) is examined
Disconnected.During imaging examination, some atypia are often mutually obscured with hepatocarcinoma and liver abscess etc. with the focus of small volume, and serology is examined
The disconnected crude antigen using then due to a lack of Sensitivity and Specificity, with Echinococcus granulosus (Echinococcus granulosus,
Eg), there is cross reaction in the antigen of cysticercus cellulosae and other parasites.Therefore develop extremely sensitive, special early stage to examine
The method of disconnected echinococcosis multilocularises and test kit are early stage control and a kind of effective method for the treatment of echinococcosis multilocularises, and
Have broad application prospects in use.
Mitochondrial DNA is exposed DNA double chain molecule, mainly annularly, may participate in the synthesis of protein, transcribes and multiple
System.The all genes of mitochondrial DNA are all located on a single ring-shaped DNA molecule, and hereditary material is not coated by nuclear membrane, and not
Compressed by protein.The main feature of mitochondrial DNA is not comprise a lot of non-coding regions, and stability is higher than DNA
A lot, so design, for the primer of Echinococcus moltilocularis mitochondrial DNA, makes the result of detection Echinococcus moltilocularis more stable.
Content of the invention
It is an object of the invention to provide a kind of method that PCR detects Echinococcus moltilocularis, echinococcuss line is directed to by design
The primer of mitochondrial DNA, detects Echinococcus moltilocularis DNA using PCR detection technique.
For achieving the above object, the technical solution used in the present invention is as follows：
A kind of PCR primer pair for detecting Echinococcus moltilocularis, described PCR primer to include outer primer to and/or interior draw
Thing pair,
The sequence of described outer primer pair is as follows：
Forward primer AE-M1F：5’–CATCTGCGGTTAGTCTGT–3’(SEQ ID NO：1)；
Downstream primer AE-M1R：5’–GGTGGACCATCCTTTACT–3’(SEQ ID NO：2)；
The sequence of described inner primer pair is as follows：
Forward primer AE-M2F：5’–GACAGGGATTAGATACCCCATT–3’(SEQ ID NO：3)；
Downstream primer AE-M2R：5’–GTGGACCATTCCCTACTATGC–3’(SEQ ID NO：4).
A kind of PCR detects the test kit of Echinococcus moltilocularis, and this test kit contains PCR primer pair as claimed in claim 1.
Preferably, described test kit also includes dNTPs, Taq enzyme, Mg2+, one or more of PCR reaction buffer.
Preferably, described test kit also includes standard positive template.
A kind of method that PCR detects Echinococcus moltilocularis, the method utilizes above-mentioned PCR primer pair, or above-mentioned test kit
Echinococcus moltilocularis are entered with performing PCR detection.
Preferably, the method comprises the following steps：
1) extract the STb gene in sample tissue；
2) with step 1) in STb gene as template, AE-M1F and AE-M1R is primer, or with AE-M2F and AE-M2R for drawing
Thing, carries out pcr amplification reaction；
3) analyze PCR primer.
It is calculated as with 20 μ L preferably for the PCR reaction system with AE-M1F and AE-M1R for PCR primer pair：
2 × Taq PCR MasterMix, 10 μ L；10 μM of primer AE-M1F, 0.45 μ L；10 μM of primer AE-M1R, 0.45 μ
L；DNA profiling, 2 μ L；ddH2O, 7.1 μ L；Overall reaction system is 20 μ L.
Preferably for the PCR reaction condition with AE-M1F and AE-M1R for PCR primer pair it is：95 DEG C of denaturations 30s,
95 DEG C of degeneration 30s, 52 DEG C of annealing 15s, 72 DEG C of extension 30s, totally 30 circulations；Last 72 DEG C of extension 10min, 1 circulation；Amplification
Primer size is 250-260bp.
It is calculated as with 20 μ L preferably for the PCR reaction system with AE-M2F and AE-M2R for PCR primer pair：
2 × Taq PCR MasterMix, 10 μ L；10 μM of primer AE-M2F, 0.45 μ L；10 μM of primer AE-M2R, 0.45 μ
L；DNA profiling, 2 μ L；ddH2O, 7.1 μ L；Overall reaction system is 20 μ L.
Preferably for the PCR reaction condition with AE-M2F and AE-M2R for PCR primer pair it is：94 DEG C of denaturations 3min；
95 DEG C of degeneration 30s, 63 DEG C of annealing 10s, 72 DEG C of extension 30s, totally 10 circulations；95 DEG C of degeneration 30s, 61 DEG C of annealing 10s, 72 DEG C are prolonged
Stretch 30s, totally 20 circulations；Last 72 DEG C of extension 5min, 1 circulation；Amplified production size is 130-140bp.
Beneficial effects of the present invention are as follows：
(1) accuracy is high, and the present invention designs primer according to Echinococcus moltilocularis mtdna sequence, and through to PCR primer
Carry out sequencing to compare, can accurately detect Echinococcus moltilocularis DNA.
(2) sensitivity is high, and the present invention extracts DNA as template from sample, and with primer AE-M1F, AE-M1R and AE-
M2F, AE-M2R enter performing PCR efficient amplification, worm sources mitochondrial DNA micro in sample can be expanded and are reached the water of detection
Flat.
Brief description
In order to be illustrated more clearly that the specific embodiment of the invention or technical scheme of the prior art, below will be to concrete
In embodiment or description of the prior art the accompanying drawing of required use be briefly described it should be apparent that, below describe in
Accompanying drawing is some embodiments of the present invention, for those of ordinary skill in the art, before not paying creative work
Put, other accompanying drawings can also be obtained according to these accompanying drawings.
Fig. 1 is not contain and contain Echinococcus moltilocularis sample DNA；
Fig. 2 is that the PCR primer of primer AE-M1F and AE-M1R is schemed with 1.5% agarose gel electrophoresiies detection；
Sequencing result after the amplified production glue reclaim for primer AE-M1F and AE-M1R for the Fig. 3；
Fig. 4 is sequencing result Blast comparison result on NCBI；
Fig. 5 is that the PCR primer of primer AE-M2F and AE-M2R is schemed with 1.5% agarose gel electrophoresiies detection；
Fig. 6 is that the nested PCR product of Echinococcus moltilocularis detection kit is schemed with 1.5% agarose gel electrophoresiies detection.
Specific embodiment
Below in conjunction with accompanying drawing, technical scheme is clearly and completely described with the enforcement it is clear that described
Example is a part of embodiment of the present invention, rather than whole embodiments.Based on the embodiment in the present invention, ordinary skill
The every other embodiment that personnel are obtained under the premise of not making creative work, broadly falls into the scope of protection of the invention.
The thinking of the present invention is as follows：Based on the stability of Echinococcus moltilocularis mitochondrial DNA, design is directed to Echinococcus moltilocularis line
The primer of mitochondrial DNA, filters out the specific primer that can distinguish Echinococcus moltilocularis DNA, reuses round pcr and is expanded,
Amplified production is carried out with sequencing compare, learn that whether this amplified production is the amplified production of Echinococcus moltilocularis DNA；Can reach
To the level accurately judging Echinococcus moltilocularis DNA.Primer after optimized and amplification condition carry out PCR experiment proof can be complete
Identification Echinococcus moltilocularis DNA.
Material
1. sample：Sample containing Echinococcus moltilocularis and the sample not containing Echinococcus moltilocularis；
2.DNA extracts：Extracted using QIAamp Circulating Nucleic Acid kit (50 times) test kit；
3.DNA electrophoretic buffer (50x TAE)：Weigh 242g Tris, 37.2g Na2EDTA 2H2O and 57.1mL ice
Acetic acid, adds water to 1000mL, dilutes 50 times during use；
4.2×Taq PCR MasterMix；
5.PCR instrument：Eppendorf AG.
Example 1：
The extraction of DNA
20 μ L Protease K are added in 1.5mL centrifuge tube, plus the sample liquid of 200 μ L, plus the Buffer AL of 200 μ L, whirlpool
Rotation 15s；
56 DEG C of incubation 10min, until cracking is complete, quick centrifugation；
Plus 200 μ L ethanol (100%), vortex 15s, quick it is centrifuged；
Transfer mixed liquor, to Spin column (2mL collecting pipe), 6000g or 8000rpm, from 1min, renews pipe, discards
Old collecting pipe；
Plus 500 μ L Buffer AW1, vortex 15s, 6000g or 8000rpm, from 1min, abandon old pipe and renew pipe；
Plus 500 μ L Buffer AW2, vortex 15s, at full speed (20,000g or 14,000rpm) renew pipe from 1min, at full speed
(20,000g or 14,000rpm) blank pipe is centrifuged 3min；
New centrifuge tube, 100 μ L Buffer AE greenhouses incubate 5min, 6000g or 8000rpm, from 1min, repeat eluting 3
Secondary；
Fig. 1 is the gel electrophoresis figure of the sample containing Echinococcus moltilocularis and the sample not containing Echinococcus moltilocularis；
In Fig. 1, swimming lane 1：DNA Marker D15000；
Swimming lane 2：DNA Marker D2000；
Swimming lane 3-7：Sample containing Echinococcus moltilocularis；
Swimming lane 8-12：Do not contain the sample of Echinococcus moltilocularis.
Example 2：
Design AE-M1F and AE-M1R primer amplification DNA
Design primer AE-M1F and AE-M1R；
AE-M1F：5’–CATCTGCGGTTAGTCTGT–3’(SEQ ID NO：1)；
AE-M1R：5’–GGTGGACCATCCTTTACT–3’(SEQ ID NO：2)；
Primer is synthesized by Sangon Biotech (Shanghai) Co., Ltd.；
As follows from the reaction system of DNA cloning gene using primer AE-M1F and AE-M1R：
PCR reaction condition is：
95 DEG C of denaturations 30sec, 95 DEG C of degeneration 30sec, 52 DEG C of annealing 15sec, 72 DEG C of extension 30sec, totally 30 circulations；
Last 72 DEG C of extension 10min；
Amplified production size is 256bp.
Result：AE-M1F and AE-M1R can amplify sequence from the sample containing Echinococcus moltilocularis, but does not contain
Do not expand out sequence in the sample DNA of Echinococcus moltilocularis, result is as shown in Figure 2.
Swimming lane 1 in Fig. 2：DNA Marker；
Swimming lane 2：Echinococcus moltilocularis protoscolex；
Swimming lane 3-12：Containing Echinococcus moltilocularis sample；
Swimming lane 13-17：Do not contain the sample of Echinococcus moltilocularis；
Swimming lane 18：Negative control.
Example 3：
Extension increasing sequence reclaims and compares analysis
Expanded using DNA fragmentation gel purification test kit (Beijing Tiangeng Bioisystech Co., Ltd) recovery purifying PCR
The gene increasing, then send Sangon Biotech (Shanghai) Co., Ltd. to be sequenced, sequencing result is carried out in data base
Compare.
Fig. 3 is the sequencing result after the amplified production glue reclaim of primer AE-M1F and AE-M1R.
Fig. 4 is sequencing result Blast comparison result on NCBI, and comparison result shows that this amplified fragments is derived from many rooms spine ball
Larva of a tapeworm or the cercaria of a schistosome mitochondrial DNA.
Example 4
Design AE-M2F and AE-M2R primer amplification DNA
Design primer AE-M2F and AE-M2R；
AE-M2F：5’–GACAGGGATTAGATACCCCATT–3’(SEQ ID NO：3)；
AE-M2R：5’–GTGGACCATTCCCTACTATGC–3’(SEQ ID NO：4)；
Primer is synthesized by Sangon Biotech (Shanghai) Co., Ltd.；
Using primer AE-M2F and AE-M2R, from sample, the reaction system of amplification gene is as follows：
PCR reaction condition is：
94 DEG C of denaturations 3min；95 DEG C of degeneration 30sec, 63 DEG C of annealing 10sec, 72 DEG C of extension 30sec, totally 10 circulations；
95 DEG C of degeneration 30sec, 61 DEG C of annealing 10sec, 72 DEG C of extension 30sec, totally 20 circulations；
Last 72 DEG C of extension 5min；
Amplified production size is 136bp.
Result：AE-M2F and AE-M2R can amplify sequence from the sample containing Echinococcus moltilocularis, but does not contain
Do not expand out sequence in the sample DNA of Echinococcus moltilocularis, can be very good to distinguish the sample containing Echinococcus moltilocularis and do not contain
There is the sample of Echinococcus moltilocularis, recall rate is 100%, as shown in Figure 5.
Fig. 5 is that the PCR primer of primer AE-M2F and AE-M2R is schemed with 1.5% agarose gel electrophoresiies detection；
Swimming lane 1 in Fig. 5：DNA Marker；
Swimming lane 2-5：Without Echinococcus moltilocularis sample；
Swimming lane 6,7：Test kit positive quality control；
Swimming lane 8：Empty；
Swimming lane 9-13：Containing Echinococcus moltilocularis sample；
Swimming lane 14：Negative；Swimming lane 15：DNA Marker.
Embodiment 5
The evaluation of Echinococcus moltilocularis nest type PCR detection reagent
Outer primer：AE-M1F and AE-M1R；
AE-M1F：5’–CATCTGCGGTTAGTCTGT–3’(SEQ ID NO：1)；
AE-M1R：5’–GGTGGACCATCCTTTACT–3’(SEQ ID NO：2)；
Inner primer：AE-M2F and AE-M2R；
AE-M2F：5’–GACAGGGATTAGATACCCCATT–3’(SEQ ID NO：3)；
AE-M2R：5’–GTGGACCATTCCCTACTATGC–3’(SEQ ID NO：4)；
Primer is synthesized by Sangon Biotech (Shanghai) Co., Ltd.；
As follows from the reaction system of DNA cloning gene using primer AE-M1F and AE-M1R：
PCR reaction condition is：
95 DEG C of denaturations 30sec, 95 DEG C of degeneration 30sec, 52 DEG C of annealing 15sec, 72 DEG C of extension 30sec, totally 30 circulations；
Last 72 DEG C of extension 10min；Collect external primer amplification product.
Primer extension product is template in addition, as follows with inner primer amplification reaction system：
Echinococcus moltilocularis detection kit can amplify from the sample containing Echinococcus moltilocularis and positive quality control sample
Sequence, but do not contain in the sample DNA of Echinococcus moltilocularis and do not expand out sequence, can be very good to distinguish and contain many rooms spine ball
The sample of the larva of a tapeworm or the cercaria of a schistosome and the sample not containing Echinococcus moltilocularis, recall rate is 100%, as shown in Figure 6.
Fig. 6 is that the nested PCR product of Echinococcus moltilocularis detection kit is schemed with 1.5% agarose gel electrophoresiies detection；
Swimming lane 1 in Fig. 6：DNA Marker；
Swimming lane 2-4：Do not contain the sample of Echinococcus moltilocularis；
Swimming lane 5-6：Test kit positive quality control
Swimming lane 7-12：Sample containing Echinococcus moltilocularis；
Swimming lane 13：Negative；
Swimming lane 14：DNA Marker.
Finally it should be noted that：Various embodiments above only in order to technical scheme to be described, is not intended to limit；To the greatest extent
Pipe has been described in detail to the present invention with reference to foregoing embodiments, it will be understood by those within the art that：Its according to
So the technical scheme described in foregoing embodiments can be modified, or wherein some or all of technical characteristic is entered
Row equivalent；And these modifications or replacement, do not make the essence of appropriate technical solution depart from various embodiments of the present invention technology
The scope of scheme.
SEQUENCE LISTING
<110>Light accurate medical science and technology company limited is known in Qinghai by Qinghai University
<120>PCR detects method and the detection kit of Echinococcus moltilocularis
<160> 4
<170> PatentIn version 3.5
<210> 1
<211> 18
<212> DNA
<213>Artificial sequence
<400> 1
catctgcggt tagtctgt 18
<210> 2
<211> 18
<212> DNA
<213>Artificial sequence
<400> 2
ggtggaccat cctttact 18
<210> 3
<211> 22
<212> DNA
<213>Artificial sequence
<400> 3
gacagggatt agatacccca tt 22
<210> 4
<211> 21
<212> DNA
<213>Artificial sequence
<400> 4
gtggaccatt ccctactatg c 21
Claims (10)
1. a kind of PCR primer for detecting Echinococcus moltilocularis to it is characterised in that：Described PCR primer is to inclusion outer primer pair
And/or inner primer pair,
The sequence of described outer primer pair is as follows：
Forward primer AE-M1F：5’–CATCTGCGGTTAGTCTGT–3’(SEQ ID NO：1)；
Downstream primer AE-M1R：5’–GGTGGACCATCCTTTACT–3’(SEQ ID NO：2)；
The sequence of described inner primer pair is as follows：
Forward primer AE-M2F：5’–GACAGGGATTAGATACCCCATT–3’(SEQ ID NO：3)；
Downstream primer AE-M2R：5’–GTGGACCATTCCCTACTATGC–3’(SEQ ID NO：4).
2. a kind of PCR detect Echinococcus moltilocularis test kit it is characterised in that：This test kit contains as claimed in claim 1
PCR primer pair.
3. test kit according to claim 2 it is characterised in that：Described test kit also includes dNTPs, Taq enzyme, Mg2+、
One or more of PCR reaction buffer.
4. the test kit according to Claims 2 or 3 it is characterised in that：Described test kit also includes standard positive template.
5. a kind of PCR detect Echinococcus moltilocularis method it is characterised in that：The method utilizes the PCR primer described in claim 1
Right, or the test kit described in any one of claim 2-4 Echinococcus moltilocularis are entered performing PCR detection.
6. method according to claim 5 is it is characterised in that the method comprises the following steps：
1) extract the STb gene in sample tissue；
2) with step 1) in STb gene as template, AE-M1F and AE-M1R is primer, or with AE-M2F and AE-M2R as primer,
Carry out pcr amplification reaction；
3) analyze PCR primer.
7. method according to claim 6 is it is characterised in that for the PCR with AE-M1F and AE-M1R for PCR primer pair
Reaction system is calculated as with 20 μ L：
2 × Taq PCR MasterMix, 10 μ L；10 μM of primer AE-M1F, 0.45 μ L；10 μM of primer AE-M1R, 0.45 μ L；DNA
Template, 2 μ L；ddH2O, 7.1 μ L；Overall reaction system is 20 μ L.
8. method according to claim 6 is it is characterised in that for the PCR with AE-M1F and AE-M1R for PCR primer pair
Reaction condition is：95 DEG C of denaturations 30s, 95 DEG C of degeneration 30s, 52 DEG C of annealing 15s, 72 DEG C of extension 30s, totally 30 circulations；Finally
72 DEG C of extension 10min, 1 circulation；Amplified production size is 250-260bp.
9. method according to claim 6 is it is characterised in that for the PCR with AE-M2F and AE-M2R for PCR primer pair
Reaction system is calculated as with 20 μ L：
2 × Taq PCR MasterMix, 10 μ L；10 μM of primer AE-M2F, 0.45 μ L；10 μM of primer AE-M2R, 0.45 μ L；DNA
Template, 2 μ L；ddH2O, 7.1 μ L；Overall reaction system is 20 μ L.
10. method according to claim 6 is it is characterised in that for AE-M2F and AE-M2R for PCR primer pair
PCR reaction condition is：94 DEG C of denaturations 3min；95 DEG C of degeneration 30s, 63 DEG C of annealing 10s, 72 DEG C of extension 30s, totally 10 circulations；
95 DEG C of degeneration 30s, 61 DEG C of annealing 10s, 72 DEG C of extension 30s, totally 20 circulations；Last 72 DEG C of extension 5min, 1 circulation；Amplification
Primer size is 130-140bp.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610969477.XA CN106399549A (en) | 2016-10-28 | 2016-10-28 | Method for PCR (polymerase chain reaction) detection of and detection kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610969477.XA CN106399549A (en) | 2016-10-28 | 2016-10-28 | Method for PCR (polymerase chain reaction) detection of and detection kit |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106399549A true CN106399549A (en) | 2017-02-15 |
Family
ID=58014593
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610969477.XA Pending CN106399549A (en) | 2016-10-28 | 2016-10-28 | Method for PCR (polymerase chain reaction) detection of and detection kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106399549A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109762910A (en) * | 2019-01-10 | 2019-05-17 | 四川省疾病预防控制中心 | It is a kind of for detecting the primer and kit of amphitypy echinococcosis simultaneously |
| CN111518877A (en) * | 2020-05-12 | 2020-08-11 | 青海大学 | One-tube method nest type real-time quantitative PCR detection kit for detecting echinococcus multilocularis and echinococcus granulosus by parting trace samples |
| CN115961057A (en) * | 2022-12-29 | 2023-04-14 | 北京亿森宝生物科技有限公司 | Echinococcosis detection primer, probe, kit and application |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104164512A (en) * | 2014-08-26 | 2014-11-26 | 中国农业科学院兰州兽医研究所 | PCR-RFLP detection kit for authenticating and differentiating infections of echinococcus multilocularis and echinococcosis shiquicus |
-
2016
- 2016-10-28 CN CN201610969477.XA patent/CN106399549A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104164512A (en) * | 2014-08-26 | 2014-11-26 | 中国农业科学院兰州兽医研究所 | PCR-RFLP detection kit for authenticating and differentiating infections of echinococcus multilocularis and echinococcosis shiquicus |
Non-Patent Citations (2)
| Title |
|---|
| DINKEL等人: "Detection of Echinococcus multilocularis in the Definitive Host: Coprodiagnosis by PCR as an Alternative to Necropsy", 《JOURNAL OF CLINICAL MICROBIOLOGY 》 * |
| 杨俊萍等人: ""多房棘球蚴线粒体ND1基因分析及PCR检测方法"", 《动物检疫学分会2010年年会论文集》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109762910A (en) * | 2019-01-10 | 2019-05-17 | 四川省疾病预防控制中心 | It is a kind of for detecting the primer and kit of amphitypy echinococcosis simultaneously |
| CN111518877A (en) * | 2020-05-12 | 2020-08-11 | 青海大学 | One-tube method nest type real-time quantitative PCR detection kit for detecting echinococcus multilocularis and echinococcus granulosus by parting trace samples |
| CN115961057A (en) * | 2022-12-29 | 2023-04-14 | 北京亿森宝生物科技有限公司 | Echinococcosis detection primer, probe, kit and application |
| CN115961057B (en) * | 2022-12-29 | 2023-09-08 | 北京亿森宝生物科技有限公司 | Echinococcosis detection primer, probe, kit and application |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102747165B (en) | Reagent kit and method for quickly detecting tilapia streptococcus agalactiae by using loop-mediated isothermal amplification technology | |
| CN111518877B (en) | One-tube method nest type real-time quantitative PCR detection kit for detecting echinococcus multilocularis and echinococcus granulosus by parting trace samples | |
| CN109913564B (en) | Primer probe composition, kit and method for detecting chlamydia pneumoniae | |
| CN113481311B (en) | SNP molecular marker for identifying Brucella vaccine strain M5 and application thereof | |
| CN107385112A (en) | Detect nucleic acid, real-time fluorescence RPA kits and the method for the type of pig circular ring virus 3 | |
| CN106399549A (en) | Method for PCR (polymerase chain reaction) detection of and detection kit | |
| CN106987626A (en) | For a variety of fungies of quick detection and identify primer and probe and its application of strain | |
| CN109880896A (en) | A kind of multiple LAMP kit and detection method for the specific parting of quick discriminating bacteria polymyxins drug resistant gene mcr | |
| CN111286559A (en) | Primer, probe and kit for detecting African swine fever virus | |
| CN114634990A (en) | RPA primer, probe and detection method for detecting Nocardia seriolae | |
| CN109306372A (en) | A kind of method nest-type PRC detection or/and identify brucella | |
| CN111793704A (en) | SNP molecular marker for identifying Brucella vaccine strain S2 and wild strain and application thereof | |
| CN113025696A (en) | High-sensitivity detection method for hydatid cyst based on high-throughput sequencing and application | |
| CN110804677B (en) | Nested double PCR detection primer and kit for distinguishing wild strain and gene deletion strain of African swine fever virus | |
| WO2011006449A1 (en) | Retrotransposons of schistosoma japonicum and uses thereof | |
| CN109749960B (en) | Method and device for evaluating constipation risk and constipation degree based on contents of various intestinal bacteria | |
| CN108504756B (en) | Aeromonas veronii detection primer, kit, detection method and development method thereof based on specific sequence | |
| CN112501280B (en) | High-sensitivity detection method for hydatid cyst based on high-throughput sequencing | |
| RU2607025C1 (en) | Synthetic oligonucleotide primers and method for detecting rna atypical pestivirus of cattle | |
| CN113755618A (en) | Method for detecting brucellosis of animals with high sensitivity | |
| WO2022023564A1 (en) | Whole nucleic acids rt-qpcr method for detecting histoplasma capsulatum fungus pathogen(s), histoplasmosis diagnosis and treatment methods, means thereof | |
| CN107312869B (en) | Kit for detecting silkworm microsporidian by PCR-ELISA method and detection method thereof | |
| CN106521030A (en) | Dual fluorescent quantitation RT-PCR detection method for classical swine fever virus (CSFV) and bovine viral diarrhea virus (BVDV) | |
| CN112941212A (en) | Universal primer group, kit and method for on-site detection of brucella | |
| CN102337357B (en) | Primers and probe for detecting mouse reovirus type III and method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170215 |
|
| RJ01 | Rejection of invention patent application after publication |