WO2011006449A1

WO2011006449A1 - Retrotransposons of schistosoma japonicum and uses thereof

Info

Publication number: WO2011006449A1
Application number: PCT/CN2010/075217
Authority: WO
Inventors: 王升跃; 夏超明; 郑华军; 郭俊杰; 许静
Original assignee: 上海人类基因组研究中心; 苏州大学
Priority date: 2009-07-16
Filing date: 2010-07-16
Publication date: 2011-01-20
Also published as: CN102010861A; CN102010861B

Abstract

Disclosed are retrotransposons of Schistosoma japonicum and uses thereof. Specifically, provided is a retrotransposon having any one of nucleotide sequences selected from sequences showed by SEQ ID NOs:1-25. The retrotransposon may act as marker for blood fluke detection. Also disclosed are primers/primer pairs which specifically amplify said retrotransposon sequences.

Description

Application of DNA target sequence of Schistosoma japonicum inversion in the diagnosis of schistosomiasis

Technical field

The present invention is in the field of biotechnology and genetics, and more particularly, the present invention relates to schistosomiasis inversion and its use. Background technique

Schistosomiasis is a serious threat to human health and causes enormous economic losses in developing countries in Africa, Asia and South America. Schistosoma japonicum is distinct from other schistosomiasis in ecology and biology. It is one of the most serious schistosomiasis diseases with the most serious harm to human health. It has been in China for more than 2,100 years. In the early days of liberation, it was widely popular in 12 provinces, municipalities and autonomous regions in the Yangtze River Basin of China, with an area of 14.8 billion square meters of host snails. In recent years, due to changes in the economic system and the ecological environment of the Yangtze River Basin and the increase of floating population, the area of snail snails has expanded and the source of infection has spread. The schistosomiasis epidemic in China has shown an upward trend, and some areas have rebounded significantly and gradually spread to cities.

The repeated epidemics of schistosomiasis has attracted the attention of the state, and the Ministry of Health has listed it as one of the four major infectious diseases. In February 2004, the State Council established the National Leading Group for the Prevention and Control of Schistosomiasis, and put forward the requirement of “taking the source, comprehensively managing, relying on scientific and technological progress, and resolutely curbing the schistosomiasis epidemic.” In May 2004, the National Conference on Prevention and Control of Schistosomiasis was held. "The work of schistosomiasis prevention and control is related to people's physical health and life safety, and is related to social and economic development and social stability." The diagnosis of schistosomiasis has long relied on pathogens. Direct detection, that is, inspection of fecal eggs as one of the main diagnostic methods. Since the eggs excreted from the feces account for only 17% of the total number of eggs laid, most of them occur in advanced patients. Although there are many improvements in the method of testing eggs, it is still cumbersome in the actual operation of epidemic areas. And inconvenience, especially the sensitivity of its diagnosis is poor, and the rate of missed detection for patients with early infection, mild and repeated chemotherapy is higher. Since the 1920s, immunological techniques have been applied to the diagnosis of schistosomiasis, for example, the use of intradermal reactions to diagnose schistosomiasis has achieved good results. Subsequently, after extensive research and continuous improvement, dozens of immunological detection methods have been established, and new methods for detecting circulating antigens and circulating immune complexes of schistosomiasis have been developed, which greatly promoted the immunological detection methods of schistosomiasis. Further development.

Due to the immunomodulatory effects of schistosomiasis-infected hosts, the dynamics of circulating antigens, circulating antigen-antibody immune complexes and specific antibodies in infected hosts are very inconsistent. So far, there is a lack of effective diagnostic tools for schistosomiasis infection, especially 疔Method of effectiveness assessment.

In recent years, research on the inversion of transposon from the whole genome of Schistosoma japonicum has attracted more and more attention. Many scholars have done a lot of research. So far, known Schistosoma japonicum reversal Extremely limited. Summary of the invention

It is an object of the present invention to provide a class of schistosomiasis inversion.

Another object of the present invention is to provide a primer pair and a reagent cartridge corresponding to the Schistosoma reversal.

Another object of the present invention is to provide the use of the schistosomiasis inversion. In a first aspect of the invention, an isolated polynucleotide comprising a nucleotide sequence selected from any one of SEQ ID NOS: 1-25 is provided. In another preferred embodiment, the polynucleotide has the nucleotide sequence shown in SEQ ID NO: 19 or SEQ ID NO: 10.

In a second aspect of the invention, the use of the polynucleotide is provided as a schistosomiasis detection marker, or the polynucleotide is used as a schistosomiasis detection marker, or a kit for detecting schistosomiasis Or DNA chip.

In addition, the inverted locus of the present invention can also be used for: determination of the genetic relationship of schistosomiasis; localization of schistosomiasis genes; conservation analysis of various or subspecies of schistosomiasis; evolutionary analysis of schistosomiasis; or identification of species or geographical populations of schistosomiasis .

In another preferred embodiment, the Schistosoma japonicum is Schistosoma japonicum

. In a third aspect of the invention, a primer pair is provided, the amplification product obtained by amplification of the primer pair having an inverted transposon sequence selected from any one of SEQ ID NOS: 1-25.

In another preferred embodiment, the primer (pair) is a primer which amplifies the nucleotide sequence shown in SEQ ID NO: 19 or 10 or a fragment thereof, and more preferably, the primer (pair) is selected from the group consisting of SEQ ID NO: the sequence shown in 26-29 or the sequence shown in SEQ ID NOs: 30-31.

In a fourth aspect of the invention, there is provided the use of said primer pairs for the preparation of a kit for detecting the presence or absence of a polynucleotide corresponding to the inverted cassette of the first aspect of the invention in the genome of the schistosomiasis .

In a fifth aspect of the invention, a method of determining a genetic relationship between schistosomiasis in two or more samples is provided, the method comprising -

(1) using the inverted subsequence sequence as a marker;

(2) amplifying the genomic DNA of Schistosoma japonicum in the two or more samples by specifically amplifying the primer of the inverted transposon sequence of (1) to obtain a corresponding amplification product;

(3) Compare the similarities and differences of amplification products of schistosomiasis in two or more samples to determine the genetic relationship between schistosomiasis in two or more samples.

In another preferred embodiment, the number and/or position of the amplified product is analyzed by electrophoresis, and amplification is performed. The higher the number and/or positional identity of the product, the closer the genetic relationship between two or more species of Schistosomiasis; the greater the difference in the number and/or position of entries in the amplified product, indicating two or more species of Schistosoma The farther the genetic relationship is between.

In a sixth aspect of the invention, there is provided a test kit comprising the specific primer pair described in the third aspect of the invention.

In another preferred embodiment, the kit further comprises a material selected from the group consisting of a PCR amplification reagent, an electrophoresis reagent, or a sequence analysis software.

In a seventh aspect of the invention, there is provided a polynucleotide set for genetic analysis, the polynucleotide set comprising the inverted vector represented by any one of SEQ ID NOs: 1-25 sequence.

In another preferred embodiment, the polynucleotide set comprises the inverted transposon sequence of 25 of SEQ ID NOs: 1-25.

In an eighth aspect of the invention, there is provided a DNA chip having a substrate and a nucleotide sequence immobilized on the substrate as inverted as shown in any one of SEQ ID NOs: 1-25 A stalk or a specific fragment thereof.

It is to be understood that within the scope of the present invention, the above-described various technical features of the present invention and the technical features specifically described in the following (as in the embodiments) may be combined with each other to constitute a new or preferred technical solution. For example, an upper limit for a large range (e.g., 10-100) may be combined with a lower limit 20 of another preferred smaller range (e.g., 20-80) to form another range (e.g., 20-100), and vice versa. Of course. Due to space limitations, it is not repeated here.

Other aspects of the invention will be apparent to those skilled in the art from this disclosure. DRAWINGS

Figure 1 shows a schematic representation of the SjCHGCS19.P1-P2 target sequence.

Figure 2 shows the sensitivity of SjCHGCS19.Pl-P2 target sequence detection. The lanes in the figure are as follows: M: lOObp DNA Ladder molecular weight standard; 1: undiluted adult template DNA; 2~9: 1 : 10~1 : 10 ⁸ diluted worm template DNA; l : 10 ⁷ (21.47fg/ul); 10. Blank control.

Figure 3 shows the sensitivity of nested PCR detection of the SjCHGCS 19.P3-P4 target sequence. The lanes in the figure are as follows: M: 100 bp DNA Ladder molecular weight standard; 1 to ⁸ : 1 : 10~1 : 10 ⁸ diluted worm template DNA. The highest detection sensitivity is 1: 10 ⁷ (21.47fg/ul).

Figure 4 shows the detection sensitivity of the constructed TA cloning plasmid DNA. The lanes in the figure are as follows: M: 100 bp DNA Ladder molecular weight standard; 1 to 14: DNA detection results after dilution of the plasmid 1:10 to 1:10 ¹⁴ . The results showed that the detection sensitivity was 2.02 copies (corresponding to a dilution of 1:10"). Figure 5 shows the detection specificity of the SjCHGCS19. P1-P2 target sequence. The lanes in the figure are as follows: M: 100 bp DNA Ladder molecular weight standard; 1: male; 2: liver tissue; 3: liver fluke. The results showed that the amplified band was 303 bp in size and did not cross-react with liver fluke.

Figure 6 shows the results of SjCHGCS19. P1-P2 target sequence detection of 50 serum DNA from rabbits infected with Schistosoma japonicum. The lanes in the figure are as follows: M: 100 bp DNA Ladder molecular weight standard; 1: normal rabbit serum; 2: infection for 3 days; 3 to 9: infection for 1 week to 7 weeks; 10 to 18: infection for 9 weeks to 24 weeks (interval 1 week test); 19: positive control.

Figure 7 shows the results of the efficacy test of SjCHGCS19.Pl-P2 target sequence for detecting serum DNA of rabbits infected with Schistosoma japonicum. The lanes in the figure are as follows: M: 100 bp DNA Ladder molecular weight standard; 1: Negative control (normal rabbit serum); 2-18: Peripheral serum at 8 weeks after 8 weeks of infection with Schistosoma japonicum cercariae; 19-21: 20 weeks after praziquantel treatment 20 weeks (25 weeks after infection, 27 weeks) Serum DNA was negative for 3 weeks; 22: Positive control (Schistosoma japonicum adult).

Figure 8 shows the detection sensitivity of the SjCHGCSlO.P1-P3 target sequence. The lanes in the figure are as follows: M: lOObp DNA Ladder molecular weight standard; 1 undiluted adult template DNA; 2~ 7: 1:10~1:10 ⁷ diluted worm template DNA; highest detection sensitivity is 1 : 10 ⁶ (214.7fg/ul) 8. Blank control.

Figure 9 shows the results of detection of serum DNA of human schistosomiasis by nested PCR based on the SjCHGCS19.P1-P2 target sequence. The lanes in the figure are as follows: 1~22: DNA template of different patients infected with Schistosoma japonicum (the intensity of band reaction is positively correlated with the degree of infection EPG); P: positive control; N: negative control. detailed description

The inventors have conducted extensive and in-depth research to discover 25 different types of new inverted transposon sequences by studying the genome and transcriptome of Schistosoma japonicum, including 18 LTR inverted transposons SjCHGCS1~ 5" JCHGCS18) , 4 kinds of Non-LTR inverted nests, SjCHGCS19~ S JCHGCS22) and 3 kinds of Penelope type inverted nests (5 '- ^ 2£^03⁄4^~ -/1⁄2?77£? 0^. The complete sequence copy number of these 25 new inverted transposons in the Schistosoma japonicum genome ranges from 1 to 130, while the incomplete sequence copy number (only partial sequences of inverted transposons) is from 15 to 6384 unequal. With so many copy numbers, these 25 new inverted occupants account for 17% of the entire Schistosoma japonicum genome. It is also found that 21 of the inverted transposons have expression activity. The mobile elements may play an important role in the evolution, pathogenicity and parasitism of schistosomiasis. The present invention has been completed on the basis of this. As used herein, the term "containing" or "including" includes "including". "mainly by "", "consisting of" and "consisting of".

As used herein, "inverted splicing sequence" and "inverted splicing" are used interchangeably and each refers to having a nucleotide sequence selected from any one of SEQ ID NOS: 1-25.

As used herein, a "polynucleotide set" is a collection of polynucleotides comprising a polynucleotide set forth in any one of SEQ ID NOS: 1-25. When used in genetic analysis, one or more of said polynucleotides can be selected from said polynucleotides as inverted epitope markers.

As used herein, "isolated" means that the substance is separated from its original environment (if it is a natural substance, the original environment is the natural environment). For example, the polynucleotides and polypeptides in the natural state in living cells are not isolated and purified, but the same polynucleotide or polypeptide is separated and purified, such as from other substances existing in the natural state. . Primer

According to the sequence of the two ends of the transposon according to the present invention, a pair of specific primers can be designed, and the inverted transposon sequence can be amplified by PCR technology, and the length polymorphism can be obtained by using techniques such as sequencing or electrophoresis analysis.

Accordingly, the present invention provides primers (; pairs;) that can be used to amplify said inverted transposons. The primers (pairs;) were designed based on the conserved sequences at the ends of these inverted parents. Primer design methods are well known to those skilled in the art. In general, different primers can be designed for one inverted locus based on their sequence at both ends, and the most suitable primers can be determined by PCR. More specifically, when designing primers, similar Tm temperatures are employed to enable these primers to be used in high throughput amplification and detection. In addition, it is necessary to ensure the uniqueness of the site where the primer is amplified. In general, 18-26 bp oligonucleotide primers have better specificity.

Using the primers described, the corresponding retrotransposons in the genome of the schistosomiasis (especially Schistosoma japonicum) can be amplified. Furthermore, using the same primer pair and using genomic DNA of Schistosoma japonicum from different sources as a template, a polynucleotide comprising a polymorphic inverted motif structure (e.g., different numbers of inverted repeats or different lengths) can be obtained. Application

The inverted adapters of the present invention and their corresponding primers have a variety of uses including, but not limited to, for: determination of the genetic relationship of schistosomiasis; localization of schistosomal genes; conservation analysis of various or subspecies of schistosomiasis; Evolutionary analysis; or identification of schistosomiasis varieties. Genetic analysis

After having learned the inverted reps or the corresponding specific primers provided by the present invention, one skilled in the art can determine the genetic relationship (or kinship) of schistosomiasis by using various techniques known in the art. The gene of trematode, for the conservative analysis of various or subspecies of schistosomiasis, the evolution analysis of schistosomiasis, or the identification of schistosomiasis, or the identification of schistosomiasis. Since the PCR amplification of the inverted cassette is specific amplification, its stability and reproducibility are both good.

The method for detecting the product after PCR amplification can employ a technique well known to those skilled in the art, and the most convenient and easiest method is to use agarose gel electrophoresis. The difference in amplification products is determined by comparing the number and/or size of the amplified bands. The method is simple in operation and low in cost.

Another more elaborate method is to use the gene scanning of the sequencer to distinguish the difference of 1-2 bases in the size of the PCR product. Gene scanning can be performed using software known to those skilled in the art, such as GenMapper 4.0 software. Test kit or system

The invention also provides a detection kit or system comprising: a primer capable of specifically amplifying an inverted transposon sequence selected from any one of SEQ ID NOs: 1-25 (Correct;).

In addition, the kit contains various materials for analyzing the genetic relationship of schistosomiasis, locating the schistosomiasis gene, conserving analysis of various or subspecies of schistosomiasis, evolution analysis of schistosomiasis or identification of schistosomiasis. For example, a material selected from the group consisting of a PCR amplification reagent, an electrophoresis reagent, a PCR product purification reagent, or a sequence analysis software may be included. These reagents can all be conventionally used by those skilled in the art.

In addition, the kit may also contain instructions for use to explain the method of use of the kit, and to give suitable conditions for use. Advantages and effects of the present invention:

1. Developed a class of schistosomiasis-specific reflexes that help to elucidate genetic differences between Schistosoma japonicum populations.

2. For the specific primers (pairs) of each of the inverted transposons, the primers have a good amplification effect and the amplification products are unique. The invention is further illustrated below in conjunction with specific embodiments. It is to be understood that the examples are not intended to limit the scope of the invention. The experimental methods in the following examples which do not specify the specific conditions are usually carried out according to the conditions described in conventional conditions such as Sambrook et al., Molecular Cloning: Laboratory Guide (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer. The suggested conditions. Percentages and parts are by weight unless otherwise stated. Example 1 Acquisition of inverted nests and primer design

1. Extraction of DNA from adult worms of Schistosoma japonicum Phenol extraction and ethanol precipitation using DNA:

1) Take a single worm and put 200 μΐ extraction buffer to wash the worm 3 times, and centrifuge at 2 000 g for 2 min to separate the washing solution;

2) blot the washing solution, add 20 μl of extraction buffer, and grind the insect body to homogenate with RNAase-free sterile small grinding rod;

3) Add extraction buffer to a final volume of 50 μΐ;

4) Add 0.5 μΐ RNAase (10 ug/μΐ), 5μ1 SDS (10%), 0.5 μΐ protein digestive enzyme, and mix repeatedly with a gun;

5) Digestion at a temperature of 110 rpm/56 °C in a double-temperature water bath oscillator _;

6) Add an equal volume of 50 μM phenol: chloroform: isopropanol is a mixture of 25:24:1, mix well, 10 000 g, centrifuge for 5 min;

7) Take the supernatant, add 50 μl of chloroform: isopropanol is a mixture of 24:1, mix well, 10000 g, centrifuge for 5 min;

8) Take the supernatant, add 80 μl absolute ethanol, mix and mix at -30 °C overnight;

9) Add 1 ml of 70% ethanol, 10000 g, and centrifuge for 15 min;

10) Remove the lower layer solution and add 10 μl ( Η ₂ 0, ready to use.

Or use protease Κ digestion method -

1) Wash the worms with 200 μl ϋΝΤ buffer 3 times, 2 000 g, and centrifuge for 2 min to separate the washing solution;

2) Drain the washing solution, add 20 l of GNT buffer, and grind the insect body to homogenate with an RNAase-free sterile small grinding rod;

3) Add 40 1 GNT buffer and rotate for 10 s;

14) Add Ιμΐ protease digestive enzyme, mix thoroughly with a pipette, digest at l 10 rpm in a double water bath at 56 °C for 1 h _;

5) 10000 g, centrifuge for 5 min, place at room temperature, transfer the supernatant to a clean 1.5 ml EP tube; 6) Add 50 μΙ ΝΙϋ buffer, shake for 30 s, set at room temperature for 3 min;

7) Rotate mixing for 30 s, 95. C 15 min inactivated protease digestion enzyme;

8) 10000 g, centrifuge for 5 min, take the supernatant to a clean 1.5 ml EP tube and set aside.

2. Inversion of the acquisition of the seat

The extracted DNA is sequenced to obtain genomic sequence data. The initial data was then obtained from the genomic database, and after further analysis, experimentation, and selection, 25 inverted transposons were finally obtained, the sequences of which are shown in SEQ ID NO: 125.

Based on the sequences shown in SEQ ID NO: 1-5, primers were designed using Primer 5.0 software to synthesize 25 pairs of specific primers, respectively. Amplifying the phase with the whole genome DNA of the Schistosoma japonicum sample as a template Amplification products for 25 inverted transposons.

The PCR cycling conditions were: 95 °C 5 mm; 94 °C 45 s, 55 °C 45 s, 72 °C 45 s, 30 cycles; 72 °C 10 min. The PCR reaction system was: 25 ng genomic DNA, 2 units of SBS Taq polymerase, bidirectional primers of 10 pm, 1.25 mM MgCl ₂ , 1 μΐ 10 X reaction buffer, 0.5 μΐ dNTPs (2.5 mM, TaKaRa).

The PCR product was purified by a conventional method, followed by genetic analysis, and the genetic analysis method was as follows:

(1). Electrophoretic identification of PCR products

The number and/or position of the amplified product is analyzed by electrophoresis. The higher the number and/or positional consistency of the amplified product, the closer the genetic relationship between the two schistosomiasis; the number of entries of the amplified product The greater the difference in position and/or position, the further the genetic relationship between the two schistosomiasis.

(2) . Gene scanning of the sample

The PC product was separated using an ABI 3730 XL automated sequencer and the exact length of the DNA fragment of the PCR product was determined using an ABI Genescan-500 LIZ (Applied Biosystems) molecular internal standard. Initial data processing was performed using ABI 3730 XL and GenMapper 4.0 software (Applied Biosystems). Result:

25 different types of new inverted transposon sequences (as shown in Table 1), including 18 LTR inverted transposons (SJCHGCS 1 to SJCHGCS 18), 4 Non-LTR inverted reciprocators CSjCHGCS 19 to SjCHGCS22 ) and three Penelope-type inverted nests (Sj-penelope l~Sj-penelope3). Studies have shown that the complete sequence copy number of these 25 new inverted transposons in the Schistosoma japonicum genome ranges from 1 to 130, while the incomplete sequence copy number (only partial sequences of inverted transposons;) 15 to 6384. With so many copy numbers, these 25 new inverted nests account for 17% of the entire Schistosoma japonicum genome. At the same time, 21 of the inverted transposons were found to have expression activity. It is suggested that these active de-possions (mobile dements) may play an important role in the evolution, pathogenicity and parasitism of schistosomiasis.

Shock] /: O / 3⁄4s Bu I> d 6ioooAV

Table 1 25 Schistosoma japonicum inversions

Incomplete copy of the complete copy Inverted Season Name Length (bp) LTR Pol Pro RT RNH Int

Number of numbers NO:

LTR inverted carrier

SJCHGCS1 5249 332 1360-4437 1360-1615 1876-2937 2695-3025 3265-3802 130 1650 1

SjCHGCS2 4945 361 430-4482 1480-1741 1939-2503 2758-3163 3442-3958 32 930 2

SjCHGCS3 4451 292 320-4201 1100-1349 1607-2168 2420-2735 3053-3590 17 646 3

SjCHGCS4 4710 312 325-4407 1153-1555 1741-2311 2563-2932 3214-3763 6 208 4

SjCHGCS5 2148 304 338-1870 1286-1574 19 762

SJCHGCS6 4839 353 379_4476 1327-1720 1891-2461 2713-3070 3394-3913 11 826 6

SJCHGCS7 4000 409 13-2870 513-666 816-1323 1539-1908 2145-2643 6 600 7

SjCHGCSH 4865 932-3817 1091-1655 1895-2255 2678-3281 2 662 8

SjCHGCS 4779 308 316-4467 1213-1609 1795-2365 2617-2986 3268-3814 4 294 9

SjCHGCSlO 5025 868-4065 988-1342 1513-2080 2335-2680 2914-3457 29 758 10

SjCHGCSH 6488 559 861-4898 1788-2139 2310-2874 3126-3480 3711-4251 5 542 11

SjCHGCSH 4965 415 438-4541 1401-1797 1965-2535 2787-3144 3474-3993 12 605 12

SjCHGCSi3 5099 527 573-4478 1623-1887 2091-2655 2910-3315 3597-4113 9 628 13

SjCHGCS14 5211 399-4922 1383-1647 2295-2859 3129-3519 3801-4317 3 381 14

S CHGCS15 4711 190 329-4378 1385-1649 1886-2450 2705-3110 3389-3905 5 479 15

SjCHGCS16 7232 1236 806-5830 2006-2438 2828-3647 3812-4277 4721-5309 1 515 16

SjCHGCSH 6960 995 940-5982 2140-2554 3241-3811 4057-4423 4855-5461 3 508 17

SjCHGCSIS 5985 400 386-5626 1694-2108 2786-3356 3596-3965 4412-5018 7 532 18

Non-LTR reverse seat

SJCHGCS19 3145 108-3131 82 2384 19

S CHGCS20 3578 610-3366 16 1530 20

S CHGCS21 4275 266-4039 1 15 21

SjCHGCSH 3768 Incomplete 1 386 22

Penelop sample ^ (Penelope-like el ement)

Sj-penelope I "50 756-3215 2 700 2

Sj-penelope2 2734 137 405-2051 10 643 24

Sj-penelope3 2512 230-1732 528 25

The inventors also performed structural analysis on the inverted reciprocators of the LTR, Non-LTR and pene lope types. Among the 18 LTR inverted transposons, except for SjCHGCS8, SjCHGCSW W SjCHGCSim, the remaining 15 LTR inverted reciprocators have long terminal repeats (LTR) at both ends, ranging in length from 190 bp to 1236 bp; all 18 LTRs The inverted transposons have a complete polyprote in coding frame; except for SJCHGC5 and SjCHGC8 ^ , the remaining 16 LTR inverted transposons can distinguish between proteases (Proteas e) and reverse transcriptase (in the pol yprote in coding frame). Reverse Transcr i ptase), the coding gene of RNaseH and Inte grase; only the coding sequence of protease can be identified in SJdC ^, and the coding sequence of protease can not be identified in SJ^^S. Of the four Non-LTR and three pene lope type inversions, only SJCHGCS22 does not have a complete po lyprote in coding frame.

A 137 bp inverted repeat was found at both ends.

Based on the accurate analysis of these 25 new Schistosoma japonicum inversion sequences, the inventors believe that these newly discovered inverted transposon sequences can be used as potential schistosomiasis detection markers, and can be used to find out with Schistosoma japonicum Related targets such as pathogenesis and immune evasion can be used as a vector for gene therapy to help study vaccines and drugs against schistosomiasis. Example 2

Detection method and application based on inverted seat SjCHGCS 19

Diagnosis is always at the center of schistosomiasis control activities. To date, pathogen examination, that is, the detection of eggs from the feces of people in epidemic areas, is still the only diagnostic route and means of schistosomiasis. When a certain pathogen infects the body, its genes are also brought into the human body. In theory, as long as the pathogen exists, the nucleic acid substance exists in the body. For the 25 inverted transposons in the Schistosoma japonicum genome listed in Table 1, in this example, the inverted codon S jCHGCS 19 (SEQ ID NO: 19) was selected as a representative for further study.

The results indicate that the inverted polynucleotide SjCHGCS 19 polynucleotide is suitable as a marker for schistosomiasis detection and is also suitable for the preparation of kits or DNA chips for detecting schistosomiasis.

For example, SjCHGCS 19 PI-P2 fragment (303 bp) and its SjCHGCS 19 P3-P4 fragment (607 bp) (S 19 PI primer: AAGGCGTTTGACAGCGTAG (SEQ ID NO: 26); S19 P2 primer: ATCATCCGCGAAGTCCAG (SEQ ID NO: 27) S19 P3 Primer: CCAAATCGCAACACTACGC (SEQ ID NO: 28); S19 P Primer: ATCGGATTCTCCTTGTTCAT (SEQ ID NO: 29) ) As a target sequence (Fig. 1), detection of Schistosoma japonicum-specific DNA by nested PCR showed extremely high Sensitivity and specificity, where sensitivity can be increased to 2 copies (Figure 2, Figure 3 and Figure 4) and no cross-reactivity with liver flukes (Figure 5).

Furthermore, the serum DNA test results of the animal model of Schistosoma japonicum infection showed that the 303 bp schistosomiasis could be amplified from the serum of rabbits infected with 50 cercariae of Schistosoma japonicum for 3 days. Specific DNA fragments (Figure 6). In addition, serum DNA of 1500, 500, 200, 100, and 30 rabbits infected with Schistosoma japonicum was also detected, and the results obtained in Fig. 6 were obtained. Therefore, the method of the invention is very suitable for early detection.

In addition, the results of serum samples after treatment with praziquantel showed that the inverted transposon of the present invention has a good therapeutic value, and the serum of Schistosoma japonicum in the serum was negative at 17 weeks after treatment and its specific antibody remained at the same time. High level (Figure 7).

In addition, the SjCHGCS 19. Pl-P2 target sequence was used for DNA detection of sera from chronic schistosomiasis patients. The results are shown in Table 1 and Figure 9.

Table 1 Results of nested PCR for serum DNA test in patients with schistosomiasis

Methods The positive rate of positive samples of serum samples of patients was positive. The positive rate of positive samples of serum samples was nested PCR 100 96 96. 0% 20 0 0% Note: 100 patients were from schistosomiasis in Hunan Province, all of which were tested by EPG. Positive. Of particular interest, as shown in Figure 9, the intensity of the amplified band reaction of DNA from different sera of Schistosoma japonicum is positively correlated with the degree of infection EPG. Example 3

Detection method and application based on inverted seat SjCHGCS 10

Similar to Example 2, in the present example, the inverted nester SjCHGCS 10 (SEQ ID NO: 10) was selected as a representative for further study.

The sensitivity of the SjCHGCS lO. P1–P3 target sequence detection is shown in Figure 8. The highest detection sensitivity is 1: 10 ^s (214. 7fg/ul). Wherein the primer is SjCHGCSl O. PI _: GCCAGTGGGCATCTCCTT (SEQ ID NO: 30); SjCHGCS lO. P3: CGGGCTGGCAATCAGTAA (SEQ ID NO: 31).

In addition, DNA was detected in the serum of chronic schistosomiasis patients using the SjCHGCSl O. PI-P3 target sequence. Similar to the test results of Example 2, the positive detection rate was as high as 92% or more, and the amplification band reaction intensity of DNA was also positively correlated with the infection degree EPG. All documents mentioned in the present application are hereby incorporated by reference in their entirety in their entireties in the the the the the the the the the In addition, it should be understood that various modifications and changes may be made to the present invention, and the scope of the invention is defined by the scope of the appended claims.

Claims

Rights request

An isolated polynucleotide, characterized in that the polynucleotide has a nucleotide sequence selected from any one of SEQ ID NOS: 19, 1-18 and 20-25.

The use of the polynucleotide according to claim 1, wherein the polynucleotide is used as a marker for detection of schistosomiasis or a kit for detecting schistosomiasis or a DNA chip.

A primer pair, characterized in that the amplification product obtained by amplification of the primer pair has an inverted subsequence selected from any one of SEQ ID NOS: 1-25.

The use of the primer pair according to claim 3, characterized in that it is used for preparing a kit for detecting the presence or absence of a polynucleotide corresponding to the inverted vector of claim 1 in the genome of the schistosomiasis.

5. A method of determining a genetic relationship between schistosomiasis in two or more samples, characterized in that the method comprises the following steps -

(1) using the inverted subsequence sequence of claim 1 as a marker;

A test kit comprising the primer set according to claim 3 in the kit.

The test kit according to claim 6, wherein the kit further comprises a material selected from the group consisting of a PCR amplification reagent, an electrophoresis reagent, or a sequence analysis software.

A polynucleotide set for genetic analysis, characterized in that the polynucleotide set comprises the inverted transposon sequence shown by any one of SEQ ID NOS: 1-25.

The polynucleotide set according to claim 8, wherein the polynucleotide set comprises the inverted transposon sequence shown by 25 of SEQ ID NOS: 1-25.

A DNA chip having a substrate and a nucleotide sequence immobilized on the substrate, such as the inverted cassette shown in any one of SEQ ID NO: 1-25 or Specific fragment.