CN110257556B

CN110257556B - Nucleic acid detection kit for pathogenic pathogen of sexually transmitted diseases

Info

Publication number: CN110257556B
Application number: CN201910365375.0A
Authority: CN
Inventors: 陈翀; 刘华勇; 季宇
Original assignee: Guangzhou Pushi Lihua Technology Co ltd
Current assignee: Guangzhou Pushi Lihua Technology Co ltd
Priority date: 2019-04-30
Filing date: 2019-04-30
Publication date: 2023-04-18
Anticipated expiration: 2039-04-30
Also published as: CN110257556A

Abstract

The invention discloses a nucleic acid detection kit for STD (Sexually transmitted diseases) pathogenic pathogens. According to the invention, the specific nucleic acid sequence site capable of detecting the STD-related pathogen based on the CRISPR/Cas12a is obtained through research, express, sensitive and specific qualitative detection of the STD pathogen can be realized aiming at the site, the STD pathogen nucleic acid detection method and the detection kit are constructed based on the technology, not only can the target single-molecule accurate detection be realized, but also the multi-site simultaneous detection can be realized, the clinical detection effect is excellent, and the method has important significance and application prospect for the detection and screening of the STD pathogen.

Description

Nucleic acid detection kit for pathogenic pathogen of sexually transmitted diseases

Technical Field

The invention belongs to the technical field of molecular biology. More particularly, it relates to a nucleic acid detection kit for pathogenic pathogen of sexually transmitted diseases.

Background

Sexually Transmitted Disease (STD) is one of the most common infectious diseases prevalent worldwide, and its onset and prevalence are closely related to lifestyle, and is a group of diseases that are mainly Transmitted by sexual contact. The prevalence of sexually transmitted diseases has gradually emerged as a situation of expanding prevalence, suffering from reduced age and increased severity over the last two decades, and has become a serious public health problem that must be faced in common by all humans. 8 STDs including syphilis, gonorrhea, genital herpes, condyloma acuminatum, chancroid, nongonococcal urethritis, lymphogranuloma veneris and AIDS are listed as the key venereal diseases in China. STD can be caused by viruses, bacteria and parasites, and there are several common pathogens: human Immunodeficiency Virus (HIV), chlamydia Trachomatis (CT), treponema Pallidum (TP), neisseria Gonorrhoeae (NG), toxoplasma Gondii (TG). In order to realize the early detection of STD and control the propagation risk thereof, it is very important to develop a diagnostic method for detecting the pathogen of STD accurately, efficiently and rapidly at low cost.

Conventional pathogen detection techniques such as (1) isolation and culture techniques: pathogen isolation culture, particularly for pathogenic microorganisms and viruses, is the gold standard for early pathogen detection. However, the method takes a long time for separation and culture, cannot realize rapid detection result in a short time, is highly dependent on hardware of a detection laboratory and conditions of experiment operators, and is not suitable for detection of pathogenic microorganisms and viruses without mature culture means at present. (2) immunological detection: pathogen-associated proteins are recognized in an antigen-antibody based immune response, and the pathogen is detected at the protein level. The method has the problems of low detection sensitivity, large influence of environment on specificity and the like, long detection window period, incapability of meeting diagnosis and treatment requirements, suitability for preliminary screening, incapability of serving as a basis for timely diagnosis, incapability of identifying different subtypes of the same pathogen and the like.

Molecular-based diagnostic methods can improve the speed and accuracy of detecting resistance genes, which is of great interest for infection control, prevention, and treatment in hospitals and community environments. The current molecular diagnostic methods are mainly Polymerase Chain Reaction (PCR): comprises common PCR, allele specificity PCR, real-time fluorescence quantitative PCR, PCR-Sanger sequencing technology, PCR-gene chip technology and the like. PCR is used for detecting pathogens from the nucleic acid level, and the whole experiment needs 1 to 2 hours to complete. The main disadvantage of this method is that PCR detection is carried out by relying on a PCR instrument or an expensive real-time quantitative PCR instrument, and other various supporting equipment, as well as a special PCR laboratory and professional operators. The PCR detection cannot realize instant detection, bedside diagnosis and scene application without specific laboratory detection conditions, so that the detection requirements of a basic level, a user terminal and a field cannot be met. Meanwhile, PCR detection may have problems of false positive, insufficient sensitivity and the like.

Disclosure of Invention

The invention aims to solve the technical problems of overcoming the defects and shortcomings of the existing STD pathogen detection technology, researching and obtaining the STD pathogen nucleic acid detection site based on the CRISPR/Cas12a system, realizing the nucleic acid detection of the STD pathogen by utilizing the CRISPR/Cas12a system aiming at the site, and having good specificity, high sensitivity and low false positive.

The invention aims to provide an STD pathogenic nucleic acid detection site based on a CRISPR/Cas12a system and a gRNA combination.

The invention also aims to provide a CRISPR/Cas12a detection system for the STD pathogenic gene.

The invention further aims to provide a method for detecting the STD pathogenic nucleic acid based on the CRISPR/Cas12a system.

The above purpose of the invention is realized by the following technical scheme:

the invention researches and discovers an STD pathogenic nucleic acid detection target site based on a CRISPR/Cas12a system, and the STD pathogenic nucleic acid detection based on the CRISPR/Cas12a system can be carried out aiming at the site, so that the detection specificity is good, and the sensitivity is high.

The sequence of the STD pathogenic nucleic acid detection target site is shown in any one of SEQ ID NO. 1-16. Can specifically distinguish different types of STD pathogens and comprises a PAM sequence recognized by Cas12 a.

Meanwhile, the application of the target site in serving as an STD pathogenic nucleic acid detection site and the application in serving as an STD pathogenic nucleic acid detection site based on a CRISPR/Cas12a system are both within the protection scope of the invention.

Based on the research result, the invention also provides an STD pathogen detection method based on the CRISPR/Cas12a system, which is used for detecting the target site by using the CRISPR/Cas12a system.

In particular to CRISPR nucleic acid detection by using a Cas12a protein and a gRNA corresponding to the target site.

The design principle of the gRNA is as follows: when a gRNA targeting sequence is selected, the 5' end of the targeting sequence should have a 5' -TTTN-3' sequence, and a stable secondary structure is not formed among the targeting sequence, the targeting sequence and the rest sequences.

As a preferred alternative, the sequence of the gRNA is shown in any one or any several of SEQ ID NO. 17-51.

The invention also provides a CRISPR/Cas12a detection system or kit of STD pathogenic nucleic acid, which comprises Cas12a protein and gRNAs, wherein the sequences of the gRNAs correspond to any one target site shown in SEQ ID NO. 1-16. Preferably, the sequence of the gRNA is as shown in any one or several of SEQ ID NO. 17-51.

In addition, the Cas12a protein is a Cas12a protein having endonuclease activity and accessory cleavage activity. Such as LbCas12a, ssCas12a, scCas12a, fnCas12a, asCas12a, etc.

The sequence of the ScCas12a is shown as SEQ ID NO.52, the sequence of the SsCas12a is shown as SEQ ID NO.53, the sequence of the LbCas12a refers to Addge number pMAL-His-LbCpf1-EC (Plasmid # 79008), the sequence of the FnCas12a refers to Addge number 6-His-MBP-TEV-FnCpf1 (Plasmid # 90094), and the sequence of the AsCas12a refers to Addge number AsCpf1-2NLS (Plasmid # 102565).

The invention has the following beneficial effects:

the invention researches and discovers an STD pathogenic nucleic acid detection target site based on a CRISPR/Cas12a system, the STD pathogenic nucleic acid detection can be realized by utilizing the CRISPR/Cas12a system aiming at the site, the detection specificity is good, the sensitivity is high, the high-sensitivity and high-precision molecular detection can be realized at the room temperature of 25-37 ℃, the specificity and the compatibility are better, the detection cost is low, and the operation is convenient and quick. The detection limit value can reach attomole level (10) ^-18 mole/L) to realize the detection of target single molecules; meanwhile, the kit can realize simultaneous detection of multiple sites, has excellent clinical detection effect, and has important significance for detection and screening of STD (acute respiratory syndrome) pathogens.

Drawings

FIG. 1 is a graph showing the effect of gRNA detection on different target sites of Human Immunodeficiency Virus (HIV) in example 2.

FIG. 2 is a graph showing the effect of gRNA detection on different target sites of Chlamydia Trachomatis (CT) in example 2.

FIG. 3 shows the effect of gRNA detection on different target sites of Treponema Pallidum (TP) in example 2.

FIG. 4 shows the effect of gRNA detection on different target sites of Toxoplasma Gondii (TG) in example 2.

FIG. 5 shows the effect of gRNA detection on different target sites of Neisseria Gonorrhoeae (NG) in example 2.

FIG. 6 is a graph showing the effect of the test on 10 Neisseria gonorrhoeae positive clinical specimens in example 4.

Detailed Description

The invention is further described with reference to the drawings and the following detailed description, which are not intended to limit the invention in any way. It will be appreciated by those skilled in the art that various other changes, modifications, substitutions, combinations, and omissions may be made in the form and detail of the invention without departing from the spirit and scope of the invention.

Reagents, methods and apparatus used in the present invention are conventional in the art unless otherwise indicated. Unless otherwise indicated, reagents and materials used in the following examples are commercially available.

The immunology, biochemistry, chemistry, molecular biology, microbiology, cell biology, genomics, recombinant DNA, and the like, as used herein, are within the ordinary skill of the art, unless otherwise indicated. See Sambrook (Sambrook), friechi (Fritsch) and manitis (manitis), molecular cloning: a LABORATORY Manual (Molecular CLONING: A Laboratory Manual), 2 nd edition (1989); a Current Manual of MOLECULAR BIOLOGY experiments (Current PROTOCOLS IN MOLECULAR BIOLOGY BIOLOGY) (edited by F.M. Otsubel et al, (1987)); METHODS IN ENZYMOLOGY (METHODS IN Enzymology) series (academic Press): "PCR 2: PRACTICAL methods" (PCR 2: a LABORATORY Manual (ANTIBODIES, A LABORATORY MANUAL), and animal cell CULTURE (ANIMAL CELL CURTURE) (R.I. Freusney, ed. Lei Xieni (R.I. Freshney, 1987)).

Example 1 discovery of STD pathogenic nucleic acid detection site based on CRISPR/Cas12a System

We obtain the STD pathogen genome sequence, and search the specific identification region of each plant type of STD pathogen through bioinformatics analysis and comparison. The specific operation method comprises the following steps of searching a whole genome sequence of the pathogen in an NCBI nucleic acid sequence library, obtaining all the existing whole genome sequences of the pathogen and screening out a reference genome according to the sequence integrity; homology analysis was performed on the above genomic sequences to find the target gene sequence of the pathogen that is conserved among different genomic sequences but specific for the human genome (hg 19). And (3) with 20bp base as a unit, searching sequences containing TTTN in the sequences and deriving related sequences as an alternative database of gRNA targeting sequences. The STD common infectious pathogens we screened in this patent: human Immunodeficiency Virus (HIV), chlamydia Trachomatis (CT), neisseria Gonorrhoeae (NG), treponema Pallidum (TP), toxoplasma Gondii (Toxoplasma Gondii). By evaluating different type differences of related pathogen targets, the specificity of each alternative gRNA sequence among different strains, series parameters such as GC content, base uniformity, sequence conservation and the like of the alternative gRNA sequence, and through a large number of experiments, gRNAs are designed aiming at different regions, a CRISPR/Cas12a system is constructed for research, and finally, the specific identification target of the STD pathogen is obtained through confirmation, wherein the sequence is shown in SEQ ID NO. 1-16. The sequences shown in SEQ ID NO.17-51 are used as STD pathogenic nucleic acid detection gRNAs based on a CRISPR/Cas12a system, and the obtained detection schemes all have good detection effects (Table 1).

TABLE 1 target genes and corresponding gRNA targeting sequences referred to in this patent

/>

/>

/>

Example 2 case of STD pathogenic nucleic acid detection based on CRISPR/Cas12a System

1. CRISPR/Cas12a gene cloning and protein expression

The Cas12a protein gene derived from Lachnospiraceae bacteria is adopted, and the gene is more suitable for being expressed in mammalian cells through codon optimization. The optimized Cas12a protein gene is cloned into pET28a plasmid with a 6-His histidine tag, so that the protein can be conveniently purified and expressed. Cas12a protein recombinant expression vector transformation, BL21star (DE 3) is adopted by expression bacteria.

The specific protein expression conditions are as follows: in culture broth OD ₆₀₀ 0.5mM IPTG was added at 0.6 and cultured for 4 hours. Collecting thallus and purifying protein. The purification conditions were: the cells were resuspended in lysate (50mM Tris, pH8.0, 300mM NaCl,5% glycerol, 20mM imidazole), sonicated (70% amplitude, 2s On/4s off,3 min, sonic 750w sonicator), the supernatant centrifuged, purified On a nickel column, eluted with lysate containing 250mM imidazole, the fractions concentrated, and purified On a Superdex 200, tricorn 10/300 gel chromatography column. And performing SDS-PAGE detection and gel column purification, and storing the obtained purified Cas12a protein at-80 ℃.

2. Preparation of target DNA

The target nucleotide may be amplified by PCR amplification, recombinase Polymerase Amplification (RPA), NASBA isothermal amplification, or loop-mediated isothermal amplification (LAMP), strand Displacement Amplification (SDA), helicase-dependent amplification (HDA), and Nicking Enzyme Amplification Reaction (NEAR).

Recombinase Polymerase Amplification RPA (recombination Polymerase Amplification): the method comprises the steps of designing an RPA Primer by using NCBI Primer blast, wherein the size of an amplified fragment is 80-120nt, the denaturation temperature of the Primer can be 54-67 ℃, opt =60, the length is 30-35nt, opt =32, the GC content in the Primer is 40-60%, and synthesizing a DNA Primer according to a designed sequence.

The template sequence is shown as SEQ ID NO.1 in example 1 (derived from the HIV genomic sequence).

Wherein the RPA primer comprises:

FP:AAGGAGTAGTGGAGTCTATGAATAAGGAA

RP:TATATCGTTATTGTCCTGTATTACCACTGC

reference to

Basic and->

The BasicRT (twist dx) kit performs the RPA reaction except that 280mM of MgAc, i.e. magnesium acetate, is added before the template fragment is added. The reaction was carried out at 37 ℃ for 30 minutes. The target DNA was obtained after purification using MinElute gel extraction kit (Qiagen) kit.

3. Preparation of gRNA

gRNA primer sequence design principle: when selecting a target sequence, the 5' end of the target sequence should have a 5' -TTTN-3' sequence; and a stable secondary structure is not formed among the targeting sequence, the targeting sequence and the rest sequences. The design can be assisted by http:// www.rgenome.net/cas-designer/online software.

gRNA primer structure:

5 '-targeting sequence- "ATCTACACTTAGTAGAAATTA" -CCCTATAGTGAGTCGTATTACA-3'

Wherein the "ATCTACACTTAGTAGAAATTA" sequence may be replaced with "ATCTACAACAGTAGAAATTA" or "ATCTACAACAGTAGAAATTA" or "ATCTACAACAGTAGAAATTA" or "GCATGAGAACCATGCATTTC" or "ACCTAATTACTAGGTAATTT" or "ATCTACAAAAGTAGAAATCC" or "ATCTACAATAGTAGAAATTA" or "ATCTACAAAGTAGAAATTAT" or "ATCTACAAACAGTAGAAATT".

Mixing the DNA fragment with T7 promoter, T7 primer and T7 polymerase, and incubating overnight at 37 ℃ according to the kit instructions of T7 RNAPLymerase kit (Thermo); purified gRNAs were obtained using the RNeasy mini kit (Qiagen).

T7 primer sequence: TGTAATACGACTCACTATAGGG

T7gRNA primer sequence:

"targeting sequence" -5'-ATCTACACTTAGTAGAAATTACCCTATAGTGAGTCGTATTACA-3'

The targeting sequence includes: SEQ ID NO.17-51

4. Validity verification of single CRISPR/Cas12a pathogen detection system

The detection system comprises: mu.l RPA product, 45nM purified LbCas12a,22.5nM gRNA,100nM reporter DNA strand that fluoresces upon cleavage of LbCas12a, i.e., non-specific single-stranded DNA fluorescent probe (DNAseAlert QC System, thermo Scientific), 0.5. Mu.l RNase inhibitor (Promega), and nuclease assay buffer (20mM Tris,60mM NaCl,10mM MgCl 2, pH 7.3). The reaction was placed in a fluorescence analyzer (BioTek) and reacted at 37 deg.C (unless otherwise stated) for 30min, and the final fluorescence was read for interpretation.

Analysis of CRISPR/Cas12a reaction fluorescence data: to calculate fluorescence data with background removed, facilitating comparison between different conditions, the initial fluorescence of the sample is removed. Background fluorescence (without target nucleotides or without grnas) was removed from the sample, and data was obtained subtracting background fluorescence. After removing background fluorescence of the sample, the sample is defined as positive when the fluorescence value is more than or equal to 3 times of that of the negative control sample, and the sample is defined as negative when the fluorescence value is less than 3 times of that of the negative control sample.

The detection results are shown in FIGS. 1 to 5, and the results show that: the Cas12a protein and the designed gRNA can recognize a cleavage target site and generate a fluorescent signal, which indicates that the designed gRNA sequence can specifically recognize a related pathogen target sequence and can be used for qualitative detection of related pathogens.

5. Specificity verification of single CRISPR/Cas12a detection system

3 groups of experiments are set, RPA products of 3 different target genes are taken, one gRNA corresponding to the RPA products and two irrelevant gRNAs are respectively selected for combined reaction, and the specificity of the gRNA sequence is verified. The method comprises the following specific operations: selecting 3 target genes (SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO. 3) from 16 target sequences in the table 1, taking RPA products of the 3 different target genes, respectively carrying out CRISPR/Cas12a shearing reaction on 3 different gRNAs (SEQ ID NO.17, SEQ ID NO.21 and SEQ ID NO. 23), taking sterilized water as a blank control, taking a sample without target nucleic acid as a negative control, and keeping other conditions unchanged. Positive is defined as a value greater than or equal to 3 times the value of the fluorescence of the negative control sample after removal of background fluorescence from the sample.

The results show that: the reaction of SEQ ID NO.1 with the corresponding gRNA (SEQ ID NO. 17) is positive, the reaction with the non-corresponding gRNA (SEQ ID NO.21 and SEQ ID NO. 23) is negative, and no fluorescence value is generated in the detection result. The reaction of SEQ ID NO.2 with the corresponding gRNA (SEQ ID NO. 21) is positive, the reaction with the non-corresponding gRNA (SEQ ID NO.17 and SEQ ID NO. 23) is positive, and no fluorescence value is generated in the detection result, and the detection result is negative. The reaction of SEQ ID NO.3 with the corresponding gRNA (SEQ ID NO. 23) is positive, the reaction with the non-corresponding gRNA (SEQ ID NO.17 and SEQ ID NO. 21) is positive, and no fluorescence value is generated in the detection result, and the detection result is negative. The results prove that the target sequences of the three pathogens and the gRNA sequences are mutually specific, and the corresponding gRNAs have good specificity. Specific results are shown in table 2.

TABLE 2 specificity verification combination and experimental result of single CRISPR/Cas12a detection system

Reactive combination	Form panel	gRNA	As a result, the
				Combination 1	SEQ ID NO.1	SEQ ID NO.17 (target sequence is SEQ ID NO. 1)	Positive for
Combination 2	SEQ ID NO.1	SEQ ID NO.21 (target sequence is SEQ ID NO. 2)	Negative of
				Combination 3	SEQ ID NO.1	SEQ ID NO.23 (target sequence is SEQ ID NO. 3)	Negative of
Combination 4	SEQ ID NO.2	SEQ ID NO.17 (target sequence is SEQ ID NO. 1)	Negative of
				Combination 5	SEQ ID NO.2	SEQ ID NO.21 (target sequence is SEQ ID NO. 2)	Positive for
Combination 6	SEQ ID NO.2	SEQ ID NO.23 (target sequence is SEQ ID NO. 3)	Negative of
				Combination 7	SEQ ID NO.3	SEQ ID NO.17 (target sequence is SEQ ID NO. 1)	Negative of
Combination 8	SEQ ID NO.3	SEQ ID NO.21 (target sequence is SEQ ID NO. 2)	Negative of
				Combination 9	SEQ ID NO.3	SEQ ID NO.23 (target sequence is SEQ ID NO. 3)	Positive for

Example 3 multiplex STD pathogenic nucleic acid detection method based on CRISPR/Cas12a System

To achieve simultaneous detection of multiple pathogens, we developed multiple detection systems for the above pathogen targets. Since Human Immunodeficiency Virus (HIV) in STD pathogens is RNA virus and needs reverse transcription or RT-RPA to carry out CRISPR/Cas12a detection, the multiplex detection system development is carried out on only 4 STD pathogens (Chlamydia trachomatis, neisseria gonorrhoeae, treponema pallidum and Toxoplasma gondii). The identification regions of the 4 pathogen genomes and the corresponding gRNA sequences are analyzed, and a reaction system and a gRNA combination mode are optimized according to the parameters of sequence similarity, GC content, base uniformity, the existence or non-existence of a secondary hairpin structure, the existence or non-existence of cross reaction of the same reaction and the like.

1. The method comprises the following specific operations: after the grnas are prepared according to the method of step 3 in example 2, 4 grnas are taken and mixed in equal proportion (SEQ ID No.23, SEQ ID No.25, SEQ ID No.28 and SEQ ID No. 33), and then a CRISPR/Cas12a detection system is prepared according to the method of step 4 in example 2 to detect the specificity of the multiple gRNA method. The templates in the detection reaction are respectively the RPA products of the target genes corresponding to the selected gRNAs, which are SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7 and SEQ ID NO.8. In the experiment, sterile water is used as a blank control, a sample without target nucleic acid is used as a negative control, and other conditions are not changed. When the background fluorescence of the sample is removed in the result analysis, the positive result is defined as the value which is more than or equal to 3 times of the fluorescence value of the negative control sample.

The experimental result shows that after the RPA products (SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO. 6) of the specific target genes are added into the multiple gRNA reaction system, specific fluorescence is generated, and the result is positive; after the RPA products (SEQ ID NO.7 and SEQ ID NO. 8) of the nonspecific target gene are added into the multiple gRNA reaction system, no fluorescence is generated, and the result is negative; the multiple CRISPR/Cas12a detection system established by the experiment has good specificity.

2. Based on the above experimental results, in order to perform qualitative detection on the 4 STD pathogens simultaneously, we combine and optimize the target genes and gRNA sequences screened by this patent, and select 1-2 target sites and corresponding grnas for combination for each pathogen. And optimizing the combination mode according to the principles of GC content, no hairpin structure, no cross reaction and the like. In this example, we selected two gRNA combination schemes by computational simulation and experimental validation. Scheme one, 7 kinds of gRNA equal ratio mix, 7 kinds of gRNA are respectively: SEQ ID NO.23 (target sequence SEQ ID NO. 3), SEQ ID NO.27 (target sequence SEQ ID NO. 4), SEQ ID NO.32 (target sequence SEQ ID NO. 6), SEQ ID NO.40 (target sequence SEQ ID NO. 10), SEQ ID NO.43 (target sequence SEQ ID NO. 11), SEQ ID NO.44 (target sequence SEQ ID NO. 12), and SEQ ID NO.49 (target sequence SEQ ID NO. 15); scheme two, 7 kinds of gRNA equal ratio mix, 7 kinds of gRNA are respectively: SEQ ID NO.23 (target sequence SEQ ID NO. 3), SEQ ID NO.31 (target sequence SEQ ID NO. 6), SEQ ID NO.37 (target sequence SEQ ID NO. 9), SEQ ID NO.40 (target sequence SEQ ID NO. 10), SEQ ID NO.41 (target sequence SEQ ID NO. 11), SEQ ID NO.47 (target sequence SEQ ID NO. 14) SEQ ID NO.50 (target sequence SEQ ID NO. 16).

To validate these two protocols, we used the chlamydia trachomatis genome, treponema pallidum genome, neisseria gonorrhoeae genome, toxoplasma gondii genome as templates, respectively, to validate the specificity of the two gRNA combinations. A CRISPR/Cas12a detection system was formulated to detect the specificity of the multiple gRNA method, following the method of step 4 in example 2. The experimental result shows that the genomic nucleic acids of four pathogens are added into the combined multiple gRNA reaction system, specific fluorescence is generated, and the result is positive (Table 3). The multiple CRISPR/Cas12a detection system established aiming at 4 STD pathogens has good specificity.

Table 3. Multiple CRISPR/Cas12a detection system specificity verification combination and experimental result

/>

/>

In this example, we only present the combination scheme of the pathogenic genomic nucleic acid sample to two grnas, and it is within the scope of the present patent to use the gRNA sequences listed in this patent for other combinations. It will be appreciated by those skilled in the art that alternative methods conventional in the art may be employed instead of one or more of the steps of cloning of the Cas12a gene, construction of a recombinant expression vector, expression and purification of the Cas12a protein, amplification of the target nucleotide/target gene fragment, etc., as is conventional in the art, in order to achieve similar or equivalent effects.

Example 4 CRISPR/Cas12a System-based clinical sample detection

10 cervical swab samples were collected and confirmed to be positive for Neisseria gonorrhoeae by fluorescent quantitative PCR. After nucleic acid extraction is carried out on the batch of samples, CRISPR/Cas12a technology detection is carried out by using the scheme of the invention.

The specific method comprises the following steps:

1. nucleic acid treatment: the swab was repeatedly washed with 1ml of physiological saline, and the nucleic acid was extracted from the eluate by column extraction (oral swab genome extraction kit) using 30. Mu.l of sterile water to dissolve the nucleic acid product.

2. The CRISPR/Cas12a gene cloning and protein expression, gRNA preparation (SEQ ID No. 43), pathogen detection system and fluorescence detection method refer to example 2 above, where the positive control is a synthetic target gene plasmid (SEQ ID No. 11).

3. The experimental result is shown in fig. 6, the detection of 10 clinical samples has fluorescence, and the fluorescence is positive, which indicates that the CRISPR/Cas12a system can successfully detect the neisseria gonorrhoeae clinical sample.

In addition, the sequences shown above in SEQ ID NO.52 and SEQ ID NO.53 are as follows:

SEQ ID No.52: (sequence of ScCas12 a)

ATGCAGACCCTGTTTGAGAACTTCACAAATCAGTACCCAGTGTCCAAGACCCTGCGCTTTGAGCTGATCCCCCAGGGCAAGACAAAGGACTTCATCGAGCAGAAGGGCCTGCTGAAGAAGGATGAGGACCGGGCCGAGAAGTATAAGAAGGTGAAGAACATCATCGATGAGTACCACAAGGACTTCATCGAGAAGTCTCTGAATGGCCTGAAGCTGGACGGCCTGGAGGAATACAAGACCCTGTATCTGAAGCAGGAGAAGGACGATAAGGATAAGAAGGCCTTTGACAAGGAGAAGGAGAACCTGCGCAAGCAGATCGCCAATGCCTTCCGGAACAATGAGAAGTTTAAGACACTGTTCGCCAAGGAGCTGATCAAGAACGATCTGATGTCTTTCGCCTGCGAGGAGGACAAGAAGAATGTGAAGGAGTTTGAGGCCTTCACCACATACTTCACCGGCTTCCACCAGAACCGCGCCAATATGTACGTGGCCGATGAGAAGAGAACAGCCATCGCCAGCAGGCTGATCCACGAGAACCTGCCAAAGTTTATCGACAATATCAAGATCTTCGAGAAGATGAAGAAGGAGGCCCCCGAGCTGCTGTCTCCTTTCAACCAGACCCTGAAGGATATGAAGGACGTGATCAAGGGCACCACACTGGAGGAGATCTTTAGCCTGGATTATTTCAACAAGACCCTGACACAGAGCGGCATCGACATCTACAATTCCGTGATCGGCGGCAGAACCCCTGAGGAGGGCAAGACAAAGATCAAGGGCCTGAACGAGTACATCAATACCGACTTCAACCAGAAGCAGACAGACAAGAAGAAGCGGCAGCCAAAGTTCAAGCAGCTGTATAAGCAGATCCTGAGCGATAGGCAGAGCCTGTCCTTTATCGCCGAGGCCTTCAAGAACGACACCGAGATCCTGGAGGCCATCGAGAAGTTTTACGTGAATGAGCTGCTGCACTTCAGCAATGAGGGCAAGTCCACAAACGTGCTGGACGCCATCAAGAATGCCGTGTCTAACCTGGAGAGCTTTAACCTGACCAAGATCTATTTCCGCTCCGGCACCTCTCTGACAGACGTGAGCCGGAAGGTGTTTGGCGAGTGGAGCATCATCAATAGAGCCCTGGACAACTACTATGCCACCACATATCCAATCAAGCCCAGAGAGAAGTCTGAGAAGTACGAGGAGAGGAAGGAGAAGTGGCTGAAGCAGGACTTCAACGTGAGCCTGATCCAGACCGCCATCGATGAGTACGACAACGAGACAGTGAAGGGCAAGAACAGCGGCAAAGTGATCGTCGATTATTTTGCCAAGTTCTGCGACGATAAGGAGACAGACCTGATCCAGAAGGTGAACGAGGGCTACATCGCCGTGAAGGATCTGCTGAATACACCCTGTCCTGAGAACGAGAAGCTGGGCAGCAATAAGGACCAGGTGAAGCAGATCAAGGCCTTTATGGATTCTATCATGGACATCATGCACTTCGTGCGCCCCCTGAGCCTGAAGGATACCGACAAGGAGAAGGATGAGACATTCTACTCCCTGTTCACACCTCTGTACGACCACCTGACCCAGACAATCGCCCTGTATAACAAGGTGCGGAACTATCTGACCCAGAAGCCTTACAGCACAGAGAAGATCAAGCTGAACTTCGAGAACAGCACCCTGCTGGGCGGCTGGGATCTGAATAAGGAGACAGACAACACAGCCATCATCCTGAGGAAGGAAAACCTGTACTATCTGGGCATCATGGACAAGAGGCACAATCGCATCTTTCGGAACGTGCCCAAGGCCGATAAGAAGGACTCTTGCTACGAGAAGATGGTGTATAAGCTGCTGCCTGGCGCCAACAAGATGCTGCCAAAGGTGTTCTTTTCTCAGAGCAGAATCCAGGAGTTTACCCCTTCCGCCAAGCTGCTGGAGAACTACGAAAATGAGACACACAAGAAGGGCGATAATTTCAACCTGAATCACTGTCACCAGCTGATCGATTTCTTTAAGGACTCTATCAACAAGCACGAGGATTGGAAGAATTTCGACTTTAGGTTCAGCGCCACCTCCACCTACGCCGACCTGAGCGGCTTTTACCACGAGGTGGAGCACCAGGGCTACAAGATCTCTTTTCAGAGCATCGCCGATTCCTTCATCGACGATCTGGTGAACGAGGGCAAGCTGTACCTGTTCCAGATCTATAATAAGGACTTTTCCCCATTCTCTAAGGGCAAGCCCAACCTGCACACCCTGTACTGGAAGATGCTGTTTGATGAGAACAATCTGAAGGACGTGGTGTATAAGCTGAATGGCGAGGCCGAGGTGTTCTACCGCAAGAAGAGCATTGCCGAGAAGAACACCACAATCCACAAGGCCAATGAGTCCATCATCAACAAGAATCCTGATAACCCAAAGGCCACCAGCACCTTCAACTATGATATCGTGAAGGACAAGAGATACACCATCGACAAGTTTCAGTTCCACATCCCAATCACAATGAACTTTAAGGCCGAGGGCATCTTCAACATGAATCAGAGGGTGAATCAGTTCCTGAAGGCCAATCCCGATATCAACATCATCGGCATCGACAGAGGCGAGAGGCACCTGCTGTACTATGCCCTGATCAACCAGAAGGGCAAGATCCTGAAGCAGGATACCCTGAATGTGATCGCCAACGAGAAGCAGAAGGTGGACTACCACAATCTGCTGGATAAGAAGGAGGGCGACCGCGCAACCGCAAGGCAGGAGTGGGGCGTGATCGAGACAATCAAGGAGCTGAAGGAGGGCTATCTGTCCCAGGTCATCCACAAGCTGACCGATCTGATGATCGAGAACAATGCCATCATCGTGATGGAGGACCTGAACTTTGGCTTCAAGCGGGGCAGACAGAAGGTGGAGAAGCAGGTGTATCAGAAGTTTGAGAAGATGCTGATCGATAAGCTGAATTACCTGGTGGACAAGAATAAGAAGGCAAACGAGCTGGGAGGCCTGCTGAACGCATTCCAGCTGGCCAATAAGTTTGAGTCCTTCCAGAAGATGGGCAAGCAGAACGGCTTTATCTTCTACGTGCCCGCCTGGAATACCTCTAAGACAGATCCTGCCACCGGCTTTATCGACTTCCTGAAGCCCCGCTATGAGAACCTGAATCAGGCCAAGGATTTCTTTGAGAAGTTTGACTCTATCCGGCTGAACAGCAAGGCCGATTACTTTGAGTTCGCCTTTGACTTCAAGAATTTCACCGAGAAGGCCGATGGCGGCAGAACCAAGTGGACAGTGTGCACCACAAACGAGGACAGATATGCCTGGAATAGGGCCCTGAACAATAACAGGGGCAGCCAGGAGAAGTACGACATCACAGCCGAGCTGAAGTCCCTGTTCGATGGCAAGGTGGACTATAAGTCTGGCAAGGATCTGAAGCAGCAGATCGCCAGCCAGGAGTCCGCCGACTTCTTTAAGGCCCTGATGAAGAACCTGTCCATCACCCTGTCTCTGAGACACAATAACGGCGAGAAGGGCGATAATGAGCAGGACTACATCCTGTCCCCTGTGGCCGATTCTAAGGGCCGCTTCTTTGACTCCCGGAAGGCCGACGATGACATGCCAAAGAATGCCGACGCCAACGGCGCCTATCACATCGCCCTGAAGGGCCTGTGGTGTCTGGAGCAGATCAGCAAGACCGATGACCTGAAGAAGGTGAAGCTGGCCATCTCCAACAAGGAGTGGCTGGAGTTCGTGCAGACACTGAAGGGCAAAAGGCCGGCGGCCACGAAAAAGGCCGGCCAGGCAAAAAAGAAAAAGGGATCCTACCCATACGATGTTCCAGATTACGCTTATCCCTACGACGTGCCTGATTATGCATACCCATATGATGTCCCCGACTATGCC

SEQ ID No.53: (sequence of SsCas12 a)

ATGCAGACCCTGTTTGAGAACTTCACAAATCAGTACCCAGTGTCCAAGACCCTGCGCTTTGAGCTGATCCCCCAGGGCAAGACAAAGGACTTCATCGAGCAGAAGGGCCTGCTGAAGAAGGATGAGGACCGGGCCGAGAAGTATAAGAAGGTGAAGAACATCATCGATGAGTACCACAAGGACTTCATCGAGAAGTCTCTGAATGGCCTGAAGCTGGACGGCCTGGAGAAGTACAAGACCCTGTATCTGAAGCAGGAGAAGGACGATAAGGATAAGAAGGCCTTTGACAAGGAGAAGGAGAACCTGCGCAAGCAGATCGCCAATGCCTTCCGGAACAATGAGAAGTTTAAGACACTGTTCGCCAAGGAGCTGATCAAGAACGATCTGATGTCTTTCGCCTGCGAGGAGGACAAGAAGAATGTGAAGGAGTTTGAGGCCTTCACCACATACTTCACCGGCTTCCACCAGAACCGCGCCAATATGTACGTGGCCGATGAGAAGAGAACAGCCATCGCCAGCAGGCTGATCCACGAGAACCTGCCAAAGTTTATCGACAATATCAAGATCTTCGAGAAGATGAAGAAGGAGGCCCCCGAGCTGCTGTCTCCTTTCAACCAGACCCTGAAGGATATGAAGGACGTGATCAAGGGCACCACACTGGAGGAGATCTTTAGCCTGGATTATTTCAACAAGACCCTGACACAGAGCGGCATCGACATCTACAATTCCGTGATCGGCGGCAGAACCCCTGAGGAGGGCAAGACAAAGATCAAGGGCCTGAACGAGTACATCAATACCGACTTCAACCAGAAGCAGACAGACAAGAAGAAGCGGCAGCCAAAGTTCAAGCAGCTGTATAAGCAGATCCTGAGCGATAGGCAGAGCCTGTCCTTTATCGCCGAGGCCTTCAAGAACGACACCGAGATCCTGGAGGCCATCGAGAAGTTTTACGTGAATGAGCTGCTGCACTTCAGCAATGAGGGCAAGTCCACAAACGTGCTGGACGCCATCAAGAATGCCGTGTCTAACCTGGAGAGCTTTAACCTGACCAAGATGTATTTCCGCTCCGGCGCCTCTCTGACAGACGTGAGCCGGAAGGTGTTTGGCGAGTGGAGCATCATCAATAGAGCCCTGGACAACTACTATGCCACCACATATCCAATCAAGCCCAGAGAGAAGTCTGAGAAGTACGAGGAGAGGAAGGAGAAGTGGCTGAAGCAGGACTTCAACGTGAGCCTGATCCAGACCGCCATCGATGAGTACGACAACGAGACAGTGAAGGGCAAGAACAGCGGCAAAGTGATCGCCGATTATTTTGCCAAGTTCTGCGACGATAAGGAGACAGACCTGATCCAGAAGGTGAACGAGGGCTACATCGCCGTGAAGGATCTGCTGAATACACCCTGTCCTGAGAACGAGAAGCTGGGCAGCAATAAGGACCAGGTGAAGCAGATCAAGGCCTTTATGGATTCTATCATGGACATCATGCACTTCGTGCGCCCCCTGAGCCTGAAGGATACCGACAAGGAGAAGGATGAGACATTCTACTCCCTGTTCACACCTCTGTACGACCACCTGACCCAGACAATCGCCCTGTATAACAAGGTGCGGAACTATCTGACCCAGAAGCCTTACAGCACAGAGAAGATCAAGCTGAACTTCGAGAACAGCACCCTGCTGGGCGGCTGGGATCTGAATAAGGAGACAGACAACACAGCCATCATCCTGAGGAAGGATAACCTGTACTATCTGGGCATCATGGACAAGAGGCACAATCGCATCTTTCGGAACGTGCCCAAGGCCGATAAGAAGGACTTCTGCTACGAGAAGATGGTGTATAAGCTGCTGCCTGGCGCCAACAAGATGCTGCCAAAGGTGTTCTTTTCTCAGAGCAGAATCCAGGAGTTTACCCCTTCCGCCAAGCTGCTGGAGAACTACGCCAATGAGACACACAAGAAGGGCGATAATTTCAACCTGAATCACTGTCACAAGCTGATCGATTTCTTTAAGGACTCTATCAACAAGCACGAGGATTGGAAGAATTTCGACTTTAGGTTCAGCGCCACCTCCACCTACGCCGACCTGAGCGGCTTTTACCACGAGGTGGAGCACCAGGGCTACAAGATCTCTTTTCAGAGCGTGGCCGATTCCTTCATCGACGATCTGGTGAACGAGGGCAAGCTGTACCTGTTCCAGATCTATAATAAGGACTTTTCCCCATTCTCTAAGGGCAAGCCCAACCTGCACACCCTGTACTGGAAGATGCTGTTTGATGAGAACAATCTGAAGGACGTGGTGTATAAGCTGAATGGCGAGGCCGAGGTGTTCTACCGCAAGAAGAGCATTGCCGAGAAGAACACCACAATCCACAAGGCCAATGAGTCCATCATCAACAAGAATCCTGATAACCCAAAGGCCACCAGCACCTTCAACTATGATATCGTGAAGGACAAGAGATACACCATCGACAAGTTTCAGTTCCACATCCCAATCACAATGAACTTTAAGGCCGAGGGCATCTTCAACATGAATCAGAGGGTGAATCAGTTCCTGAAGGCCAATCCCGATATCAACATCATCGGCATCGACAGAGGCGAGAGGCACCTGCTGTACTATGCCCTGATCAACCAGAAGGGCAAGATCCTGAAGCAGGATACCCTGAATGTGATCGCCAACGAGAAGCAGAAGGTGGACTACCACAATCTGCTGGATAAGAAGGAGGGCGACCGCGCAACCGCAAGGCAGGAGTGGGGCGTGATCGAGACAATCAAGGAGCTGAAGGAGGGCTATCTGTCCCAGGTCATCCACAAGCTGACCGATCTGATGATCGAGAACAATGCCATCATCGTGATGGAGGACCTGAACTTTGGCTTCAAGCGGGGCAGACAGAAGGTGGAGAAGCAGGTGTATCAGAAGTTTGAGAAGATGCTGATCGATAAGCTGAATTACCTGGTGGACAAGAATAAGAAGGCAAACGAGCTGGGAGGCCTGCTGAACGCATTCCAGCTGGCCAATAAGTTTGAGTCCTTCCAGAAGATGGGCAAGCAGAACGGCTTTATCTTCTACGTGCCCGCCTGGAATACCTCTAAGACAGATCCTGCCACCGGCTTTATCGACTTCCTGAAGCCCCGCTATGAGAACCTGAATCAGGCCAAGGATTTCTTTGAGAAGTTTGACTCTATCCGGCTGAACAGCAAGGCCGATTACTTTGAGTTCGCCTTTGACTTCAAGAATTTCACCGAGAAGGCCGATGGCGGCAGAACCAAGTGGACAGTGTGCACCACAAACGAGGACAGATATGCCTGGAATAGGGCCCTGAACAATAACAGGGGCAGCCAGGAGAAGTACGACATCACAGCCGAGCTGAAGTCCCTGTTCGATGGCAAGGTGGACTATAAGTCTGGCAAGGATCTGAAGCAGCAGATCGCCAGCCAGGAGTCCGCCGACTTCTTTAAGGCCCTGATGAAGAACCTGTCCATCACCCTGTCTCTGAGACACAATAACGGCGAGAAGGGCGATAATGAGCAGGACTACATCCTGTCCCCTGTGGCCGATTCTAAGGGCCGCTTCTTTGACTCCCGGAAGGCCGACGATGACATGCCAAAGAATGCCGACGCCAACGGCGCCTATCACATCGCCCTGAAGGGCCTGTGGTGTCTGGAGCAGATCAGCAAGACCGATGACCTGAAGAAGGTGAAGCTGGCCATCTCCAACAAGGAGTGGCTGGAGTTCGTGCAGACACTGAAGGGCAAAAGGCCGGCGGCCACGAAAAAGGCCGGCCAGGCAAAAAAGAAAAAGGGATCCTACCCATACGATGTTCCAGATTACGCTTATCCCTACGACGTGCCTGATTATGCATACCCATATGATGTCCCCGACTATGCC

Sequence listing

<110> Guangzhou Pushili Huakojiu Co., ltd

<120> nucleic acid detection kit for pathogenic pathogen of sexually transmitted diseases

<140> 2019103653750

<141> 2019-04-30

<160> 53

<170> SIPOSequenceListing 1.0

<210> 1

<211> 378

<212> DNA

<213> Human Immunodeficiency Virus (HIV)

<400> 1

aaggagtagt ggagtctatg aataaggaat taaagaaaat catagggcag gtaagagagc 60

aagctgaaca ccttaagaca gcagtacaaa tggcagtatt cattcacaat tttaaaagaa 120

aaggggggat tggggggtac agtgcagggg aaagaataat agacataata gcaacagaca 180

tacaaactaa agaattacaa aaacaaatta taaaaattca gaattttcgg gtttattaca 240

gggacagcag agatccaatt tggaaaggac cagcaaaact actctggaaa ggtgaagggg 300

cagtggtaat acaggacaat aacgatataa aagtagtacc aagaagaaaa gcaaagatca 360

ttagggatta tggaaaac 378

<210> 2

<211> 367

<212> DNA

<213> Human Immunodeficiency Virus (HIV)

<400> 2

agatgctgca tataagcagc tgctttttgc ctgtactggg tctctcttgt tagaccagat 60

ccgagcctgg gagctctctg gctaactagg gaacccactg cttaagcctc aataaagctt 120

gccttaagtg cttcaagtag tgtgtgcccg tctgttgtgt gactctggta gctagagatc 180

cctcagaccc ttttagtcag tgtgaaaaat ctctagcagt ggcgcccgaa cagggactta 240

aaagcgaaag agaaaccaga ggagctctct cgacgcagga ctcggcttgc tgaagcgcgc 300

acggcaagag gcgaggggcg gcgactggtg agtacgccaa aattttgact agcggaggct 360

agaagga 367

<210> 3

<211> 254

<212> DNA

<213> Chlamydia Trachomatis (CT)

<400> 3

atgaaaaaac tcttgaaatc ggtattagta tttgccgctt tgagttctgc ttcctccttg 60

caagctctgc ctgtggggaa tcctgctgaa ccaagcctta tgatcgacgg aattctgtgg 120

gaaggtttcg gcggagatcc ttgcgatcct tgcgccactt ggtgtgacgc tatcagcatg 180

cgtgttggtt actacggaga ctttgttttc gaccgtgttt tgaaaactga tgtgaataaa 240

gaatttcaga tggg 254

<210> 4

<211> 390

<212> DNA

<213> Treponema Pallidum (TP)

<400> 4

attattgatt gcgcgtgtgc gaatggtgtg gtcgcgtttg attgtgaaac ggatggattg 60

catccgcacg atacacgtct ggtcggattt tcgatctgct ttcaggaagc agaggctttt 120

tatgttcctc ttattgttcc ggacgtttct cttcataccg agtcaactca gtgtacatgt 180

gcacgtagca ctaatgtcga gactgaaaag gagtgcacag aacagcatgg ggtatctgca 240

tctgctgtgc aggatccggc atatgtccaa gctgtcatgc accagcttcg acgtctttgg 300

aatgatgaga cgctcacact tgttatgcat aatggaaagt ttgattatca cgttatgcat 360

cgtgcaggcg tttttgagca ctgtgcatgt 390

<210> 5

<211> 200

<212> DNA

<213> Treponema Pallidum (TP)

<400> 5

accaacaggg cgctgcctac tatacaacag cgtgttaagc aagctgttca ggaaaatata 60

cggaggatca acgctgtggt gcagcaaaaa gcgcaaacgc tcacctcttc ccaggaactg 120

gaaaaggcag tgtattcgtt gttcgttccc acgtttgaaa acctggtgtt gggtgcaggc 180

gcgctgctgg ctcttttgga 200

<210> 6

<211> 200

<212> DNA

<213> Treponema Pallidum (TP)

<400> 6

tcgggcagat tactggcgtg gtgcagaacg ttatcaccca gcaggtacag gcccgggttg 60

cgcagtcgac cgcggttgca atccagcaag tttctgtgtt caaccagcaa accgtcgctg 120

cagaaaaagc gaatacgcaa aagcatacga taaatggcaa gtcatacgcg gctcatatcg 180

gctcgttggt aagtctcgct 200

<210> 7

<211> 200

<212> DNA

<213> Treponema Pallidum (TP)

<400> 7

ggtgaagcag gcacacgatc agattaaacg caccaatgga acacaagtag tgaatattga 60

cgtgaccgtt ccggtgaacg tccggcaaag tcctgttcgg caacctgact tgccttcact 120

taccgcaatc gcagcgcaat tgccaaatgt aaccaagctc ttcttcctta gtgccggggc 180

ggccgccgcg aggcccatta 200

<210> 8

<211> 200

<212> DNA

<213> Treponema Pallidum (TP)

<400> 8

gatgctgtgt tgcctgttga gtgtacaacc ctgttatgcc gggtacgtgt ttgtttcccc 60

aaagcttggc gtgtatggag aagcattggg cggtcctgac acggtgggta aagcggtcaa 120

gcaggccgac ggtactaaga ttgctccgaa gatatggtac tacgcgccgc gtaccccgct 180

ttttggcgtg gatataggct 200

<210> 9

<211> 200

<212> DNA

<213> Treponema Pallidum (TP)

<400> 9

atttttgaac actgcaagcg caagcggctc tgataccttg tgttccacgt cgcaccacgt 60

agtgggggtg ctccctgagc cgttcgtata ccggcagtac accttgtcct tggtaaggat 120

ataggtattg ctgccatcgc aggcgctggc gaggatcggc gcctctgcct tacaggtgac 180

gtcctttgtt tcggagataa 200

<210> 10

<211> 405

<212> DNA

<213> Neisseria Gonorrhoeae (NG)

<400> 10

cctttatcgg cttggcaggc gaattcggta cgctgcgcgc cggtcgcgtt gcgaatcagt 60

ttgacgatgc cagccaagcc attgatcctt gggacagcaa taatgatgtg gcttcgcaat 120

tgggtatttt caaacgccac gacgacatgc cggtttccgt acgctacgat tcccccgaat 180

tttccggttt cagcggcagc gttcaattcg ttccgatcca aaacagcaag tccgcctata 240

cgccggctta ttatactaag aatacaaaca ataatcttac tctcgttccg gctgttgtcg 300

gcaagcccgg atcggatgtg tattatgccg gtctgaatta caaaaatggc ggttttgccg 360

ggaactatgc ctttaaatat gcgagacacg ccaatgtcgg acgta 405

<210> 11

<211> 200

<212> DNA

<213> Neisseria Gonorrhoeae (NG)

<400> 11

atgacagtcc gaaacacgca aaccgaaacc gtccggacgg aagccgcgcc gcaacaaggc 60

ggcaatacca acccgggcta ttacaaaaac cgcgccttcg agtgcgtcgg gtttgcgcaa 120

tacctcaact tcaacctcgg caacgccttc aaatacatct ggcggcacaa ggaaaaaggc 180

gggcgcgaag acttggaaaa 200

<210> 12

<211> 200

<212> DNA

<213> Toxoplasma Gondii (TG)

<400> 12

aggcaatgac aaaagagcaa ctgcatccgt agcatggtgg gacacaacga agaattatgc 60

ataagctttt ccgttttttc gctatctcga gagcacggac gaacaccatc caccctaccc 120

gcagagcgtc ttatccgcct cttttagagc catctctgct tgacagatgc gcagatggaa 180

aaccggcgat ccgacttaac 200

<210> 13

<211> 200

<212> DNA

<213> Toxoplasma Gondii (TG)

<400> 13

cgccctgtga ggcgctgtca cagtctctgg aaaatcttgg gggtttattt ctcagacaca 60

cactgcttgt aacgatgatt gcttcacatt aaacgctctg gagaggtgaa agttctcagc 120

tgtttagact cgtctgtctc tcgttcctcc gtcacgtgct gtctgcggac ctagttcttc 180

ctggaatcgt ttctccgatg 200

<210> 14

<211> 200

<212> DNA

<213> Toxoplasma Gondii (TG)

<400> 14

atcacccgag cgccagcttt catctgtcgc ccgccgtcca actactatcc tacaagggca 60

acaagaacac cgcggagatg acacagaagg aacttgtggt actacagaaa gcgacaacgt 120

cttcagtggt ccaaaattgt ctttgacagc ctctggtatg tgttacattc gtccatacaa 180

ccagtcacaa gcggcaaaag 200

<210> 15

<211> 200

<212> DNA

<213> Toxoplasma Gondii (TG)

<400> 15

caagagggtc ttggctgaga gaatcaatcc ccgatataca cacgctaata tcggctttgc 60

ttcttatgac ttttcagaat ctctgatgac atgaggccgt agccggttga cccacagtga 120

tgcttgtgca tgctgctcct cacgttcttc gtcctccggt ttctcttctt ccttccgtgt 180

ttcatcgttg gcactgctcc 200

<210> 16

<211> 200

<212> DNA

<213> Toxoplasma Gondii (TG)

<400> 16

tccgaattgt gtgctgatcg agcttgacga ccagccaagc tccgtcgggc gcatagacct 60

ctttgatgta tgagcagcac tccgacaaca gcgtcttctc aattcgattt ttcaccatca 120

ctgcatagtt gtagtcctcg tcgttaacca gaggcacgac gatgatgggg gtctgaatct 180

tttgcgctgc gtttatgatt 200

<210> 17

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

ttacagggac agcagagatc 20

<210> 18

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

gaaaggacca gcaaaactac 20

<210> 19

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

ctggtccttt ccaaattgga 20

<210> 20

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

cctgtactgg gtctctcttg 20

<210> 21

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

gcgtactcac cagtcgccgc 20

<210> 22

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

ttgaggctta agcagtgggt 20

<210> 23

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 23

agttctgctt cctccttgca 20

<210> 24

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 24

ggcggagatc cttgcgatcc 20

<210> 25

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 25

agtctcgaca ttagtgctac 20

<210> 26

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 26

tcttcatacc gagtcaactc 20

<210> 27

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 27

gaatgatgag acgctcacac 20

<210> 28

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 28

aaaacctggt gttgggtgca 20

<210> 29

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 29

cagttcctgg gaagaggtga 20

<210> 30

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 30

ctgcaccaca gcgttgatcc 20

<210> 31

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 31

tgtgttcaac cagcaaaccg 20

<210> 32

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 32

tcgtatgctt ttgcgtattc 20

<210> 33

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 33

gcaattgcgc tgcgattgcg 20

<210> 34

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 34

ccggacgttc accggaacgg 20

<210> 35

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 35

cccaccgtgt caggaccgcc 20

<210> 36

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 36

cccaaagctt ggcgtgtatg 20

<210> 37

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 37

aacactgcaa gcgcaagcgg 20

<210> 38

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 38

tcggcttggc aggcgaattc g 21

<210> 39

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 39

agcggcagcg ttcaattcgt 20

<210> 40

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 40

aatatgcgag acacgccaat g 21

<210> 41

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 41

cgcaatacct caacttcaac 20

<210> 42

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 42

cttgtgccgc cagatgtatt 20

<210> 43

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 43

aaggcgttgc cgaggttgaa 20

<210> 44

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 44

gctatctcga gagcacggac 20

<210> 45

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 45

tcagacacac actgcttgta 20

<210> 46

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 46

gactcgtctg tctctcgttc 20

<210> 47

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 47

acagcctctg gtatgtgtta 20

<210> 48

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 48

tgtagtacca caagttcctt 20

<210> 49

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 49

agaatctctg atgacatgag 20

<210> 50

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 50

atgtatgagc agcactccga 20

<210> 51

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 51

accatcactg catagttgta 20

<210> 52

<211> 3885

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 52

atgcagaccc tgtttgagaa cttcacaaat cagtacccag tgtccaagac cctgcgcttt 60

gagctgatcc cccagggcaa gacaaaggac ttcatcgagc agaagggcct gctgaagaag 120

gatgaggacc gggccgagaa gtataagaag gtgaagaaca tcatcgatga gtaccacaag 180

gacttcatcg agaagtctct gaatggcctg aagctggacg gcctggagga atacaagacc 240

ctgtatctga agcaggagaa ggacgataag gataagaagg cctttgacaa ggagaaggag 300

aacctgcgca agcagatcgc caatgccttc cggaacaatg agaagtttaa gacactgttc 360

gccaaggagc tgatcaagaa cgatctgatg tctttcgcct gcgaggagga caagaagaat 420

gtgaaggagt ttgaggcctt caccacatac ttcaccggct tccaccagaa ccgcgccaat 480

atgtacgtgg ccgatgagaa gagaacagcc atcgccagca ggctgatcca cgagaacctg 540

ccaaagttta tcgacaatat caagatcttc gagaagatga agaaggaggc ccccgagctg 600

ctgtctcctt tcaaccagac cctgaaggat atgaaggacg tgatcaaggg caccacactg 660

gaggagatct ttagcctgga ttatttcaac aagaccctga cacagagcgg catcgacatc 720

tacaattccg tgatcggcgg cagaacccct gaggagggca agacaaagat caagggcctg 780

aacgagtaca tcaataccga cttcaaccag aagcagacag acaagaagaa gcggcagcca 840

aagttcaagc agctgtataa gcagatcctg agcgataggc agagcctgtc ctttatcgcc 900

gaggccttca agaacgacac cgagatcctg gaggccatcg agaagtttta cgtgaatgag 960

ctgctgcact tcagcaatga gggcaagtcc acaaacgtgc tggacgccat caagaatgcc 1020

gtgtctaacc tggagagctt taacctgacc aagatctatt tccgctccgg cacctctctg 1080

acagacgtga gccggaaggt gtttggcgag tggagcatca tcaatagagc cctggacaac 1140

tactatgcca ccacatatcc aatcaagccc agagagaagt ctgagaagta cgaggagagg 1200

aaggagaagt ggctgaagca ggacttcaac gtgagcctga tccagaccgc catcgatgag 1260

tacgacaacg agacagtgaa gggcaagaac agcggcaaag tgatcgtcga ttattttgcc 1320

aagttctgcg acgataagga gacagacctg atccagaagg tgaacgaggg ctacatcgcc 1380

gtgaaggatc tgctgaatac accctgtcct gagaacgaga agctgggcag caataaggac 1440

caggtgaagc agatcaaggc ctttatggat tctatcatgg acatcatgca cttcgtgcgc 1500

cccctgagcc tgaaggatac cgacaaggag aaggatgaga cattctactc cctgttcaca 1560

cctctgtacg accacctgac ccagacaatc gccctgtata acaaggtgcg gaactatctg 1620

acccagaagc cttacagcac agagaagatc aagctgaact tcgagaacag caccctgctg 1680

ggcggctggg atctgaataa ggagacagac aacacagcca tcatcctgag gaaggaaaac 1740

ctgtactatc tgggcatcat ggacaagagg cacaatcgca tctttcggaa cgtgcccaag 1800

gccgataaga aggactcttg ctacgagaag atggtgtata agctgctgcc tggcgccaac 1860

aagatgctgc caaaggtgtt cttttctcag agcagaatcc aggagtttac cccttccgcc 1920

aagctgctgg agaactacga aaatgagaca cacaagaagg gcgataattt caacctgaat 1980

cactgtcacc agctgatcga tttctttaag gactctatca acaagcacga ggattggaag 2040

aatttcgact ttaggttcag cgccacctcc acctacgccg acctgagcgg cttttaccac 2100

gaggtggagc accagggcta caagatctct tttcagagca tcgccgattc cttcatcgac 2160

gatctggtga acgagggcaa gctgtacctg ttccagatct ataataagga cttttcccca 2220

ttctctaagg gcaagcccaa cctgcacacc ctgtactgga agatgctgtt tgatgagaac 2280

aatctgaagg acgtggtgta taagctgaat ggcgaggccg aggtgttcta ccgcaagaag 2340

agcattgccg agaagaacac cacaatccac aaggccaatg agtccatcat caacaagaat 2400

cctgataacc caaaggccac cagcaccttc aactatgata tcgtgaagga caagagatac 2460

accatcgaca agtttcagtt ccacatccca atcacaatga actttaaggc cgagggcatc 2520

ttcaacatga atcagagggt gaatcagttc ctgaaggcca atcccgatat caacatcatc 2580

ggcatcgaca gaggcgagag gcacctgctg tactatgccc tgatcaacca gaagggcaag 2640

atcctgaagc aggataccct gaatgtgatc gccaacgaga agcagaaggt ggactaccac 2700

aatctgctgg ataagaagga gggcgaccgc gcaaccgcaa ggcaggagtg gggcgtgatc 2760

gagacaatca aggagctgaa ggagggctat ctgtcccagg tcatccacaa gctgaccgat 2820

ctgatgatcg agaacaatgc catcatcgtg atggaggacc tgaactttgg cttcaagcgg 2880

ggcagacaga aggtggagaa gcaggtgtat cagaagtttg agaagatgct gatcgataag 2940

ctgaattacc tggtggacaa gaataagaag gcaaacgagc tgggaggcct gctgaacgca 3000

ttccagctgg ccaataagtt tgagtccttc cagaagatgg gcaagcagaa cggctttatc 3060

ttctacgtgc ccgcctggaa tacctctaag acagatcctg ccaccggctt tatcgacttc 3120

ctgaagcccc gctatgagaa cctgaatcag gccaaggatt tctttgagaa gtttgactct 3180

atccggctga acagcaaggc cgattacttt gagttcgcct ttgacttcaa gaatttcacc 3240

gagaaggccg atggcggcag aaccaagtgg acagtgtgca ccacaaacga ggacagatat 3300

gcctggaata gggccctgaa caataacagg ggcagccagg agaagtacga catcacagcc 3360

gagctgaagt ccctgttcga tggcaaggtg gactataagt ctggcaagga tctgaagcag 3420

cagatcgcca gccaggagtc cgccgacttc tttaaggccc tgatgaagaa cctgtccatc 3480

accctgtctc tgagacacaa taacggcgag aagggcgata atgagcagga ctacatcctg 3540

tcccctgtgg ccgattctaa gggccgcttc tttgactccc ggaaggccga cgatgacatg 3600

ccaaagaatg ccgacgccaa cggcgcctat cacatcgccc tgaagggcct gtggtgtctg 3660

gagcagatca gcaagaccga tgacctgaag aaggtgaagc tggccatctc caacaaggag 3720

tggctggagt tcgtgcagac actgaagggc aaaaggccgg cggccacgaa aaaggccggc 3780

caggcaaaaa agaaaaaggg atcctaccca tacgatgttc cagattacgc ttatccctac 3840

gacgtgcctg attatgcata cccatatgat gtccccgact atgcc 3885

<210> 53

<211> 3885

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 53

atgcagaccc tgtttgagaa cttcacaaat cagtacccag tgtccaagac cctgcgcttt 60

gagctgatcc cccagggcaa gacaaaggac ttcatcgagc agaagggcct gctgaagaag 120

gatgaggacc gggccgagaa gtataagaag gtgaagaaca tcatcgatga gtaccacaag 180

gacttcatcg agaagtctct gaatggcctg aagctggacg gcctggagaa gtacaagacc 240

ctgtatctga agcaggagaa ggacgataag gataagaagg cctttgacaa ggagaaggag 300

aacctgcgca agcagatcgc caatgccttc cggaacaatg agaagtttaa gacactgttc 360

gccaaggagc tgatcaagaa cgatctgatg tctttcgcct gcgaggagga caagaagaat 420

gtgaaggagt ttgaggcctt caccacatac ttcaccggct tccaccagaa ccgcgccaat 480

atgtacgtgg ccgatgagaa gagaacagcc atcgccagca ggctgatcca cgagaacctg 540

ccaaagttta tcgacaatat caagatcttc gagaagatga agaaggaggc ccccgagctg 600

ctgtctcctt tcaaccagac cctgaaggat atgaaggacg tgatcaaggg caccacactg 660

gaggagatct ttagcctgga ttatttcaac aagaccctga cacagagcgg catcgacatc 720

tacaattccg tgatcggcgg cagaacccct gaggagggca agacaaagat caagggcctg 780

aacgagtaca tcaataccga cttcaaccag aagcagacag acaagaagaa gcggcagcca 840

aagttcaagc agctgtataa gcagatcctg agcgataggc agagcctgtc ctttatcgcc 900

gaggccttca agaacgacac cgagatcctg gaggccatcg agaagtttta cgtgaatgag 960

ctgctgcact tcagcaatga gggcaagtcc acaaacgtgc tggacgccat caagaatgcc 1020

gtgtctaacc tggagagctt taacctgacc aagatgtatt tccgctccgg cgcctctctg 1080

acagacgtga gccggaaggt gtttggcgag tggagcatca tcaatagagc cctggacaac 1140

tactatgcca ccacatatcc aatcaagccc agagagaagt ctgagaagta cgaggagagg 1200

aaggagaagt ggctgaagca ggacttcaac gtgagcctga tccagaccgc catcgatgag 1260

tacgacaacg agacagtgaa gggcaagaac agcggcaaag tgatcgccga ttattttgcc 1320

aagttctgcg acgataagga gacagacctg atccagaagg tgaacgaggg ctacatcgcc 1380

gtgaaggatc tgctgaatac accctgtcct gagaacgaga agctgggcag caataaggac 1440

caggtgaagc agatcaaggc ctttatggat tctatcatgg acatcatgca cttcgtgcgc 1500

cccctgagcc tgaaggatac cgacaaggag aaggatgaga cattctactc cctgttcaca 1560

cctctgtacg accacctgac ccagacaatc gccctgtata acaaggtgcg gaactatctg 1620

acccagaagc cttacagcac agagaagatc aagctgaact tcgagaacag caccctgctg 1680

ggcggctggg atctgaataa ggagacagac aacacagcca tcatcctgag gaaggataac 1740

ctgtactatc tgggcatcat ggacaagagg cacaatcgca tctttcggaa cgtgcccaag 1800

gccgataaga aggacttctg ctacgagaag atggtgtata agctgctgcc tggcgccaac 1860

aagatgctgc caaaggtgtt cttttctcag agcagaatcc aggagtttac cccttccgcc 1920

aagctgctgg agaactacgc caatgagaca cacaagaagg gcgataattt caacctgaat 1980

cactgtcaca agctgatcga tttctttaag gactctatca acaagcacga ggattggaag 2040

aatttcgact ttaggttcag cgccacctcc acctacgccg acctgagcgg cttttaccac 2100

gaggtggagc accagggcta caagatctct tttcagagcg tggccgattc cttcatcgac 2160

gatctggtga acgagggcaa gctgtacctg ttccagatct ataataagga cttttcccca 2220

ttctctaagg gcaagcccaa cctgcacacc ctgtactgga agatgctgtt tgatgagaac 2280

aatctgaagg acgtggtgta taagctgaat ggcgaggccg aggtgttcta ccgcaagaag 2340

agcattgccg agaagaacac cacaatccac aaggccaatg agtccatcat caacaagaat 2400

cctgataacc caaaggccac cagcaccttc aactatgata tcgtgaagga caagagatac 2460

accatcgaca agtttcagtt ccacatccca atcacaatga actttaaggc cgagggcatc 2520

ttcaacatga atcagagggt gaatcagttc ctgaaggcca atcccgatat caacatcatc 2580

ggcatcgaca gaggcgagag gcacctgctg tactatgccc tgatcaacca gaagggcaag 2640

atcctgaagc aggataccct gaatgtgatc gccaacgaga agcagaaggt ggactaccac 2700

aatctgctgg ataagaagga gggcgaccgc gcaaccgcaa ggcaggagtg gggcgtgatc 2760

gagacaatca aggagctgaa ggagggctat ctgtcccagg tcatccacaa gctgaccgat 2820

ctgatgatcg agaacaatgc catcatcgtg atggaggacc tgaactttgg cttcaagcgg 2880

ggcagacaga aggtggagaa gcaggtgtat cagaagtttg agaagatgct gatcgataag 2940

ctgaattacc tggtggacaa gaataagaag gcaaacgagc tgggaggcct gctgaacgca 3000

ttccagctgg ccaataagtt tgagtccttc cagaagatgg gcaagcagaa cggctttatc 3060

ttctacgtgc ccgcctggaa tacctctaag acagatcctg ccaccggctt tatcgacttc 3120

ctgaagcccc gctatgagaa cctgaatcag gccaaggatt tctttgagaa gtttgactct 3180

atccggctga acagcaaggc cgattacttt gagttcgcct ttgacttcaa gaatttcacc 3240

gagaaggccg atggcggcag aaccaagtgg acagtgtgca ccacaaacga ggacagatat 3300

gcctggaata gggccctgaa caataacagg ggcagccagg agaagtacga catcacagcc 3360

gagctgaagt ccctgttcga tggcaaggtg gactataagt ctggcaagga tctgaagcag 3420

cagatcgcca gccaggagtc cgccgacttc tttaaggccc tgatgaagaa cctgtccatc 3480

accctgtctc tgagacacaa taacggcgag aagggcgata atgagcagga ctacatcctg 3540

tcccctgtgg ccgattctaa gggccgcttc tttgactccc ggaaggccga cgatgacatg 3600

ccaaagaatg ccgacgccaa cggcgcctat cacatcgccc tgaagggcct gtggtgtctg 3660

gagcagatca gcaagaccga tgacctgaag aaggtgaagc tggccatctc caacaaggag 3720

tggctggagt tcgtgcagac actgaagggc aaaaggccgg cggccacgaa aaaggccggc 3780

caggcaaaaa agaaaaaggg atcctaccca tacgatgttc cagattacgc ttatccctac 3840

gacgtgcctg attatgcata cccatatgat gtccccgact atgcc 3885

Claims

1. A CRISPR/Cas12a detection system of STD pathogenic nucleic acid, which is characterized in that the STD pathogen is human immunodeficiency virus, chlamydia trachomatis, treponema pallidum, neisseria gonorrhoeae and Toxoplasma gondii; the detection system comprises a Cas12a protein and a gRNA, wherein the gRNA is designed by taking a target site as a target sequence, and the design principle is as follows: when a gRNA targeting sequence is selected, the 5' end of the targeting sequence should have a 5' -TTTN-3' sequence, and a stable secondary structure is not formed among the targeting sequence, the targeting sequence and the rest sequences;

wherein, the gRNA for detecting the human immunodeficiency virus is designed by taking a target site shown in SEQ ID NO.1 or SEQ ID NO.2 as a target sequence; when SEQ ID NO.1 is taken as a target sequence, the target sequence of the gRNA is shown as SEQ ID NO.17 or SEQ ID NO. 19; when SEQ ID NO.2 is taken as a target sequence, the target sequence of the gRNA is shown in any one of SEQ ID NO. 20-22;

the gRNA for detecting chlamydia trachomatis is designed by taking a target site shown in SEQ ID NO.3 as a target sequence, and the target sequence of the gRNA is shown in SEQ ID NO. 23;

the gRNA for detecting the treponema pallidum is designed by taking a target site shown by any one of SEQ ID NO. 4-7 as a target sequence; when SEQ ID NO.4 is taken as a target sequence, the target sequence of the gRNA is shown in any one of SEQ ID NO. 25-27; when SEQ ID NO.5 is taken as a target sequence, the target sequence of the gRNA is shown in any one of SEQ ID NO. 28-30; when SEQ ID NO.6 is taken as a target sequence, the target sequence of the gRNA is shown as SEQ ID NO.31 or SEQ ID NO. 32; when SEQ ID NO.7 is taken as a target sequence, the target sequence of the gRNA is shown as SEQ ID NO.33 or SEQ ID NO. 34;

the gRNA for detecting Neisseria gonorrhoeae is designed by taking a target site shown in SEQ ID NO.10 or SEQ ID NO.11 as a target sequence; when SEQ ID NO.10 is taken as a target sequence, the target sequence of the gRNA is shown as SEQ ID NO.38 or SEQ ID NO. 40; when SEQ ID NO.11 is taken as a target sequence, the target sequence of the gRNA is shown in any one of SEQ ID NO. 41-43;

the gRNA for detecting Toxoplasma gondii is designed by taking any one of the target sites shown in SEQ ID NO. 13-16 as a target sequence; when SEQ ID NO.13 is taken as a target sequence, the target sequence of the gRNA is shown as SEQ ID NO.45 or SEQ ID NO. 46; when SEQ ID NO.14 is taken as a target sequence, the target sequence of the gRNA is shown as SEQ ID NO.47 or SEQ ID NO. 48; when SEQ ID NO.15 is taken as a target sequence, the targeting sequence of the gRNA is shown as SEQ ID NO. 49; when SEQ ID NO.16 is taken as a target sequence, the targeting sequence of the gRNA is shown as SEQ ID NO.50 or SEQ ID NO. 51.

2. Use of the test system according to claim 1 for the preparation of a product for the detection of human immunodeficiency virus, chlamydia trachomatis, treponema pallidum, neisseria gonorrhoeae and/or toxoplasma gondii.

3. Use of a gRNA according to claim 1 in the preparation of a product for the detection of a nucleic acid from an STD pathogen, wherein the STD pathogen is human immunodeficiency virus, chlamydia trachomatis, treponema pallidum, neisseria gonorrhoeae and/or toxoplasma gondii.

4. The use of a gRNA as claimed in claim 1, for the preparation of a CRISPR/Cas12a system-based STD pathogen nucleic acid detection product, wherein the STD pathogen is human immunodeficiency virus, chlamydia trachomatis, leptospira pallidum, neisseria gonorrhoeae and/or Toxoplasma gondii.