CN106399317A - DNA (deoxyribonucleic acid) aptamer of phthalate type plasticizer and screening and expression method and electro-chemical sensor thereof - Google Patents

DNA (deoxyribonucleic acid) aptamer of phthalate type plasticizer and screening and expression method and electro-chemical sensor thereof Download PDF

Info

Publication number
CN106399317A
CN106399317A CN201610949635.5A CN201610949635A CN106399317A CN 106399317 A CN106399317 A CN 106399317A CN 201610949635 A CN201610949635 A CN 201610949635A CN 106399317 A CN106399317 A CN 106399317A
Authority
CN
China
Prior art keywords
dbp
aptamer
stranded dna
screening
pcr
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201610949635.5A
Other languages
Chinese (zh)
Other versions
CN106399317B (en
Inventor
娄新徽
何苗
韩宇
刁冬林
郭倩
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Tsinghua University
Capital Normal University
Original Assignee
Tsinghua University
Capital Normal University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Tsinghua University, Capital Normal University filed Critical Tsinghua University
Priority to CN201610949635.5A priority Critical patent/CN106399317B/en
Priority to CN201910033530.9A priority patent/CN109609507B/en
Publication of CN106399317A publication Critical patent/CN106399317A/en
Application granted granted Critical
Publication of CN106399317B publication Critical patent/CN106399317B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034—Isolating an individual clone by screening libraries
    • C12N15/1048—SELEX
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/5308—Immunoassay; Biospecific binding assay; Materials therefor for analytes not provided for elsewhere, e.g. nucleic acids, uric acid, worms, mites
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/16—Aptamers

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Organic Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • General Health & Medical Sciences (AREA)
  • Plant Pathology (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Biophysics (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Cell Biology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Food Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Analytical Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to a DNA (deoxyribonucleic acid) aptamer of a phthalate type plasticizer and a screening and expression method and an electro-chemical sensor thereof. The screening and expression method comprises the following steps of 1, preparing a derivative of dibutyl phthalate through chemical synthesis, wherein the terminal of one linear fatty side chain of the dibutyl phthalate is provided with an amino group; 2, condensing the amino and an epoxy ethane activation group on agarose beads, and connecting DBP-NH2 onto the agarose beads in a covalence way; 3, screening the aptamer based on the solid phase separation; 4, performing high-flux sequencing on an obtained enriched library after screening; 5, testing the affinity and selectivity of two sequences DBP-1 and DBP-2 with maximum occurring frequency in the high-flux sequencing; 6, building the electro-chemical sensor based on the DBP-1. The method has the advantages that the method can be applied to develop various types of detection techniques and biological sensors, and the important application value is realized for the rapid detection of the phthalate type plasticizer in foods or environments.

Description

A kind of phthalic ester plasticizer single stranded DNA nucleic acid aptamers and its screening with Characterizing method and electrochemical sensor
Technical field
The present invention relates to a kind of phthalic ester plasticizer single stranded DNA nucleic acid aptamers and its screening and characterizing method And apply its electrochemical sensor, belong to biological technical field.
Background technology
Phthalate material (Phthalate Esters or Phthalic Acid Esters, PAEs) is adjacent benzene The general designation of the ester that dioctyl phthalate is formed, its chemical constitution is made up of a plane aromatic hydrocarbons and two aliphatic side chainses.PAEs mainly uses In pvc material, make polrvinyl chloride be changed into resilient plastic cement from hard plastic glue, play the effect of plasticising.PAEs extensively should For toy, packaging material for food, medical blood bag and sebific duct, vinyl flooring and wallpaper, cleaning agent, lubricating oil, use in personal care In hundreds of products such as product (as nial polish, hair spray, fancy soap and shampoo).
PAEs is class persistence organic pollutant (the persistent organic in ester type compound compared with difficult degradation Pollutants, POPs), the environment incretion interferent being also well recognized as.PAEs is a class liposoluble substance, can by breathing, Diet contacts entrance human body with skin, and human body is worked the mischief.It is similar that research shows that PAEs plays in human body with animal body The effect of estrogen, may interfere with endocrine, so that man semen amount and sperm quantity is reduced, Sperm Motility is low, sperm Paramophia, serious meeting leads to carcinoma of testis, is to cause man's reproductive problems " arch-criminal ".It also can increase women and suffer from breast The probability of adenocarcinoma, also can jeopardize the reproductive system of the boy baby of their following fertilities.It is presently believed to be the PAEs of harmful substance For 15 kinds, wherein phthalic acid two (2- ethyl hexyl) ester (DEHP), dibutyl phthalate (DBP), phthalic acid two N-octyl (DNOP), BBP(Butyl Benzyl Phthalate (BBP), diisononyl phthalate (DINP), phthalic acid two isodecyl 6 kinds of ester (DIDP) is classified as, by European Union, the material that human body and environment are harmful to that total detected level have to be lower than 1%.China is to life All there is clear and definite limit value to multiple PAEs in the pollutant emission standard of drinking water, surface water and sewage treatment plant.Because DBP dives Endocrine disruption toxicity maximum, its limit value is all minimum.Such as China's drinking water sanitary standard (GB5749-2006) is right The limit value of DBP is low to reach 0.003mg/L (～1nM, 3ppb).The outer detection to plasticizer of Current Domestic is also only limitted to large-scale instrument Device, such as efficient liquid phase and mass spectrum are it is impossible to realizing scene efficiently and timely monitoring.How quickly, accurately, directly effectively examine Survey the plasticizer in food and water body, be the technology that related scientific research worker's keen anticipation such as environment and food safety can solve the problem that A difficult problem.
Aptamer is by SELEX technology (Systematic Evolution of Ligands by Exponential Enrichment, that is, system index enrichment aptamers phyletic evolution technology) obtain single-stranded or double-stranded DNA or RNA (Nature, 1990,346,818-822；Nature,1992,355,564-566).Aptamer can be special Property identification includes protein, small molecule, cell and the diversified target molecule in being organized in, its stability high it is easy to synthesize And modification, low cost, all it is with a wide range of applications in fields such as bio-sensing, imaging and medicament research and development.At present, by body The aptamer that outer triage techniqueses obtain has a lot, much has been carried out online fast high-sensitive detection, but has not seen spy The report of opposite sex identification phthalic ester plasticizer aptamer.
Content of the invention
It is an object of the invention to provide a kind of phthalic ester plasticizer single stranded DNA nucleic acid aptamers and its screening with Characterizing method and the electrochemical sensor applying it.The present invention is that gone out using SELEX technology screening can be with O-phthalics such as DBP Acid ester type plasticizer specificity and the single stranded DNA nucleic acid aptamers sequence of high-affinity combination, and utilize this aptamer structure Build and the phthalic ester plasticizers such as DBP can be carried out with highly sensitive and high specific detection electrochemical sensor.
A kind of and phthalic ester plasticizer that the present invention provides has the single stranded DNA of high specific and high-affinity Aptamer.The single-stranded DNA sequence of this aptamer is highly enriched, from same rich in C base family:5' CTTTCTGTCCTTCCGTCACN1-4TCCCACGCATTCTCCACAT3' and/or the variant for its single base or double alkali yl. Wherein in high-flux sequence, two aptamers of frequency of occurrences highest are respectively：DBP-1：5' CTTTCTGTCCTTCCGTCACATCCCACGCATTCTCCACAT3', and DBP-2:5' CTTTCTGTCCTTCCGTCACAGGTCCCACGCATTCTCCACAT3'.
A kind of screening of phthalic ester plasticizer single stranded DNA nucleic acid aptamers and sign that the present invention provides and should With the method for its electrochemical sensor, comprise the steps：Step one：Prepare a linear fat wherein by chemosynthesis The end of fat side chain has the derivant (DBP-NH of the dibutyl phthalate (DBP) of amino group2)；Step 2：Pass through Oxirane activating group in amino and agarose microbeads carries out condensation reaction by DBP-NH2It is covalently attached to agarose microbeads On；Step 3：Carry out the SELEX screening based on solid phase detached DNA aptamer；Step 4：To the richness obtaining after screening Collection library carries out high-flux sequence；Step 5：To frequency of occurrences highest two sequences DBP-1 and DBP-2 in high-flux sequence Carry out affinity and selective test；Step 6：Build the electrochemical sensor based on DBP-1.
The present invention also provides a kind of electrochemica biological sensor based on above-mentioned aptamer, and its signal probe is DBP-1-10T-C-Fc or DBP-1-C-Fc.
The present invention has the neighbour of amino group by the end that chemosynthesis are prepared for a linear aliphatic side chain wherein Derivant (the DBP-NH of phthalic acid dibutyl ester (DBP)2).Then pass through oxirane activating in amino and agarose microbeads Group carries out condensation reaction by DBP-NH2It is covalently attached in agarose microbeads.Subsequently carry out fitting based on the detached nucleic acid of solid phase Ligand screening.After 4 wheel screenings, high-flux sequence is carried out to the enriched library obtaining, find front 100 DNA of frequency of occurrences highest Sequence is all from same family.Using Real-time quantitative PCR to 2 aptamers of frequency of occurrences highest (DBP-1 and DBP-2) to DBP-NH2Affinity tested, respectively 70 ± 5nM and 100 ± 5nM.DBP-1 and DBP-2 to DBP, The affinity of DEHP, BBP compares DBP-NH2Affinity high 1.5-4.0 times.DBP-1 and DBP-2 all has to DBP, DEHP, BBP There is good specificity, to the small molecules such as glucose, kanamycin and ethanol and heavy metal ion (Hg2+,Pb2+,Ni2+,Cd2+) There is no significant affinity.DBP electrochemical sensor is constructed based on this aptamer.This sensor has to DBP very well Selectivity and sensitivity.Detection limit reaches 10pM, kinetics interval 10pM-1mM.Due to phthalic ester plasticizer Structural similarity it is contemplated that the aptamer of the present invention other phthalic ester plasticizers also should be had high Affinity and selectivity.
The present invention has following feature and technical advantage：
(1) the single stranded DNA nucleic acid aptamers sequence that the present invention obtains, with DBP, BBP and DEHP be respectively provided with very high affine Power (dissociation constant KdRespectively in nM scope), and there is good specificity.Structure due to phthalic ester plasticizer Similarity it is contemplated that the aptamer of the present invention other phthalic ester plasticizers also should be had high affine Power and selectivity.
(2) target solid phase fixed form of the present invention is first the hydrophobic side chain of DBP to be chemically modified acquisition DBP-NH2, then by condensation reaction between amino and epoxide group by DBP-NH2It is covalently attached to oxirane activating So that ditridecyl phthalate group is exposed to the surface of microsphere in agarose microbeads, thus can realize to O-phthalic The screening of the common functional group of acid ester type plasticizer, rather than only screen a kind of specific phthalic ester plasticizer.
(3) mentioned in (2) target molecule solid phase fixed form can also significantly reduce interface non-specific adsorption and Reduce screening wheel number, the present invention combines high throughput sequencing technologies, only pass through 4 wheel screenings and just obtain highly enriched nucleic acid adaptation Body.
(4) the aptamer primer region sequence of the phthalic ester plasticizer of the present invention is not engaged in and target molecule Combination, so both can save the complex work of Engineering Design, biography can be greatly reduced because probe length is shorter again The cost of sensor and simplification sensor design, are highly convenient for the application of this aptamer.
(5) this nucleic acid aptamer sequence can be with the various sensing platform knots including electrochemical sensor Close, realize to the highly sensitive of phthalic ester plasticizer and detect with high specificity；With the detection skill based on large-scale instrument Art is compared, and the transducer production method based on aptamer is simple, operation is more convenient, low cost, suitable Site Detection.
The present invention utilizes the in-vitro screening technology (SELEX of aptamer：The Fas lignand system evolution technology skill of index concentration Art), screening in the random dna library chemically synthesizing obtains and has high specific and height parent with phthalic ester plasticizer Single stranded DNA nucleic acid aptamers with power.Structure for food and the new detecting method of phthalic ester plasticizer in environment Lay the foundation.
The present invention has the neighbour of amino group by the end that chemosynthesis are prepared for a linear aliphatic side chain wherein Derivant (the DBP-NH of phthalic acid dibutyl ester (DBP)2).Then pass through oxirane activating in amino and agarose microbeads Group carries out condensation reaction by DBP-NH2It is covalently attached in agarose microbeads.Subsequently carry out fitting based on the detached nucleic acid of solid phase Ligand screening.After 4 wheel screenings, high-flux sequence is carried out to the enriched library obtaining, find front 100 DNA of frequency of occurrences highest Sequence is all from same family.Using Real-time quantitative PCR to 2 aptamers of frequency of occurrences highest, DBP-1 and DBP-2, to DBP-NH2Affinity tested, respectively 70 ± 5nM and 100 ± 5nM.DBP-1 and DBP-2 to DBP, The affinity of DEHP, BBP compares DBP-NH2Affinity high 1.4-4.0 times.DBP-1 and DBP-2 is respectively provided with single-minded well Property, the representativeness chaff interference such as relative affinity ratio glucose, kanamycin, ampicillin and ethanol is high 240-1100 times.It is based on This aptamer constructs DBP electrochemical sensor.This sensor has good selectivity and sensitivity to DBP.Detection Limit reaches 10pM, kinetics interval 10pM-1mM.Due to phthalic ester plasticizer structural similarity it is contemplated that this The aptamer of invention also should have high affinity and selectivity to other phthalic ester plasticizers.The present invention Compensate for there is no the vacancy of phthalate compound aptamer.As one kind, there is high-affinity and specific Bio-identification, the aptamer of the present invention can be used for developing various detection techniques and biosensor.For food Or the easy detection of the phthalic ester plasticizer in environment has significant application value.
Brief description
Fig. 1 is the Technology Roadmap that the present invention carries out the screening of phthalic ester plasticizer single stranded DNA nucleic acid aptamers.
Fig. 2 is DBP-NH in the present invention2Synthetic route chart.
Fig. 3 is the characterize data of the one-dimensional nucleus magnetic hydrogen spectrum of DBP-NH-Boc in the present invention (compound 2).
Fig. 4 is DBP-NH in the present invention2The Electrospray Mass Spectrometry characterize data of (compound 3).
Fig. 5 is that the present invention utilizes fluorescence inverted microscope to characterize two bioaccumulation efficiency highest aptamers respectively (DBP-1 and DBP-2) is to DBP-NH2Modify the affinity of agarose microbeads and selective fluorescence picture：(a) unmodified DBP- NH2Agarose microbeads；Unmodified DBP-NH after (b) and DBP-1-FAM and DBP-2-FAM incubation2Agarose microbeads；(c) With the DBP-NH after DBP-1-FAM and DBP-2-FAM incubation2The agarose microbeads modified.
Fig. 6 is that the present invention utilizes Real-time quantitative PCR to measure DBP-1 (a) and DBP-2 (b) respectively to DBP-NH2Parent Datagram with power.
Fig. 7 is that the present invention utilizes Real-time quantitative PCR to DBP-1 (a) and DBP-2 (b) to DBP-NH2、BBP、DBP、 DEHP and the relative affinity test data to selectivity test solution, the numerical value of relative affinity is under each test sample competition The quantity of DBP-1-RT-PCR or DBP-2-RT-PCR coming competes, divided by the presence of selectivity test solution, the DBP-1- getting off The quantity of RT-PCR or DBP-2-RT-PCR.
Fig. 8 is the schematic diagram (a) of the electrochemical sensor that the present invention is built based on DBP-1, detection 16 kinds of variable concentrations PAE mixes square wave volt-ampere curve (b, c) and the heavy metal ion (Hg of standard substance2+,Pb2+,Ni2+) and antibiotic (10 μM are blocked that Mycin and 10 μM of sulfadimethoxine biased samples) selectivity test (d).Wherein (b) and (c) is corresponding respectively uses DBP-1- 10T-C-Fc and DBP-1-C-Fc is as the sensor of signal probe.
Specific embodiment
Table 1：Used in the present invention, (in table, the sequence of underscore is the area being combined with primer in PCR to nucleic acid probe sequence Domain)
Front 100 nucleotide sequences (5'-3') of frequency of occurrences highest being obtained by high-flux sequence in table 2 present invention
Sorted from high to low with the sequence frequency of occurrences in high-flux sequence.Article first, the underscore part of sequence is highly rich The conserved sequence of collection.It to be the part of the variation compared with sequence 1 that black matrix in other sequences is underlined.
Embodiment 1:Screen the single stranded DNA core of phthalic ester plasticizer using SELEX and high throughput sequencing technologies The technology path of sour aptamers
As shown in figure 1, the utilization SELEX of the present invention and high throughput sequencing technologies screen phthalic ester plasticizer The technology path of single stranded DNA nucleic acid aptamers comprises the following steps：(1)DBP-NH2Chemosynthesis and sign；(2)DBP-NH2 Agarose microbeads (Epoxy-activated Sepharose with epoxy activationTMCoupling 6B) and sign；(3) by 6 × 1014 (1nmol) the initial single-stranded DNA banks (pool being commercially synthesized0, table 1) and DBP-NH2The agarose microbeads mixing being coupled is incubated Educate；(4) DNA sequence combining the agarose microbeads of aptamer with do not combine with agarose microbeads is carried out separating and Rinse；(5) carry out thermal washing to the aptamer in the agarose microbeads after rinsing to take off；(6) adopt the anti-of 5 end phosphate radicals modifications Phase primer (PO4- RP-SELEX, table 1) and forward primer (FP-SELEX, table 1), the aptamer eluting is carried out PCR expands；(7) the complementary chain degradation that phosphate radical is modified by the circumscribed enzyme reaction of λ, low cost preparation single-stranded DNA banks, this article are carried out Storehouse enters next screening circulation；Library (pool after (8) 4 wheel SELEX4) carry out high-flux sequence；(9) to the frequency of occurrences Two high aptamer DBP-1 and DBP-2 carry out affinity and selectivity characterizes.
Embodiment 2:Aminoderivative (the DBP-NH of DBP2) synthesis and sign
DBP-NH2Synthetic route as shown in Figure 2.In the present embodiment, reagent used is that analysis is pure, and each step was reacted Cheng Jun carries out real-time monitoring with thin layer chromatography, and product is isolated and purified by silicagel column.Specific synthetic method, condition and table Levy following (1-3) described：
(1) preparation of phthalic acid mono-n-butylester (compound 1)
In the oxolane containing phthalic acid anhydride (8.5g, 57mmol) and Non-aqueous processing (7.5 milliliters) and cleaning N-butyl alcohol (5 milliliters) is added, 60 DEG C are heated to reflux under magnetic stirring in the round-bottomed flask of 50 milliliters of dryings of magneton being dried 9 hours.Insoluble white solid is had to generate.Place sucking filtration after room temperature, with sucking filtration again after oxolane cleaning bottle.After revolving White slurry material.Add CH2Cl2Afterwards, there is white precipitate.Sucking filtration revolving obtains oily liquids.Add 100 ml deionized water, Extracted 3 times with isopyknic ethyl acetate again, with saturation NaCl extraction organic faciess 1 time, finally use anhydrous Na2SO4Drying is organic Phase, stands overnight.Filter, be spin-dried for obtaining 10.986g, through silica gel column separating purification (methylene chloride/methanol (95:5) it is mobile phase). It is spin-dried for rear evacuation and obtain 2.1g phthalic acid mono-n-butylester (compound 1).High performance liquid chromatography (Agilent 1200) is separated into Unimodal, products pure.
(2) preparation of DCC condensation product (compound 2)
In this experiment, phthalic acid mono-n-butylester (compound 1) and 5- (N- tert-butoxy amino) -1- amylalcohol press 1:1.2 throwing Material.Add phthalic acid mono-n-butylester (1.158g) in 20mL anhydrous tetrahydro furan, under magnetic agitation and ice-water bath, add bicyclo- Hexyl carbodiimide (DCC, 5.495g).Add DMAP (DMAP, 0.217g) after 10 minutes, add after 20 minutes 5- (N- tert-butoxy amino) -1- amylalcohol (1.723g is dissolved in the anhydrous tetrahydro furan of 5ml, is added dropwise over).In ice-water bath stirring After 1 hour, remove ice-water bath room temperature reaction 24 hours.Reactant liquor is carried out sucking filtration, washs flask with anhydrous oxolane, take out Filter, by filtrate revolving.Add 20 milliliters of petroleum ether, sucking filtration.It is placed in refrigerator overnight sucking filtration, taken out with petroleum ether flask Filter, revolving.Then (eluant is petroleum ether to cross silica column purification product：Ethyl acetate=4:1(v:V)), revolving.After purification Arrive about 0.5g DCC condensation product (compound 2).(VNMRS-600 megahertz, TMS is internal standard to one-dimensional nucleus magnetic hydrogen spectrum sign, CDCl3 For solvent) confirm to obtain expected compound 2 (Fig. 3).
(3) the DBP derivant (DBP-NH that alkyl chain terminal amino group is modified2) (compound 3) preparation
By DCC condensation product (compound 2) (0.5g), dichloromethane (DCM, 2 milliliters) and trifluoroacetic acid (TFA, 2 milliliters) Add in three-neck flask, magnetic agitation 40 minutes at room temperature.Then mixture is filtered, rotary evaporation, obtain oily liquids.Oil Property liquid is extracted with ethyl acetate three times, and uses saturation NaHCO3Washed once, use anhydrous sodium sulfate drying.Finally, passed through Filter, rotary evaporation, obtain 0.1g DBP-NH2.Electrospray Mass Spectrometry (Agilent LC/SMDTOF) shows that molecular ion peak is 308.1856, with compound 3 (C17H25O4N theoretical molecular) coincide (Fig. 4), illustrates to be successfully prepared compound 3.
Embodiment 3:DBP-NH2Coupling in the agarose microbeads of epoxy activation
The agarose microbeads of 0.1g epoxy activation are added deionized water swelling, and with 20mL deionized water cyclic washing, obtain Obtain 350 μ L wet bulbs.Then use 0.2M Na2CO3(pH ≈ 12) washs agar sugar ball.46.7mg is added in 500 μ L reaction systems (0.15mmol)DBP-NH2, it is placed in oscillating reactionss 48 hours under room temperature condition.The sodium acetate buffer of pH 4.5 is used in reaction after terminating Solution (0.1M Sodium Acetate Trihydrate, 0.5M NaCl) and pH 12 sodium carbonate buffer (0.2M NaHCO3/Na2CO3, 0.5M NaCl) Alternately and repeatedly washing agarose microbeads three times, finally wash with water, and are settled to 500 μ L, 4 DEG C of Refrigerator stores are standby.Element divides Analysis (Elementar Vario MICROCUBE, Germany) shows each composition Elements C of agar sugar ball, and the ratio shared by H, N, S is divided Wei 33.61%, 9.26%, 0.92% and 1.09%.It is coupled DBP-NH2Afterwards, Elements C, the ratio shared by H, N, S are respectively formed It is respectively 50.21%, 7.88%, 2.3% and 0.9%, after being wherein coupled, being significantly increased of C and N ratio confirms DBP-NH2Become It is coupled in the agarose microbeads of epoxy activation work(.
Embodiment 4:SELEX screens
Present invention screening random single-stranded DNA banks (Pool used0, table 1) had by raw work biological engineering (Shanghai) share Limit company synthesizes, through polyacrylamide gel electrophoresis (PAGE) purification.Pool080 bases of total length, are 20 including two ends length The fixed sequence program of individual base and the random sequences of middle 40 bases longs.Fixed sequence program be SELEX PCR step in respectively with Forward primer (FP-SELEX, table 1) and downstream primer (PO4- RP-SELEX, table 1) calmodulin binding domain CaM.Forward primer and downstream are drawn Thing is synthesized by precious biological engineering (Dalian) company limited (TaKaRa).Wherein downstream primer 5 ' end carries out phosphorylation modification. Pool0, FP-SELEX and PO4- RP-SELEX is all with 1 × Tris-EDTA buffer (10mM Tris, 1mM EDTA, pH 8.0) It is configured to 100 μM of storing liquid, store for future use in -80 DEG C.
The first round screens：Pool by 1nmole0(100 μM of storing liquids, 10 μ L) are diluted in combination buffer BB of 490 μ L In (20mM Tris, 100mM sodium chloride, 2mM magnesium chloride, 5mM potassium chloride, 1mM calcium chloride, 1%Tween20,0.03% Triton X-100,2%DMSO, pH 7.9).By above-mentioned solution in 95 DEG C heat 10 minutes, ice-water bath quenching 5 minutes, put to Room temperature.It is connected to DBP-NH by prepare in embodiment 32Agarose microbeads (100 μ L) washed three times with combination buffer BB. Then by the pool after adding above-mentioned heat treatment in the agarose microbeads after above-mentioned washing0Solution, room temperature rotation incubation 1 is little When.Separated with 10K super filter tube, agar sugar ball washed after three times with combination buffer BB, add 100 μ L combination buffers BB, Separated with super filter tube after 90 DEG C of concussions are heated ten minutes, collect supernatant.By eluent enter performing PCR amplification, reaction overall Amass as 2mL.The PCR primer being obtained PAGE carries out using ethanol precipitation purified pcr product after qualitative characterization.Then use Lamda exonuclease digestion method carries out the preparation of single stranded DNA, then purifies the single stranded DNA literary composition obtaining enrichment with ethanol precipitation Storehouse Pool1.
2-4 takes turns SELEX：The Pool that first round SELEX is obtained is quantitative after redissolving, and puts into about 300pmol and carries out next The screening of wheel, concrete screening process is identical with first round screening with condition.Finally obtain single-stranded DNA banks Pool of enrichment4.
Embodiment 5:Pool4High-flux sequence analysis
By Pool4Deliver to Beijing Nuo Hezhi source bio information Science and Technology Ltd. and carry out high-flux sequence.High-flux sequence Result (table 2) display front 100 single-stranded DNA sequence of frequency of occurrences highest are highly enriched, from same family (5' CTTTCTGTCCTTCCGTCACN1-4TCCCACGCATTCTCCACAT3'), and rich in C base.Wherein frequency of occurrences highest Front 2 single-stranded DNA sequence are respectively：
DBP-1：5'CTTTCTGTCCTTCCGTCACATCCCACGCATTCTCCACAT3'(39 base)
DBP-2:5'CTTTCTGTCCTTCCGTCACAGGTCCCACGCATTCTCCACAT3'(41 base)
This two aptamers differ only by 2 bases (underscore marks).
Embodiment 6:Measure DBP-1 and DBP-2 using fluorescence inverted microscope to DBP-NH2Modify the parent of agarose microbeads With power and selectivity
By 5 ' end fluorophor FAM modify DBP-1 and DBP-2 (1 μM, DBP-1-FAM and DBP-2-FAM, table 1, Shanghai Sheng Gong Bioisystech Co., Ltd) respectively with blank and 10 μ L DBP-NH2The agarose microbeads modified combine buffering in 200 μ L It is incubated 1 hour in liquid BB, be put in after cleaning on clean microscope slide, observed using fluorescence inverted microscope and take pictures.
As shown in figure 5, agarose microbeads fluorescence itself is very weak (a)；With the sky after DBP-1-FAM and DBP-2-FAM incubation The fluorescence of white agarose microbeads is also very weak (b)；With the DBP-NH after DBP-1-FAM and DBP-2-FAM incubation2The agarose modified Microsphere all shows strong fluorescent brightness (c).Experimental result explanation DBP-1 and DBP-2 is all to DBP-NH2The agarose microbeads modified There is stronger affinity, and be the optionally DBP-NH with microsphere surface2In conjunction with not being combined with agarose microbeads substrate. DBP-NH after being wherein incubated with DBP-1-FAM2After the fluorescent brightness rate of the agarose microbeads modified is higher than DBP-2-FAM incubation DBP-NH2The agarose microbeads modified, illustrate DBP-1 to DBP-NH2Affinity more slightly higher than DBP-2.This experimental result also table Bright, DBP-1 and DBP-2 just can be to DBP-NH without the primer region sequence participation of Pool2There is good affinity and selection Property, so both can save the complex work of Engineering Design, sensor can be greatly reduced because probe length is shorter again Cost and simplify sensor design, be highly convenient for the application of this aptamer.
Embodiment 7:Real-time quantitative PCR (RT-PCR) measures DBP-1 and DBP-2 to DBP-NH2Affinity
(1) it is used for the design of nucleic acid aptamer probe and the synthesis of affinity test
RT-PCR technology quantitation and DMP-NH is utilized in the present embodiment2The number of the aptamer that the magnetic bead modified combines Amount.For this reason, adding the guiding region for PCR amplification at the two ends of DBP-1 and DBP-2 respectively, obtain two sequences DBP-1-RT- PCR and DBP-2-RT-PCR (table 1, Shanghai Sheng Gong Bioisystech Co., Ltd).It is worthy of note that being adopted in this experiment Primer region sequence different from the guiding region used in SELEX screening process, if test result shows aptamer still So there is affinity, fully proved DBP-1 and DBP-2 without Pool primer region sequence participate in just can be to DBP-NH2Tool There are good affinity and selectivity.
(2)DBP-NH2The preparation of the magnetic bead modified
Draw 100 μ L DynabeadsTMThe magnetic bead that M-270 carboxylic acid is modified, 2- (N- morpholine) second with 100 μ L 25mM Sulfonate buffer (MES, pH 5.0) is sufficiently mixed 10 minutes.Centrifuge tube is positioned over strong magnets carried out magnetic upper 4 minute and divide From, remove supernatant after cleaned twice with 200 μ L MES solution.In above-mentioned MES solution, difference is fresh prepares 50mg/mL's The NHS solution of EDC solution and 50mg/mL.Sequentially add the above-mentioned EDC solution of 100 μ L and the above-mentioned NHS solution of 100 μ L in washing In the magnetic bead crossed, fully mix, under room temperature, low speed shakes 30 minutes.Centrifuge tube is positioned over strong magnets upper 4 minute, removes Clear liquid.Clean 2 times with 200 μ L MES solution.Then add the DBP-NH of 6 μ L 100mM in the magnetic bead after activation2, add MES solution, makes final solution volume be 300 μ L.Fully mix, be incubated 30 minutes at room temperature.Place 4 points on strength magnet Clock, removes supernatant.Clean 4 times with 200 μ L with reference to buffer solution.It is eventually adding 100 μ L 1XPBS (NaCl 137mM, KCl 2.7mM, Na2HPO410mM, KH2PO42mM, pH 7.4), be positioned over 4 DEG C standby.
(3) affinity (dissociation constant Kd) mensure
In combination buffer BB configure variable concentrations DBP-1-RT-PCR or DBP-2-RT-PCR (1pM, 10pM, 100pM、1nM、10nM、50nM、75nM、100nM、200nM、300nM).Above-mentioned aptamer solution is separately added into equivalent DBP-NH prepared by step (2)2The M-270 magnetic bead (10 μ L) modified, incubated at room 30 minutes.4 are placed on strength magnet After minute, remove supernatant.Clean 4 times with 200 μ L with reference to buffer solution.Add 100 μ L combination buffers BB, shake at 90 DEG C Carry out Magnetic Isolation after swinging heating ten minutes, collect supernatant.Supernatant is carried out RT-PCR.Determined according to standard curve Using variable concentrations aptamer when, the amount of the aptamer being combined with magnetic bead.Draw the DBP-1- being combined with magnetic bead Relation curve (the figure of the amount of RT-PCR or DBP-2-RT-PCR and the concentration of DBP-1-RT-PCR or DBP-2-RT-PCR putting into 6).According to aptamer and DBP-NH2For 1:1 combination ratio, calculates K using nonlinear fittingdValue is respectively：70± 5nM (DBP-1-RT-PCR, Fig. 6 a) and 100 ± 5nM (DBP-2-RT-PCR, Fig. 6 b), error is derived from three repeated experiments.And Start library pool0To DBP-NH2The magnetic bead modified does not have affinity.
Embodiment 8:Using RT-PCR test DBP-1 and DBP-2 to DBP-NH2, the relative affinity of BBP, DBP, DEHP Test and to the selectivity that may interfere with thing
Due in environment occur plasticizer all do not have amido modified, and species more it is necessary to test screened Whether aptamer out also has good affinity and selectivity to these plasticizers.We conducted following for this Competitive assay measure DBP-NH2, BBP, DBP, DEHP relative affinity test and to the selectivity that may interfere with thing.
By DBP-1RT-PCR or DBP-2-RT-PCR (5 μ L, 10 μM) of same volume same concentrations respectively with equivalent (10 μ L DBP-NH)2The magnetic bead modified is incubated 1 hour in the combination buffer solution of 500 μ L, then combines buffering with 100 μ L molten Liquid cleans 3 times.By the DBP-NH being 10 μM with 120 μ L concentration respectively in the magnetic bead after cleaning2, DBP, DEHP, BBP or containing many Selectivity test solution mixing 1 hour of incubation of type small molecule.Glucose is contained, to block that mould in selectivity test solution The representational chaff interference such as element, ampicillin, ethanol, concentration is 10 μM.After strength magnet is placed 4 minutes, remove Clear liquid.RT-PCR is carried out to the amount of DBP-1-RT-PCR or DBP-2-RT-PCR in supernatant, supernatant is determined according to standard curve The amount of DBP-1-RT-PCR or DBP-2-RT-PCR in liquid.
In above-mentioned experiment, DBP-1-RT-PCR or DBP-2-RT-PCR is first in DBP-NH2Combine on the magnetic bead modified, with The DBP-NH adding afterwards2Or DBP or DEHP or BBP or selectivity test solution and DBP-NH2The magnetic bead modified is at war with, portion Divide the DBP-NH in DBP-1-RT-PCR or DBP-2-RT-PCR and solution2Or DBP or DEHP or BBP or selectivity test solution Composition combine, hence into solution.So in supernatant, the quantity of DBP-1-RT-PCR or DBP-2-RT-PCR just reflects DBP-NH2Or the relative affinity of DBP or DEHP or BBP or selectivity test solution.
As shown in fig. 7, for expressing simple, intuitive, DBP-1-RT-PCR or DBP- competing with selectivity test solution The relative populations of 2-RT-PCR are 1, that is, the numerical value of relative affinity be DBP-1-RT-PCR that each test sample competes or The quantity of DBP-2-RT-PCR competes, divided by the presence of selectivity test solution, DBP-1-RT-PCR or DBP-2-RT- getting off The quantity of PCR.Draw DBP-1 (a) and DBP-2 (b) to DBP-NH2, the relative affinity of BBP, DBP, DEHP.DBP-1-RT- PCR or DBP-2-RT-PCR is to DBP-NH2Or the relative affinity comparison selectivity test solution of DBP or DEHP or BBP is high about 240～1100 times, illustrate that the aptamer that the present invention is screened has good selectivity.In addition DBP-1-RT-PCR and DBP-2-RT-PCR all compares DBP-NH to the relative affinity of DBP, DEHP and BBP2Affinity high about 1.4～4.0 times.Say The aptamer that the bright present invention is screened has good affinity to plasticizer, or even repaiies than the amino being used during screening The affinity of the DBP of decorations is also high.The above results show that the aptamer that the present invention is screened has high parent to common plasticizers With power and specificity, this is that the basis of molecular recognition established by the structure of the plasticizer new detecting method based on aptamer, Development to the detection technique of plasticizer in environment and food is significant.
Embodiment 9:The structure of the plasticizer electrochemica biological sensor based on aptamer DBP-1 and the inspection of plasticizer Survey
(1) cleaning of disk gold electrode surfaces
With ultrapure water gold disk electrode (a diameter of 2mm), successively with 1 μm, 0.3 μm, 0.05 μm of Al2O3Polishing powder Polishing electrode surface (adds a small amount of ultra-pure water and pressed powder polishing 5-10 minute) on polishing cloth, uses ultra-pure water after polishing every time After flushing, ultrasonic 5 minutes in ultra-pure water, then carry out next polishing step.The electrode polishing smooth passes through three-electrode system Connect VMP3 multi-channel electrochemical work station in 0.5M H2SO4In swept as cyclic voltammetric with 100mV/s with -0.4～1.2V scope Retouch 36 circles (with gold electrode as working electrode, with saturation Mercurous sulfate electrode as reference electrode, platinum electrode is to electrode), until following Ring voltammogram is basicly stable.Significantly correspond to redox peaks as do not observed, again above-mentioned steps polishing gold electrode.(2) base The structure of the plasticizer electrochemical sensor (SD-EAB) replacing in signal probe chain
100 μ L are contained the terminal modified oxidizing reducing group ferrocene (Fc) of 0.5 μM of HS-DBP-1 (table 1) and 0.5 μM of 3' DBP-1-10T-C-Fc (table 1) or DBP-1-C-Fc (table 1) PBS/1M NaCl solution (1 × PB, 1M NaCl, pH= 7.4) in 95 DEG C of heating in water bath 10min, slow cooling is to room temperature.It is subsequently adding 1 μ L TCEP (10mM), room temperature is placed 1 hour.By (1) Disk gold electrode after middle cleaning puts into above-mentioned solution, and ambient temperature overnight assembles.Washed with PBS/1M NaCl solution three times, by electricity 100 μ L 1mM [S (CH are put in pole2)2(OCH2CH2)6OCH3]2(OEG6OMe PBS/1M NaCl solution), incubated at room 1 is little When.Washed with PBS/1M NaCl solution three times, be finally placed on and balance 1 hour with reference in buffer solution BB, sweep SWV and obtain surely Determine baseline standby.
(3) detection of PAE and selectivity test
By containing of 16 PAE mixed standard solutions of variable concentrations (Chem Service, every kind of containing 10ppm) or 10 μM There are different heavy metal ion (Hg2+,Pb2+,Ni2+,Cd2+) combination buffer solution BB and electrode be incubated 1 hour after sweep SWV.HS- DBP-1 can be specifically combined with PAE, rejects complementary DBP-1-10T-C-Fc or DBP-1-C-Fc, thus leading to electric current The reduction (Fig. 8 a) of signal.Thus can be realized to DBP or other by scanning the change of square wave volt-ampere monitoring current The detection by quantitative of PAE.
Test result indicate that (Fig. 8), electrochemica biological can be built by Engineering Design using the DBP-1 filtering out and pass Sensor detects, two kinds of different signal probe designs：DBP-1-10T-C-Fc (Fig. 8 b) or DBP-1-C-Fc (Fig. 8 c) is all real Now, being detected, detection limit is less than 160ppt to the high sensitivity of PAE, detection interval is 160ppt～1.6ppm.Other 10 μM of Hg2 +,Pb2+,Ni2+, and the mixture (Kana+Sulf) of the sulfadimethoxine of 10 μM of kanamycin and 10 μM all significantly less than The response (Fig. 8 d) of 16 PAE mixed standard solutions of 1.6ppm (being roughly equal to 4 μM), illustrates the choosing that this electrochemical sensor has had Selecting property.

Claims (16)

1. a kind of phthalic ester plasticizer single stranded DNA nucleic acid aptamers are it is characterised in that this aptamer is and neighbour Phthalic easter plastizer has the aptamer of high specific and high-affinity.
2. aptamer according to claim 1 it is characterised in that this aptamer single-stranded DNA sequence height Enrichment, from same rich in C base family.
3. aptamer according to claim 2 is it is characterised in that the single-stranded DNA sequence of this aptamer is 5' CTTTCTGTCCTTCCGTCACN1-4TCCCACGCATTCTCCACAT3' and/or the variant for its single base or double alkali yl.
4. aptamer according to claim 3 is it is characterised in that the single-stranded DNA sequence of this aptamer is DBP-1：5'CTTTCTGTCCTTCCGTCACATCCCACGCATTCTCCACAT3'.
5. aptamer according to claim 3 is it is characterised in that the single-stranded DNA sequence of this aptamer is DBP-2:5'CTTTCTGTCCTTCCGTCACAGGTCCCACGCATTCTCCACAT3'.
6. a kind of phthalic ester plasticizer single stranded DNA nucleic acid aptamers screening with characterize method it is characterised in that The method comprises the steps：Step one：Ammonia is had by the end that a linear aliphatic side chain wherein is prepared in chemosynthesis The derivant (DBP-NH2) of the dibutyl phthalate (DBP) of base group；Step 2：By on amino and agarose microbeads Oxirane activating group carry out condensation reaction DBP-NH2 be covalently attached in agarose microbeads；Step 3：It is based on The detached aptamer of solid phase screens；Step 4：After screening, high-flux sequence is carried out to the enriched library obtaining.
7. method according to claim 6 is it is characterised in that step one is as follows：(1) phthalic acid mono-n-butylester (chemical combination Thing 1) preparation；The preparation of DCC condensation product (compound 2)；DBP derivant (the DBP-NH that alkyl chain terminal amino group is modified2) The preparation of (compound 3).
8. method according to claim 6 it is characterised in that the preparation of (1) phthalic acid mono-n-butylester (compound 1) such as Under：By phthalic acid anhydride (8.5g, 57mmol), n-butyl alcohol (5 milliliters), the oxolane (7.5 milliliters) of Non-aqueous processing and The magneton of clean dried is put in the round-bottomed flask of 50 milliliters of dryings, and 60 DEG C are heated to reflux 9 hours under magnetic stirring, have insoluble White solid generate, place sucking filtration after room temperature, with sucking filtration again after oxolane cleaning bottle, after revolving white slurry thing Matter, adds CH2Cl2Afterwards, there is white precipitate, sucking filtration revolving obtains oily liquids, add 100 ml deionized water, then use equal-volume Ethyl acetate extract 3 times, with saturation NaCl extraction organic faciess 1 time, finally use anhydrous Na2SO4Organic faciess are dried, stand overnight, Filter, be spin-dried for obtaining 10.986g, silica gel column separating purification, be spin-dried for rear evacuation and obtain 2.1g phthalic acid mono-n-butylester, efficient liquid phase Chromatograph (Agilent 1200) is separated into unimodal, products pure；Preparing of DCC condensation product (compound 2) is as follows：O-phthalic Sour mono-n-butylester and 5- (N- tert-butoxy amino) -1- amylalcohol press 1:1.2 feed intake, and add O-phthalic in 20ml anhydrous tetrahydro furan Sour mono-n-butylester (1.158g), under magnetic agitation and ice-water bath, adds dicyclohexylcarbodiimide (DCC, 5.495g), after 10 minutes Add DMAP (DMAP, 0.217g), after 20 minutes add 5- (N- tert-butoxy amino) -1- amylalcohol (1.723g, It is dissolved in the anhydrous tetrahydro furan of 5ml, be added dropwise over), after ice-water bath stirs 1 hour, remove ice-water bath room temperature reaction 27 hours, will Reactant liquor carries out sucking filtration, washs flask, sucking filtration with anhydrous oxolane, filtrate revolving adds 20 milliliters of petroleum ether, Sucking filtration, is placed in refrigerator overnight sucking filtration, with petroleum ether flask sucking filtration, revolving, and (eluant is then to cross silica column purification product Petroleum ether：Ethyl acetate=8:2(v:V)), revolving, obtains about 0.5g DCC condensation product after purification, and one-dimensional nucleus magnetic hydrogen spectrum characterizes (VNMRS600 megahertz, TMS is internal standard, CDCl3For solvent) confirm to obtain expected compound 1；Alkyl chain terminal amino group is modified DBP derivant (DBP-NH2) (compound 3) prepare as follows：By DCC condensation product (0.5g), dichloromethane (DCM, 2 millis Rise) and trifluoroacetic acid (TFA, 2 milliliters) addition three-neck flask in, magnetic agitation 40 minutes at room temperature, then by mixture mistake Filter, rotary evaporation, obtain oily liquids, oil-based liquid is extracted with ethyl acetate three times, and uses saturation NaHCO3Washed once, with no Aqueous sodium persulfate is dried, finally, through filtering, rotary evaporation, and obtain 0.1g DBP-NH2.
9. method according to claim 6 is it is characterised in that step 2 is as follows：Will be micro- for the agarose of 0.1g epoxy activation It is swelling that ball adds deionized water, and with 20mL deionized water cyclic washing, obtains 350 μ L wet bulbs.Then use 0.2M Na2CO3(pH≈ 12) wash agar sugar ball, 500 μ L reaction systems add 46.7mg (0.15mmol) DBP-NH2, it is placed in and shake under room temperature condition Swing reaction 48 hours, sodium acetate buffer (0.1M Sodium Acetate Trihydrate, 0.5M NaCl) and the pH 12 of pH 4.5 is used in reaction after terminating Sodium carbonate buffer (0.2M NaHCO3/Na2CO3, 0.5M NaCl) alternately and repeatedly washing agarose microbeads three times, finally use Water washing, and it is settled to 500 μ L, 4 DEG C of Refrigerator stores are standby.
10. method according to claim 6 is it is characterised in that step 3 includes 4 wheel screenings.
11. methods according to claim 10 are it is characterised in that screen random single-stranded DNA banks (Pool used0, table 1) synthesized by Sangon Biotech (Shanghai) Co., Ltd., through polyacrylamide gel electrophoresis (PAGE) purification, Pool0Entirely Long 80 bases, the random sequences of 40 bases longs of fixed sequence program and centre being 20 bases including two ends length, fixing Sequence be SELEX PCR step in respectively with forward primer (FP-SELEX, table 1) and downstream primer (PO4- RP-SELEX, table 1) calmodulin binding domain CaM, forward primer and downstream primer are synthesized by precious biological engineering (Dalian) company limited (TaKaRa).Wherein Downstream primer 5 ' end carries out phosphorylation modification, Pool0, FP-SELEX and PO4- RP-SELEX is all with 1 × Tris-EDTA buffer (10mM Tris, 1mM EDTA, pH8.0) is configured to 100 μM of storing liquid, stores for future use in -80 DEG C；
The first round screens：Pool by 1nmole0(100 μM of storing liquids, 10 μ L) are diluted in the combination buffer of 490 μ L (20mMTris, 100mM sodium chloride, 2mM magnesium chloride, 5mM potassium chloride, 1mM calcium chloride, 1%Tween20,0.03%triton X-100,2%DMSO, pH 7.9), above-mentioned solution is heated 10 minutes in 95 DEG C, ice-water bath quenching 5 minutes, side to room temperature, will In embodiment 3, preparation is connected to DBP-NH2Agarose microbeads (100 μ L) wash three times with combination buffer, then will be The pool after above-mentioned heat treatment is added in agarose microbeads after above-mentioned washing0Solution, room temperature rotation incubation 1 hour, surpassed with 10K Chimney filter separates, and agar sugar ball is washed after three times with combination buffer, adds 100 μ L combination buffers, in 90 DEG C of concussion heating Separated with super filter tube after ten minutes, collect supernatant, eluent is entered performing PCR amplification, the cumulative volume of reaction is 2mL, is obtained PCR primer carry out using ethanol precipitation purified pcr product after qualitative characterization with PAGE, then disappeared with Lamda exonuclease Change method carries out the preparation of single stranded DNA, then purifies single-stranded DNA banks Pool obtaining enrichment with ethanol precipitation1；
2-4 takes turns SELEX：The Pool that first round SELEX is obtained is quantitative after redissolving, and puts into the sieve that 200pmol carries out next round Choosing, concrete screening process is identical with first round screening with condition, finally obtains single-stranded DNA banks Pool of enrichment4.
12. methods according to claim 6 are it is characterised in that step 4 is as follows：The enriched library of acquisition is delivered to Beijing Nuo Hezhiyuan bio information Science and Technology Ltd. carries out high-flux sequence, before high-flux sequence result display frequency of occurrences highest Article 100, single-stranded DNA sequence is highly enriched, from same family, and is rich in C base.
13. methods according to claim 12 are it is characterised in that the single-stranded DNA sequence in step 4 is 5' CTTTCTGTCCTTCCGTCACN1-4TCCCACGCATTCTCCACAT3' and/or the variant for its single base or double alkali yl.
14. methods according to claim 13 are it is characterised in that the single-stranded DNA sequence in step 4 is DBP-1：5' CTTTCTGTCCTTCCGTCACATCCCACGCATTCTCCACAT3' or DBP-2:5' CTTTCTGTCCTTCCGTCACAGGTCCCACGCATTCTCCACAT3'.
A kind of 15. electrochemica biological sensors based on the aptamer as described in any claim in claim 1-5.
16. electrochemica biological sensors as claimed in claim 15, its signal probe is DBP-1-10T-C-Fc or DBP- 1-C-Fc.
CN201610949635.5A 2016-10-26 2016-10-26 Method for screening and characterizing single-stranded DNA aptamer of phthalate plasticizer Active CN106399317B (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
CN201610949635.5A CN106399317B (en) 2016-10-26 2016-10-26 Method for screening and characterizing single-stranded DNA aptamer of phthalate plasticizer
CN201910033530.9A CN109609507B (en) 2016-10-26 2016-10-26 Single-stranded DNA aptamer of phthalate plasticizer, screening and characterization method of single-stranded DNA aptamer and electrochemical sensor

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201610949635.5A CN106399317B (en) 2016-10-26 2016-10-26 Method for screening and characterizing single-stranded DNA aptamer of phthalate plasticizer

Related Child Applications (1)

Application Number Title Priority Date Filing Date
CN201910033530.9A Division CN109609507B (en) 2016-10-26 2016-10-26 Single-stranded DNA aptamer of phthalate plasticizer, screening and characterization method of single-stranded DNA aptamer and electrochemical sensor

Publications (2)

Publication Number Publication Date
CN106399317A true CN106399317A (en) 2017-02-15
CN106399317B CN106399317B (en) 2020-04-24

Family

ID=58014153

Family Applications (2)

Application Number Title Priority Date Filing Date
CN201910033530.9A Active CN109609507B (en) 2016-10-26 2016-10-26 Single-stranded DNA aptamer of phthalate plasticizer, screening and characterization method of single-stranded DNA aptamer and electrochemical sensor
CN201610949635.5A Active CN106399317B (en) 2016-10-26 2016-10-26 Method for screening and characterizing single-stranded DNA aptamer of phthalate plasticizer

Family Applications Before (1)

Application Number Title Priority Date Filing Date
CN201910033530.9A Active CN109609507B (en) 2016-10-26 2016-10-26 Single-stranded DNA aptamer of phthalate plasticizer, screening and characterization method of single-stranded DNA aptamer and electrochemical sensor

Country Status (1)

Country Link
CN (2) CN109609507B (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110261340A (en) * 2019-05-24 2019-09-20 同济大学 A kind of quick visualization analyzes the method and sensor of a variety of phthalate total amount of pollutant
CN110257383A (en) * 2019-06-24 2019-09-20 湖北师范大学 The aptamer and its screening technique of specific recognition phthalic acid two (2- ethyl) own ester and application
CN107446929B (en) * 2017-08-31 2020-10-13 天津科技大学 Aptamer for specifically recognizing ochratoxin A and preparation method thereof
CN113249449A (en) * 2021-06-28 2021-08-13 中国农业大学 Method for determining Kd value based on real-time quantitative PCR of extension luminescent primer

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111135805B (en) * 2020-01-21 2023-03-21 福州大学 Aptamer functional extraction material for adsorbing phthalate, and preparation method and application thereof

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104655759A (en) * 2015-02-13 2015-05-27 王利兵 Method for detecting recovery rate of [2,2-bis(4-hydroxyphenol)propane] absorbed by using aptamer functional magnetic nanomaterial
CN104749233A (en) * 2015-03-31 2015-07-01 山东大学 Bisphenol A sensor of nano-porous gold modified based on aptamer and method

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103487483B (en) * 2013-09-12 2015-07-29 同济大学 Electrochemical analysis method BDD electrode being constructed 17 beta estradiol aptamer sensor is modified based on dendritic gold

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104655759A (en) * 2015-02-13 2015-05-27 王利兵 Method for detecting recovery rate of [2,2-bis(4-hydroxyphenol)propane] absorbed by using aptamer functional magnetic nanomaterial
CN104749233A (en) * 2015-03-31 2015-07-01 山东大学 Bisphenol A sensor of nano-porous gold modified based on aptamer and method

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
IMEN KAZANE ET AL.: "Highly Sensitive Bisphenol-A Electrochemical Aptasensor Based on Poly(Pyrrole-Nitrilotriacetic Acid)-Aptamer Film", 《ANAL. CHEM.》 *
PENG YU ET AL.: "A novel electrochemical aptasensor for bisphenol A assay basedon triple-signaling strategy", 《BIOSENSORS AND BIOELECTRONICS》 *
刘小文 等: "食品中邻苯二甲酸酯类增塑剂的检测方法进展", 《食品工业科技》 *
吴莉莉: "邻苯二甲酸酯类增塑剂的检测标准现状分析", 《塑料工业》 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107446929B (en) * 2017-08-31 2020-10-13 天津科技大学 Aptamer for specifically recognizing ochratoxin A and preparation method thereof
CN110261340A (en) * 2019-05-24 2019-09-20 同济大学 A kind of quick visualization analyzes the method and sensor of a variety of phthalate total amount of pollutant
CN110257383A (en) * 2019-06-24 2019-09-20 湖北师范大学 The aptamer and its screening technique of specific recognition phthalic acid two (2- ethyl) own ester and application
CN110257383B (en) * 2019-06-24 2023-05-26 湖北师范大学 Aptamer for specifically recognizing di (2-ethyl) hexyl phthalate as well as screening method and application thereof
CN113249449A (en) * 2021-06-28 2021-08-13 中国农业大学 Method for determining Kd value based on real-time quantitative PCR of extension luminescent primer

Also Published As

Publication number Publication date
CN109609507B (en) 2022-04-26
CN109609507A (en) 2019-04-12
CN106399317B (en) 2020-04-24

Similar Documents

Publication Publication Date Title
CN106399317A (en) DNA (deoxyribonucleic acid) aptamer of phthalate type plasticizer and screening and expression method and electro-chemical sensor thereof
CN107413313B (en) A kind of Magnetic solid phases extractant and its preparation method and application based on covalent organic framework material
CN105548109B (en) A kind of fluorescent detection system and detection method of heavy metal cadmium
CN108614102A (en) Multiple assay based on aptamer
CN107907620A (en) The method that ultrasonic extraction Solid Phase Extraction pre-treatment combination LC-MS technology detects six 24 kinds of antibiotic of class in feces of livestock and poultry at the same time
CN104761549B (en) A kind of palladium ion probe and preparation thereof and application
CN105087619B (en) A kind of ubiquitin-like modification protein substrate identification method
Zhou et al. Microchip electrophoresis array-based aptasensor for multiplex antibiotic detection using functionalized magnetic beads and polymerase chain reaction amplification
CN104745589B (en) A kind of screening technique of nucleic acid aptamer of specific recognition streptomysin and application
CN109342632A (en) The method that microwave abstracting-Solid Phase Extraction pre-treatment combination LC-MS technology detects 15 kinds of antibiotic in aquaculture bed mud simultaneously
CN110004148B (en) Alternariol aptamer affinity column and preparation method and application thereof
CN105126793B (en) A kind of preparation method based on single stranded DNA nucleic acid aptamers modification hybrid quartz capillary integral post
CN104745588B (en) A kind of nucleic acid aptamer of specific recognition streptomysin and its application in streptomysin detection
CN103937487A (en) Phosphorescent fluorinion probe, preparation and applications thereof
CN101130814A (en) Nucleic acid ligand group chip and manufacturing method thereof
CN103439319A (en) Method for measuring bleomycins by utilizing electrochemical luminescence of carbon nanoparticle modified electrode
CN103882531B (en) A kind of synthesis of lead compound and screening method and test kit
CN102784628B (en) Solid-phase micro extraction fiber extraction head and preparation method thereof
CN103901139A (en) Pretreatment method for analyzing tetrabromobisphenol A in biologic urine
CN104730240B (en) A kind of compound fluorescent nano probe and its preparation method and application
CN110511935A (en) A kind of aptamers truncation optimization method cut based on S1 digestion
CN108531592A (en) A kind of DNA encoding technology and cancer markers detection method associated with nano-pore technology
Vergara-Barberán et al. Selection and characterization of DNA aptamers for highly selective recognition of the major allergen of olive pollen Ole e 1
KR100930974B1 (en) DNA aptamer binding to Retinol Binding Protein 4 with specificity and production method thereof
KR101989679B1 (en) DNA aptamer specifically binding to nonylphenol ethoxylate and uses thereof

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant