CN106282232B - A method of tumour is treated based on adenovirus vector expression overall length Cetuximab - Google Patents
A method of tumour is treated based on adenovirus vector expression overall length Cetuximab Download PDFInfo
- Publication number
- CN106282232B CN106282232B CN201510308359.XA CN201510308359A CN106282232B CN 106282232 B CN106282232 B CN 106282232B CN 201510308359 A CN201510308359 A CN 201510308359A CN 106282232 B CN106282232 B CN 106282232B
- Authority
- CN
- China
- Prior art keywords
- carrier
- adenovirus
- monoclonal antibody
- former times
- expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
- C12N15/861—Adenoviral vectors
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Biotechnology (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Virology (AREA)
- Physics & Mathematics (AREA)
- Veterinary Medicine (AREA)
- Biophysics (AREA)
- Public Health (AREA)
- Plant Pathology (AREA)
- Animal Behavior & Ethology (AREA)
- Microbiology (AREA)
- Epidemiology (AREA)
- Pharmacology & Pharmacy (AREA)
- Biochemistry (AREA)
- Medicinal Chemistry (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention relates to a kind of methods based on adenovirus vector expression overall length Cetuximab treatment tumour.Adenovirus vector success is used for the first time, efficiently expresses western appropriate former times monoclonal antibody, and monoclonal antibody bioactivity obtained is good, can reach effective therapeutic effect for animal.
Description
Technical field
The invention belongs to biotechnologys and field of virology, more particularly it relates to which a kind of be based on adenovirus vector
The method for expressing overall length Cetuximab treatment tumour.
Background technique
Cetuximab (cetuximab) is first to be approved to list in the multiple countries in the whole world, is targeting in epidermis
People's mouse mosaic type lgG1 monoclonal antibody (Iressa:first angiogenesis of growth factor receptors (EGFR)
inhibitor approved for the treatment of advanced NSCLC.Expert Rev Anticancer
Ther, 2003.3 (3): p.257).Cetuximab can be specifically bound with EGFR, and competitiveness blocks epidermal growth factor and its
The combination of ligand, also, the compatibility in conjunction with EGFR is 10 times of native ligand EGF.It can inhibit the heterologous of EGFR in conjunction with after
It is Dimerized, and gene downstream is lowered, PI3K-AKT, the signal transduction paths such as RAS-RAF-MAPK are blocked, these approach exist
The proliferation of tumour cell, infiltration and inhibit to play a significant role in Apoptosis.Cetuximab can also make EGFR by endocytosis, from
And reduce the expression of EGFR.Furthermore, it is also possible to kill target cell by Antibody -dependent cell cytotoxicity (ADCC).
Cetuximab blocks tumor cell proliferation, transfer, invasion and angiogenesis by the above approach, reaches treatment tumour
Purpose.
The study found that many carcinoma of the colon and rectum, head-neck carcinoma, non-small cell lung cancer, cancer of pancreas, breast cancer, cervical carcinoma, kidney
All there is EGFR overexpression in the cancer cell of the patients such as cancer, this just implies that Cetuximab is likely to become the candidate of these cancers
Medicine.Currently, Cetuximab has been used as the medication combined relevant chemotherapeutic of first-line treatment, for metastatic carcinoma of the colon and rectum and
The treatment of head and neck squamous cell carcinoma.Meanwhile Cetuximab combines other Chemotherapeutic treatments non-small cell lung cancers, metastatic pancreas
Gland cancer, late gastric cancer etc. also enter III clinical trial phase.
Currently, the Cetuximab clinically used is the culture production in mammalian cell (murine myeloma cell)
's.The defects of the method is there are long preparation period, complex process, and hybridoma is unstable and resistance is easy to be lost, so that western appropriate
The preparation cost of former times monoclonal antibody is higher, is about 2.4 ten thousand RMB, a Nian Ze using the expense that Cetuximab treats a course for the treatment of
1,150,000 RMB are needed, expensive expense makes the patient for benefiting from Cetuximab be difficult to undertake.
Therefore, it there is an urgent need in the art to develop the method for preparing Cetuximab for reducing cost, with conspicuousness reduces
The treatment cost of clinical patient.
Summary of the invention
The purpose of the present invention is to provide a kind of sides based on adenovirus vector expression overall length Cetuximab treatment tumour
Method.
In the first aspect of the present invention, a kind of method for expressing the western appropriate former times monoclonal antibody of overall length, the method packet are provided
It includes: using the western appropriate former times monoclonal antibody of gland virus expression overall length.
In a preferred embodiment, in the method, the adenovirus, the adenovirus are formed by adenovirus vector
Element comprising the western appropriate former times monoclonal antibody of expression in carrier.
In another preferred example, in the method, the adenovirus vector of the adenovirus is formed with the black of E1 and E3 missing
Orangutan type AdC68 carrier or people's Hu5 carrier of E1 and E3 missing are as skeleton carrier.
In another preferred example, in the method, the element of the western appropriate former times monoclonal antibody of expression is successively (according to 5 '
→ 3 ' sequences) it include: promoter, signalase 11 coded sequence, western appropriate former times monoclonal antibody heavy coded sequence, catenation sequence, letter
Number 2 coded sequence of peptide, western appropriate former times monoclonal antibody light chain encoding sequences, terminator.
In another preferred example, in the method, the promoter includes: CASI promoter, CMV promoter；Preferably
Ground is CASI promoter；Or the terminator includes but is not limited to: SV40PloyA, BGH PloyA；Preferably BGH
PloyA。
In another preferred example, in the method, the signalase 11 or signal peptide 2 are secreting signal peptides；Preferably wrap
It includes: HLA-A*0201 signal peptide；Preferably, the signalase 11 and signal peptide 2 is identical or different.
In another preferred example, in the method, the catenation sequence includes: F2A, 2A, IRES；Preferably F2A.
In another preferred example, in the method, the western appropriate former times monoclonal antibody heavy coded sequence such as SEQ ID
In NO:1 shown in 1-1356 or the western appropriate former times monoclonal antibody light chain encoding sequences such as SEQ ID NO:1 1357-
Shown in 1998.
In another preferred example, in the method, the vaccine carrier for chimpanzee type that the adenovirus vector is lacked with E1 and E3 is formed
As skeleton carrier, the element of the western appropriate former times monoclonal antibody of expression is inserted into this for AdC68 carrier or people AdHu5 carrier
The region E1 being deleted in carrier.
In another preferred example, in the method, the method for the western appropriate former times monoclonal antibody of the expression overall length is non-examines
Disconnected or therapeutic method.
In another aspect of this invention, a kind of adenovirus expression carrier is provided, the chimpanzee which is lacked with E1 and E3
Type AdC68 carrier or people's AdHu5 carrier are as skeleton carrier；And successively (according to 5 ' → 3 ' sequence) include following table darcy appropriate former times
The element of monoclonal antibody: promoter, signalase 11 coded sequence, western appropriate former times monoclonal antibody heavy coded sequence connect sequence
Column, 2 coded sequence of signal peptide, western appropriate former times monoclonal antibody light chain encoding sequences, terminator.
In a preferred embodiment, in the adenovirus expression carrier, the element of the western appropriate former times monoclonal antibody of expression
It is inserted into the region E1 being deleted in the carrier.
In another preferred example, in the adenovirus expression carrier, the promoter includes: CASI promoter, CMV
Promoter；Preferably CASI promoter；Or the terminator includes but is not limited to: SV40PloyA.
In another preferred example, in the adenovirus expression carrier, the signalase 11 or signal peptide 2 are secretion letters
Number peptide；It is preferably comprised: HLA-A*0201 signal peptide；Preferably, the signalase 11 and signal peptide 2 is identical or different.
In another preferred example, in the adenovirus expression carrier, the catenation sequence includes: F2A, 2A, IRES；
Preferably F2A.
In another preferred example, in the adenovirus expression carrier, the western appropriate former times monoclonal antibody heavy coding
Sequence is as shown in 1-1356 in SEQ ID NO:1 or the western appropriate former times monoclonal antibody light chain encoding sequences such as SEQ
Shown in ID NO:1 1357-1998.
In another preferred example, in the adenovirus expression carrier, with the vaccine carrier for chimpanzee type AdC68 carrier of E1 and E3 missing
When as skeleton carrier, the nucleotide sequence of the gland virus expression Cetuximab is as shown in SEQ ID NO:3；Or with E1 and
When the people pHu5 carrier of E3 missing is as skeleton carrier, the nucleotide sequence of the gland virus expression Cetuximab such as SEQ ID
Shown in NO:4.
In another aspect of this invention, the purposes of the adenovirus expression carrier is provided, adenovirus is used to prepare, it is described
Adenovirus can express the western appropriate former times monoclonal antibody of overall length.
In another aspect of this invention, a kind of adenovirus is provided, the adenovirus is by the adenovirus expression carrier system
It is standby to form.
In a preferred embodiment, after the adenovirus expression carrier being linearized, it is transferred to virus production cell such as HEK
293 cells, to prepare adenovirus.
In another aspect of this invention, the purposes of the adenovirus is provided, anti-tumor drug is used to prepare.
In another aspect of this invention, a kind of anti-tumor drug is provided, the anti-tumor drug includes the adenovirus,
And pharmaceutically acceptable carrier.
In another aspect of this invention, provide it is a kind of for expressing the kit of the western appropriate former times monoclonal antibody of overall length, it is described
Kit in include: the adenovirus expression carrier or the adenovirus；Or the anti-tumor drug.
Other aspects of the invention are apparent to those skilled in the art due to this disclosure
's.
Detailed description of the invention
Fig. 1, overall length Cetuximab expression cassette schematic diagram.Monoclonal antibody gene is inserted into the deleted region E1 of adenovirus vector, by
The starting of CASI promoter is expressed, and is respectively provided with secreting signal peptide HLA-A*0201 before monoclonal antibody heavy chain lgG HC, light chain lgG LC,
Centre is connected by F2A, behind have SV40 PloyA.
Fig. 2, recombinant adenovirus plasmid digestion identification.A: recombinant adenovirus plasmid pAdC 68-CTB through Bgl II, Xho I,
I digestion of Mfe identification；B: recombinant adenovirus plasmid pHu 5-CTB identifies through Bgl II, Kpn I, III digestion of Hind.
Fig. 3, recombined adhenovirus genome digestion identification.A: recombined adhenovirus AdC 68-CTB genome is through Bgl II, Xho
I, I digestion of Mfe is identified；B: recombined adhenovirus Hu 5-CTB genome is identified through Bgl II, Kpn I, III digestion of Hind.
Fig. 4, Western Bolt detect recombined adhenovirus vivoexpression overall length Cetuximab.1010The hole vp/ recombinant adenovirus
Malicious AdC68-CTB, Hu5-CTB infect 293 cell of HEK, with 1010The hole vp/ AdC68-empty, Hu5-empty are negative control,
Collect cell conditioned medium afterwards for 24 hours.To be commercialized Cetuximab as positive control.A is the expression of overall length monoclonal antibody under non reducing conditions；
B is the expression respectively of heavy chain and light chain under reducing condition.
Fig. 5, ELISA detect the expression quantity of Cetuximab in vitro.With 1010vp、109The hole vp/ recombined adhenovirus AdC68-
CTB, Hu5-CTB infect 5 cell of MRC, with 108vp、107The hole vp/ recombined adhenovirus infects 293 cell of HEK, respectively 3 days, 5
It collects cell conditioned medium.With 1010vp、109vp、108vp、107Zero load adenovirus AdC68-empty, Hu5-empty in the hole vp/ is yin
Property control.
Cetuximab binding specificity expressed by Fig. 6, indirect immunofluorescene assay recombined adhenovirus.Choose EGFR+'s
HCEpi C, 508 NCI-H and EGFR-Chinese hamster ovary celI, to inject AdC68-CTB, Hu5-CTB mice serum as experimental group,
AdC68-empty, Hu5-empty mice serum are negative control group, and commercialization Erbitux is positive controls.
The affinity of Cetuximab expressed by Fig. 7, indirect ELISA detection recombined adhenovirus.With inject AdC68-CTB,
Hu5-CTB mice serum is experimental group, and commercialization Erbitux is positive control, and the compatibility of Cetuximab monoclonal antibody passes through detection
EC50Value is compared.
Fig. 8, MTT detect influence of the recombined adhenovirus to the proliferation of colon cancer cell.Colorectal cancer cell system DiFi and
NCI-H508 is through 107、108With 109After vp recombined adhenovirus handles 72h, MTT detects cell-proliferation activity.
Fig. 9, nude mouse tumor model assess recombined adhenovirus to the inhibiting effect of colon cancer.A is early treatment group；B is evening
Phase treatment group.
The immunohistochemistry detection of specific proteins Ki-67 is proliferated in Figure 10, NCI-H508 tumour.Ki-67 positive signal is in
Brown color is positioned at tumour cell karyon.A: the detection for the treatment of of late stage group Ki-67；B: the detection of early treatment group Ki-67.
Figure 11, pAdC68- △ E1E3 construct schematic diagram.
Specific embodiment
The present inventor is after extensive and in-depth study, it has unexpectedly been found that is lacked using adenovirus vector, particularly E1 and E3
The vaccine carrier for chimpanzee type AdC68 carrier or people's Hu5 carrier of mistake express western appropriate former times monoclonal antibody, can get high expression, and obtain
Monoclonal antibody bioactivity is good, and the adenovirus generated for recombinantly expressing western appropriate former times monoclonal antibody can be directly used for
Animal simultaneously reaches effective therapeutic effect.The present invention is completed on this basis.
In the prior art, the preparation of western appropriate former times monoclonal antibody was produced generally using the method for hybridoma expression
Journey complexity is difficult to control, and limits throughput, scale is limited, and antibody is also easy to lose activity or be contaminated, using eukaryotic expression system
At high cost and expression of uniting is difficult.Therefore, the present inventor studies a variety of expression systems, is suitble to expression western appropriate former times to find
The system of monoclonal antibody, is screened by numerous studies, it has unexpectedly been found that expresses west using the adenoviral expression systems of optimization
Appropriate former times monoclonal antibody, expression efficiency is high, and expression is stablized, low in cost, and the biology of the appropriate former times monoclonal antibody obtained is living
Property is very good, and the adenovirus generated for recombinantly expressing western appropriate former times monoclonal antibody can be directly used for animal and reach effective
Therapeutic effect.The present invention provides a kind of new method for clinically relevant oncotherapy.
Adenovirus vector
Since the genome comparison of adenovirus is big, about 36kb makes Direct Cloning recombinant adenoviral vector become technology
Bottleneck.Therefore, inventor developed the fast method direct constructions that can be connected by digestion to be based on vaccine carrier for chimpanzee type adenovirus
AdC68 is as expression vector.In addition, vaccine carrier for chimpanzee type adenovirus AdC6, AdC7 and adenovirus hominis AdHu26, AdHu36 etc. are also can
?.As preferred embodiment of the invention, with the E1 and E3 vaccine carrier for chimpanzee type AdC68 carrier lacked or the people Hu5 of E1 and E3 missing
Carrier is as skeleton carrier.
Monoclonal antibody there are heavy chain and light chain, how efficiently to realize expression and can retentive activity, the present inventor into
The design studies gone repeatedly are screened for a large amount of Expression element, the suitable Expression element of final optimization pass, including are opened
Mover, catenation sequence, signal peptide etc..Therefore it is used as preferred embodiment of the invention, it is described to express western appropriate former times monoclonal antibody
Element successively includes: promoter, signalase 11 coded sequence, western appropriate former times monoclonal antibody heavy coding (according to 5 ' → 3 ' sequences)
Sequence, catenation sequence, 2 coded sequence of signal peptide, western appropriate former times monoclonal antibody light chain encoding sequences, terminator.
As preferred embodiment of the invention, using from foot and mouth disease virus (food-and-mouth disease virus,
FMDV ribosomal skip sequence (ribosomal skipping sequence 2A)) realizes heavy chain of antibody and antibody light chain
Coexpression.The advantages that 2A connexon has self cleavage high-efficient, and two gene expression balances of upstream and downstream are good, and structure is short and small.?
After Furin protease cleavage site RAKR is added before 2A, the sequence for remaining in front end PROTEIN C end after 2A self cleavage can remove
Column, improve the shear efficiency of connexon, while avoiding influence of the 2A residual sequence to front end protein expression.RAKR is connect with 2A
The sequence abbreviation F2A that son is constituted.
As preferred embodiment of the invention, using CASI as promoter, be by CMV, chicken- β-actin,
Ubiquitin C composition, it is able to maintain that continuous expression of the foreign gene Cetuximab in muscle.By the present inventor
A large amount of screening, it is believed that CASI promoter is highly suitable for carrying out the expression of Cetuximab, can extremely efficient improve
The expression quantity of foreign gene Cetuximab, and maintain its continuous expression in muscle.
As preferred embodiment of the invention, using HLA-A*0201 as signal peptide, the inventors discovered that, it can guide
Newborn polypeptide is entered intracavitary by endoplasmic reticulum, is finally secreted into extracellular.Preferably using the HLA-A* optimized through GC
The secretion level of antibody can be improved in 0201 signal peptide.
The expression vector is usually also containing replication orgin and/or marker gene etc..Prompt according to the present invention, ability
Method known to the technical staff in domain can be used to construct the required expression vector of the present invention.These methods include extracorporeal recombinant DNA
Technology, DNA synthetic technology, In vivo recombination technology etc..The DNA sequence dna can be effectively connected to the appropriate starting in expression vector
On sub (such as CMV), to instruct mRNA to synthesize.Expression vector further includes the ribosome bind site and tanscription termination of translation initiation
Son.In addition, expression vector preferably includes one or more selected markers, to provide for selecting the host of conversion thin
The phenotypic character of born of the same parents.
In the present invention, the western appropriate former times monoclonal antibody is antibody known in the art, and heavy chain-coding sequence can be with
As shown in 1-1356 in SEQ ID NO:1；Light chain encoding sequences can be as shown in SEQ ID NO:1 1357-1998.
On the light chain or heavy chain of monoclonal antibody, formed by one or more replacing, missing or adding for amino acid residue but antigen
Binding ability monoclonal antibody identical or approximate with western appropriate former times monoclonal antibody is also included in the present invention.The present invention can also adopt
With the monoclonal antibody modified or improved, for example, can be used to promote its half-life period, validity, metabolism and/or albumen
Effect and the monoclonal antibody modified or improved and formed.That is, any biology for not influencing monoclonal antibody is living
The light chain and sequence of heavy chain version of property can be used in the present invention.
Above-mentioned each element of the invention is operability connection, to be conducive to the effective expression of monoclonal antibody.Such as this paper institute
With " operability is connected (or connection) " refers to functional space of two or more nucleic acid regions or nucleic acid sequence
Arrangement, the operability of these sequences, which is connected, can produce functional product, such as albumen or RNA molecule.
Adenovirus
After obtaining the adenovirus expression carrier, by transfected virus produce cell, carry out virus breeding.After transfection
After a period of time, virus can be harvested.The virus production cell, which can be, well known in the art various can breed adenopathy
The cell, such as 293 cells etc. of poison.
As preferred embodiment of the invention, the virus of harvest can repeated infection virus production cell, it is lasting to pass on.Virus drop
Spend (TCID50) measurement can be carried out according to conventional method in that art.Recombined adhenovirus obtained is also included in the present invention.
Pharmaceutical composition
The present invention also provides a kind of pharmaceutical compositions, it contains effective quantity (such as 0.000001-50wt%；Preferably
0.00001-20wt%；More preferably, 0.0001-10wt%) the adenovirus and pharmaceutically acceptable carrier.
As used herein, term " containing " indicates that various composition can be applied to mixture or composition of the invention together
In.Therefore, term " mainly by ... form " and " consist of " were included in term " containing ".
As used herein, term " effective quantity " or " effective dose ", which refer to, to generate function or activity to people and/or animal
And can be received by people and/or animal as used herein.
As used herein, the ingredient of " pharmaceutically acceptable " is suitable for people and/or mammal and without excessively bad
Side reaction (such as toxicity, stimulation and allergy), i.e., with the substance of reasonable benefit/risk ratio.Term " can pharmaceutically connect
The carrier received " refers to the carrier for Therapeutic Administration, including various excipient and diluent.
In general, the adenovirus can be formulated in nontoxic, inert and pharmaceutically acceptable aqueous carrier medium,
Wherein pH is usually about 5-8, preferably, pH is about 6-8.
Pharmaceutical composition of the invention can be made into injection form, such as with physiological saline or contain glucose and other
The aqueous solution of adjuvant is prepared by conventional method.The dosage of active constituent (adenovirus) is therapeutically effective amount, such as often
Its about 10 mg/kg weight of about 0.1 microgram/kg body weight-.Certainly, specific dosage is also contemplated that administration route, patient health
The factors such as situation, within the scope of these are all skilled practitioners technical ability.
For inhibit mammal tumor when, the adenovirus can systemic administration or local application, specifically may be used
The factors such as type, growth site, progress extent depending on tumour determine.
Kit or medicine box
Based on new discovery of the invention, the present invention also provides a kind of for expressing the examination of the western appropriate former times monoclonal antibody of overall length
Agent box/medicine box includes the adenovirus expression carrier or the adenovirus in the kit/medicine box.The examination
Agent box/medicine box may also include virus production cell (such as 293 cells), culture medium etc..In addition, in the kit/medicine box also
It may include the operation instructions of adenovirus application method after illustrating expression.
The present inventor has detected the biological activity of the Cetuximab obtained using system expression of the invention, and thin
Detect that it, with good antitumous effect, provides a kind of new plan for the Antybody therapy of tumour in born of the same parents' level and animal model
Slightly.
The recombined adhenovirus energy high-efficiency transfection mammalian cell of recombinant adenoviral vector generation of the invention is easy to expand
And purifying, toxicity are low, expression efficiency is high and permanent.Adenovirus vector expression recombination Cetuximab production technology of the invention
Simply, cheap, curative effect is lasting, better than the expression of other methods currently on the market.
Present invention will be further explained below with reference to specific examples.It should be understood that these embodiments are merely to illustrate the present invention
Rather than it limits the scope of the invention.In the following examples, the experimental methods for specific conditions are not specified, usually according to conventional strip
Part such as J. Pehanorm Brooker etc. is write, Molecular Cloning:A Laboratory guide, the third edition, Science Press, condition described in 2002, or
According to the normal condition proposed by manufacturer.
I. materials and methods
1, main agents, bacterial strain and experimental animal
All toolenzymes are purchased from New England Biolabs；LipofectatimeTM 2000, acillin
Etc. being purchased from Invitrogen；Primer is synthesized in Jin Sirui Biotechnology Co., Ltd；Small amount plasmid extraction purification kit,
DNA purification kit, DNA gel recycling and purification kit are purchased from Tiangeng biochemical technology Co., Ltd；DMEM culture medium, tire
Cow's serum, 0.25% pancreatin, secondary antibody are purchased from Hyclone.Goat-anti people lgG-Kappa is purchased from SouthernBiotech, rabbit-anti people
LgG Fc (HRP), lgG H&L (HRP) be purchased from Abcom, goat-anti people lgG-FITC be purchased from Santa Cruz, anti-rabbit lgG (HRP),
Anti- sheep lgG (HRP) is purchased from Sigma.
Coli strain Stbl 2 is purchased from Invitrogen；293 cell of adenovirus packaging cell system HEK, people's Colon and rectum
Cancer cell DiFi and NCI-H508 (EGFR+) it is purchased from ATCC；CHO Chinese hamster ovary cell (EGFR-), human embryonic lung cell MRC
5 and people colon epithelial cell HCEpi C is purchased from Cell Bank of Chinese Academy of Sciences.Experiment mice 6-8 week old Balb/C female is naked
Mouse is purchased from Shanghai Ling Chang Bioisystech Co., Ltd.
2, the building for the pHu5 that plasmid pAdC68- △ E1E3 and E1 and E3 is deleted
(i) building of plasmid pNEB193-KE
According to the multiple cloning sites and adenovirus AdC68 genome on pNEB193 carrier (New England Biolabs)
Sequence, design amplification KE segment primer (table 1), PCR amplification purpose product KE segment.EcoR I and Kpn I double digestion PCR
The KE segment of amplification, agarose gel purification KE segment are connected to the pNEB193 carrier through identical digestion, are transformed into DH5 α sense
By in state cell, picking positive colony obtains pNEB193-KE through digestion and sequencing identification.
Table 1, PCR primer sequence
(ii) building of plasmid pNEB193-KE-AK
Asc I and Kpn I double digestion AdC68 genome (GenBank accession number AC_000011), low melting-point agarose are solidifying
Gel electrophoresis recycles AK segment, is connected to the pNEB193-KE carrier through identical digestion, is transformed into Stbl2 competent cell, chooses
Positive colony is taken, identifies to obtain pNEB193-KE-AK through digestion.
(iii) building of plasmid pNEB193-KE-AK-XA
Xba I and Asc I double digestion AdC68 genome, due to Asc I in adenovirus AdC68 there are three restriction enzyme sites,
It is partially digested to Asc I progress, 37 DEG C of digestion AdC68 genome 10s are placed in, low melting point gel recycles the maximum XA piece of digestion
Section, is connected to the pNEB193-KE-AK carrier through identical digestion, digestion is identified to obtain pNEB193-KE-AK-XA.
(iv) building of plasmid pNEB193-PX
According to the sequence of multiple cloning sites and adenoviral gene group on pNEB193 carrier, design amplification PX segment is drawn
Object (table 1), PCR amplification purpose product PX segment.The PX segment of Pme I and Xba I double digestion PCR amplification recycling, agarose are solidifying
Glue recycles purpose product PX segment, is connected to the pNEB193 carrier through identical digestion, is transformed into Stbl2 competent cell, chooses
Positive colony is taken, wherein identifying close to the region of adenovirus AdC68 left end ITR through sequencing.Xba I digestion adenovirus AdC68 base
Because of group, the recycling of low melting-point agarose gel obtains the part Xba I-Xba I in AdC68, and replaces and be connected to through Xba I digestion
PNEB193-PX carrier in, be transformed into Stbl2 competent cell, picking positive colony, digestion is identified to obtain pNEB193-
PX。
(v) part E1 in AdC68 genome is deleted in pNEB193-PX plasmid
EcoR I and Mfe I double digestion pShuttle-CMV plasmid (Clontech Laboratories, Inc), according to same
The property of tail enzyme connects empty carrier, is transformed into DH5a competent cell and obtains the plasmid of pShuttle-EM.According to
The primer (table 1) of the sequence design amplification Linker of pShuttle-EM plasmid, PCR amplification Linker product.SnaB I and Nde
The Linker segment of I double digestion PCR amplification, Ago-Gel recycle Linker product, are connected to through identical digestion
PNEB193-PX carrier (by AdC68 genomic sequence analysis, it can be by it using two restriction enzyme sites of SnaB I and Nde I
E1 partial sequence is deleted), it is transformed into DH5 α competent cell, picking positive colony is identified to obtain pNEB193-PX- through digestion
Linker。
The sequence of Linker is inserted between AdC68 genome 459-3011, replaces most sequence of E1.
The sequence of Linker is following (SEQ ID NO:11):
cgcgcgttgg ccgattcatt aatgcagacc cataataccc ataatgccat ttcattacct 60
ctttctccgc acccgacata gatgaattgt cggtcaagcc ttgccttgtt gtagcttaaa 120
ttttgctcgc gcactactca gcgacctcca acacacaagc agggagcaga tactggctta 180
actatgcggc atcagagcag attgtactga gagtgcacca taggggatcg ggagatctga 240
gctttcgcta ccttaggacc gttatagtta cgtcaggtgg cacttttcgg ggaaatgtgc 300
gcggaac 307
(vi) pAdC68- △ E1 plasmid construction
Xba I and Pme I double digestion pNEB193-PX-Linker Plasmid DNA, and PX- is recycled using Ago-Gel
Linker segment is connected to the pNEB193-KE-AK-XA carrier of the low melting-point agarose gel recycling through identical digestion, conversion
Enter in Stbl2 competent cell, picking positive colony, identifies to obtain pAdC68-E1-deleted (pAdC68- △ through digestion
E1)。
(vii) pAdC68- △ E1E3 is constructed
Using plasmid pAdC68- △ E1 as template, according to upstream primer F:tctcctagggaggaacaacaagca (SEQ ID
NO:12) and downstream primer R:tggcctaggatttaaataGTCGTTGTCGCAGTGGTTG (SEQ ID NO:13), PCR is obtained
Segment AA, meanwhile, identical cohesive end is generated with Avr II digested plasmid pAdC68- △ E1 and segment AA, is connected with low melting point
The method connect obtains recombinant adenovirus plasmid pAdC68- △ E1E3, schematic diagram such as Figure 11.
The area E3 is 24679-28414 bit sequence by the part that domain is deleted.
(viii) pHu5 (the pHu5- △ E1/E3) building that E1 and E3 is deleted
The construction method for the pHu5 that E1 and E3 is deleted is identical as pAdC68.
3, the building of shuttle vector of adenovirus
(weight, sequence of light chain are referring to GenBank accession number GM685459.1 and GM685461.1 by overall length Cetuximab.Weight,
Light chain front end respectively carries a HLA-A*0201 signal peptide, and (its sequence is atggccgtgatggcgccgcggaccctggtcctcct
Gctgagcggcgccctcgccctgacgcagacctgggccggg (SEQ ID NO:14)), and connected by F2A, code sequence
It arranges it to be inserted into PU57 plasmid, becomes PUC57-CTB plasmid, full length sequence such as SEQ ID NO:2.
By synthetic vectors PUC57-CTB plasmid through I double digestion of Avr II and Cla, while PUC-Promoter (being started
Sub- CASI sequence is shown in that GenBank accession number JB974538.1, SV40ployA sequence is shown in JB974550.1, is inserted into PU57 matter
In grain, become PUC-Promoter) carrier with identical cohesive end, linearisation is obtained through Avr II and I double digestion of Cla,
It is attached using cohesive end of the T4DNA ligase to above-mentioned two product.Connection product is converted according to a conventional method, anti-containing that is blocked
Property agar plate on screen, be incubated overnight for 37 DEG C in the LB culture medium of that resistance containing card, extract plasmid.Using PCR, digestion
The methods of identified, obtain positive recombinant plasmid, be named as pShuttle-CTB.
4, the preparation of recombinant adenovirus plasmid
By pShuttle-CTB plasmid through PI-Sce I and I-Ceu I double digestion, while by adenovirus vector pAdC68- △
E1/E3 obtains the carrier with identical cohesive end, linearisation through PI-Sce I and I-Ceu I double digestion.It is solidifying using agarose
Glue is separated and recovered from target fragment, meanwhile, adenovirus vector is separated using low melting-point agarose gel, by gland-containing virus carrier
65 DEG C of gel are incubated for 5 minutes, carry out cohesive end connection to above-mentioned two product with T4DNA ligase until completely dissolved.In competence
Connection product is converted according to a conventional method in bacterium Stbl 2, converted product is then applied to the agarose plate of the resistance of benzyl containing ammonia
On, for 24 hours in 30 DEG C of cultures, selected clone is incubated overnight for 30 DEG C in the LB culture medium of the resistance of benzyl containing ammonia, plasmid is extracted, with 1%
Ago-Gel carries out electrophoretic mobility analysis, and carries out Bgl II, Xho I, Mfe I Cleavage Map.By resulting sun
Property recombinant adenovirus plasmid bacterium solution expand the Plasmid DNA that culture (1:1000) obtains a large amount of high quality, be named as pAdC68-CTB,
Its full length sequence such as SEQ ID NO:3.
Clone's recombined adhenovirus pHu5-CTB method is same as above, i.e., by pShuttle-CTB plasmid through PI-Sce I and I-Ceu
I double digestion, while adenovirus vector pHu5- △ E1/E3 being obtained through PI-Sce I and I-Ceu I double digestion, connection, and carried out
Bgl II, Hind III, I Cleavage Map of Kpn.The full length sequence of pHu5-CTB such as SEQ ID NO:4.
5, the preparation of recombined adhenovirus
Recombinant adenovirus plasmid pAdC68-CTB is linearized with restriction enzyme Pac I, by LipofectatimeTM
Method on 2000 specifications is by 293 cell of plasmid transfection HEK, 37 DEG C, 5%CO2, there is obvious plaque in culture 8-12 days.To
Cell is collected after cell rounding, suspension, multigelation takes viral supernatants to infect 293 cell (25cm of HEK afterwards three times2Cell culture
Bottle).Then above step is repeated, 1:3 amplification virus (one 75cm of infection after poison is received2Tissue Culture Flask), it is pressed after receiving poison later
1:6 amplification virus (three 150cm of infection2Tissue Culture Flask), about 1:9 amplification (about 25-30, virus are pressed after finally receiving poison
150cm2Tissue Culture Flask), it is viral [16] using cesium chloride density gradient centrifugation purifying recombined glandulae, OD value is surveyed, is added dense eventually
Degree is stored in -80 DEG C for 10% glycerol.Recombined adhenovirus Hu5-CTB preparation method is same as above.
Viral genome AdC68-CTB is extracted, and carries out Bgl II, Xho I, Mfe I Cleavage Map.Extract virus
Genome Hu5-CTB, and carry out Bgl II, Hind III, I Cleavage Map of Kpn.
6, Western blot detects recombined adhenovirus and expresses Cetuximab monoclonal antibody
Recombined adhenovirus AdC68-CTB, Hu5-CTB are diluted to concentration 1011Then vp/ml uses 100ul recombined adhenovirus
Six orifice plate HEK, 293 cell is infected, i.e., every hole 1010Vp adenovirus, with every hole 1010Vp AdC68-empty (empty control plasmid),
Hu5-empty (empty control plasmid) is negative control, harvests cell conditioned medium afterwards for 24 hours, passes through the side blot non-reduced Western
Method detects the expression of Cetuximab destination protein overall length, detects Cetuximab weight by reduced form Western blot method
The expression of chain, light chain.Wherein, detection antibody is that HRP marks mouse anti-human igg 1 (H+L) secondary antibody.
7, Cetuximab Expression in Vivo and in Vitro amount is detected
MRC 5,293 cell of HEK in logarithmic growth phase are laid in 6 orifice plates, 37 DEG C, 5%CO2Cultivate for 24 hours, to
Cell density it is long to 80% when, respectively with 1010vp、109The hole vp/ recombined adhenovirus AdC68-CTB, Hu5-CTB infect MRC 5,
With 108vp、107The hole vp/ recombined adhenovirus infects HEK293 cell, collects cell conditioned medium 3 days, 5 days respectively.With 1010vp、
109vp、108vp、107Zero load adenovirus AdC68-empty, Hu5-empty in the hole vp/ is negative control.
Using the Balb/c nude mice of 5-6 week old, mouse is randomly divided into 4 groups: AdC68-CTB, Hu5-CTB, AdC68-
Empty and Hu5-empty, every group of 6 mouse.Every group with 5 × 1010Vp/100ul recombined adhenovirus single intramuscular injection, periodically
Blood sampling detection internal antibody expression.
The expression quantity of indirect ELISA detection albumen: using the hole 50ng goat-anti people lgG Kappa 50ul/, and 4 DEG C are wrapped overnight
Cell conditioned medium is diluted 10 times by elisa plate, 5% skim milk of the hole 50ul/, 37 DEG C of closing 2h, and serum dilutes 400 times, with 50ul/
Hole, 4 DEG C of incubation 2h.The anti-human lgG Fc secondary antibody 1:10000 of mouse of HRP label dilutes the hole 50ul/, 37 DEG C of incubation 1h.Wherein, with quotient
For the Cetuximab of industry using every hole 10ng as initial amount, 2 times of gradient dilutions draw standard curve.
8, Cetuximab binding specificity expressed by recombined adhenovirus is detected
HCEpi C、NCI-H 508(EGFR+) and CHO (EGFR-) cell is laid in 24 orifice plates, 37 DEG C, 5%CO2It cultivates
After for 24 hours, after cell is cleaned 3 times with PBS, 5 minutes are fixed with 4% paraformaldehyde.Cell is first closed through 37 DEG C of 5% skimmed milk power
Then then 2h uses FITC with the mice serum and commercialization 4 DEG C of incubation 2h of Cetuximab being immunized through recombined adhenovirus respectively
37 DEG C of incubation 1h of goat-anti people lgG secondary antibody of label, after TBST is washed three times, DAPI dyes 5min, finally sees under fluorescence microscope
It examines.
9, the affinity of Cetuximab expressed by recombined adhenovirus is detected
It is stayed overnight for 4 DEG C of packet elisa plate with the hole 60ng EGFR 50ul/, after 5% skim milk closes 2h, by recombined adhenovirus
Monoclonal antibody and commercialization Cetuximab are expressed using every hole 80ng as initial amount, 2 times of gradient dilutions, 11 gradients, i.e., every hole is diluted to
The hole 0.078125ng, 50ul/, 4 DEG C of incubation 2h.The anti-human secondary antibody 1:10000 dilution of the mouse that HRP is marked, the hole 50ul/, 37 DEG C incubate
After educating 1h, 50 μ l of TMB developing solution is added in every hole, is protected from light colour developing 5min, is paid attention to color change, and colour developing is avoided excessively to be added in time
50 μ l terminate liquids.Microplate reader detects OD450 numerical value.
10, influence of the detection recombined adhenovirus to the proliferation of colon cancer cell
With the proliferative capacity of MTT (3- (4,5- dimethylthiazole -2) -2,5- diphenyltetrazolium bromide bromide) detection cell: receiving
DiFi the and NCI-H508 cell for collecting logarithmic growth phase, by 1 × 104/ hole is laid in 96 orifice plates, and every group of 6 multiple holes are felt afterwards for 24 hours
Dye 109、108、107Recombined adhenovirus AdC68-CTB, the Hu5-CTB in the hole vp/, with AdC68-empty, Hu5- of same dose
Empty does negative control, 37 DEG C, 5%CO2The MTT of 20ul, hole are added after cultivation 72h, abandons supernatant, every hole after routine culture 4h
150ul DMSO is added, shakes 10min, microplate reader detects OD490 numerical value, and using the time as abscissa, OD490 value is ordinate,
Draw cell Proliferation histogram.
11, inhibiting effect of the nude mouse tumor model assessment recombined adhenovirus to colon cancer
DiFi, NCI-H508 cell of logarithmic growth phase, are resuspended with Martixgel, and 1 × 10 is pressed after counting7A cell/
100ul is injected in subcutaneous on the right side of nude mice hind leg, constant temperature, ventilation, kept under sterile conditions.When transplantable tumor grows to a certain size
(the early treatment group size of NCI-H508 cell tumor model reaches 150cm3, treatment of late stage group reaches 600cm3；DiFi cell
The early treatment group size of tumor model reaches 80cm3, treatment of late stage group reaches 300cm3), mouse is randomly divided into 5 groups:
AdC68-CTB, Hu5-CTB, Erbitux (commercially produced product is purchased from Merck), AdC68-empty, Hu5-empty, wherein yin
Property every group of 6 mouse of control group, remaining every group of 10 mouse.Every group with 5 × 1010Vp/100ul recombined adhenovirus single intramuscular note
It penetrates, Erbitux group is biweekly injected intraperitoneally with the Erbitux of every 20mg/kg.After starting treatment, measurement in every 3 days is primary swollen
Tumor size and weight, with " maximum diameter × most path2× 0.5 " formula calculates gross tumor volume.
Observation was to 21 days, and be euthanized mouse, takes knurl sample, is fixed with 4% paraformaldehyde, paraffin embedding, immunohistochemistry
Detect the expression of Ki-67, p-EGFR.
II. embodiment
The building and identification of embodiment 1, recombinant adenovirus plasmid
Cetuximab is that a people mouse is fitted into anti-egfr antibodies, for treating colorectal cancer, head and neck squamous cell carcinoma etc.
The monoclonal antibody of cancer.The present invention constructs AdC68- △ E1/E3, Hu5- △ E1/E3 and expresses overall length Cetuximab gene, with
For colorectal cancer animal model, the effect of examination recombined adhenovirus expression Cetuximab monoclonal antibody treatment tumour.
It is connected between the weight of signal peptide (HLA-A*0201 signal peptide), light chain with F2A as shown in Figure 1, carrying, overall length monoclonal antibody warp
After I double digestion of Avr II and Cla, it is connected on the shuttle vector pUC57 for carrying CASI promoter and SV40polyA, building obtains
Obtain shuttle plasmid pUC57-CASI-CTB.PUC57-CASI-CTB, pAdC68- △ E1/E3 or pHu5- △ E1/E3 are through PI-Sce
After I and I-Ceu I double digestion and connection, pAdC68-CTB or pHu5-CTB is obtained.
Obtained recombinant adenovirus plasmid pAdC68-CTB Bgl II, Xho I, Mfe I digestion identification and analysis, pHu5-
CTB Bgl II, Hind III, I digestion identification and analysis of Kpn, are shown in Fig. 2, identical as restriction enzyme mapping clip size analysis, it was demonstrated that weight
Group adenoviral plasmid building is correct.
The acquisition and identification of embodiment 2, recombined adhenovirus
Recombinant adenovirus plasmid pAdC68-CTB, pHu5-CTB use LipofectatimeTM after Pac I linearisation
2000 are transferred in 293 cell of HEK, 8-12 days to be cultivated, plaque occur, cell is collected after cell rounding, suspension, is frozen repeatedly
Melt and viral supernatants is taken to infect 293 cell (25cm of HEK afterwards three times2Tissue Culture Flask).It is appropriate viral to collecting to repeat above step
(about 27-30 150cm2Tissue Culture Flask), utilize cesium chloride density gradient centrifugation purification of adenoviral AdC68-CTB, recombination
Adenovirus Hu5-CTB preparation method is same as above.Finally, the present inventor obtain recombined adhenovirus AdC68-CTB concentration be 8.5 ×
1012Vp/ml, Hu5-CTB concentration are 4.2 × 1012vp/ml。
Adenoviral gene group AdC68-CTB is extracted, and carries out Bgl II, Xho I, Mfe I Cleavage Map, sees figure
3A.Viral genome Hu5-CTB is extracted, and carries out Bgl II, Hind III, I Cleavage Map of Kpn, Fig. 3 B is seen, with map
It is correct to compare display endonuclease bamhi.
Embodiment 3, Western blot detection recombined adhenovirus express Cetuximab monoclonal antibody
1010The hole vp/ recombined adhenovirus AdC68-CTB, Hu5-CTB infect 293 cell of HEK, with 1010The hole vp/ AdC68-
Empty, Hu5-empty are negative control, collect cell conditioned medium afterwards for 24 hours.It is detected by non-reduced Western blot method
The expression of Cetuximab destination protein overall length is shown in Fig. 4 A, it can be seen that AdC68- using commercialized Erbitux as positive control
CTB, Hu5-CTB and Erbitux have a specific band, the i.e. destination protein of 152kd between 170kb and 130kd, and negative
Property control group then without.
The expression of Cetuximab heavy chain, light chain is detected, by reduced form Western blot method with commercialized
Erbitux is positive control, sees Fig. 4 B, it can be seen that respectively has a specific band, i.e. purpose egg near 55kd and near 25kd
White heavy chain and light chain, it was demonstrated that correct destination protein has successfully been obtained in the present inventor.
Embodiment 4, the expression of ELISA detection Cetuximab in vivo and in vitro
With 1010vp、109The hole vp/ recombined adhenovirus AdC68-CTB, Hu5-CTB infect MRC 5, with 108vp、107The hole vp/
Recombined adhenovirus infects 293 cell of HEK, collects cell conditioned medium 3 days, 5 days respectively.With 1010vp、109vp、108vp、107vp/
Zero load adenovirus AdC68-empty, Hu5-empty in hole is negative control.
The expression quantity of monoclonal antibody in each cell line is detected by indirect ELISA, draws standard curve to be commercialized Erbitux.
Vivoexpression is shown in Fig. 5.Such as the upper figure of Fig. 5, in non-replicating cells system MRC 5, at the 3rd day, low dosage AdC68-CTB expression quantity
Reach 368.8ng/ml, high dose 598.9ng/ml；Low dosage Hu5-CTB is hardly expressed, high dose 648.1ng/ml；
At the 5th day, AdC68-CTB high dose group and low dose group expression quantity were almost suitable, respectively 792.9ng/ml, 784.5ng/
Ml, Hu5-CTB high dose and low dose group are respectively 382.4ng/ml, 760.1ng/ml.
Such as Fig. 5 following figure, in science cell line HEK 293, at the 3rd day, low dosage AdC68-CTB expression quantity reaches
945.3ng/ml, high dose 1803.9ng/ml；Low dosage Hu5-CTB is 121.58, high dose 1925.2ng/ml；?
At 5 days, AdC68-CTB high dose group and low dose group expression quantity are almost suitable, respectively 2448.5ng/ml, 2378.3ng/
Ml, Hu5-CTB high dose and low dose group are respectively 2334.1ng/ml, 2715.4ng/ml.
Cetuximab binding specificity expressed by embodiment 5, indirect immunofluorescene assay recombined adhenovirus
The Cetuximab of AdC68-CTB, Hu5-CTB expression is the monoclonal antibody of anti-EGFR a kind of, being capable of specific recognition cell
The EGFR of surface expression.
As shown in fig. 6, in EGFR+HCEpi C, 508 NCI-H cell surface can see very strong FITC fluorescence letter
Number, this illustrates that the antibody of expression can be in conjunction with the EGFR of cell surface.EGFR-Chinese hamster ovary celI surface fluorescence is not observed
Signal, this illustrates the expression due to lacking EGFR, and Cetuximab cannot be in conjunction with Chinese hamster ovary celI.And commercialized Erbitux exists
EGFR+Cell surface FITC fluorescence signal intensity having the same, this explanation, recombined adhenovirus expression monoclonal antibody and commercialization
Monoclonal antibody activity having the same.
The affinity of Cetuximab expressed by embodiment 6, indirect ELISA detection recombined adhenovirus
Recombined adhenovirus is calculated by Binding ELISA and is commercialized the EC of Erbitux50Value, so that it is affine to compare its
Power.
As shown in fig. 7, the monoclonal antibody EC50 value of AdC68-CTB, Hu5-CTB expression is respectively 0.250 and 0.272, and business
Change the EC of Erbitux50Value is 0.264, and there is no significant differences, shows the monoclonal antibody and commercialization monoclonal antibody of recombined adhenovirus expression
Combination EGFR compatibility it is not variant.
The influence of embodiment 7, MTT detection recombined adhenovirus to the proliferation of colon cancer cell
It can inhibit the growth of colorectal cancer cell to assess recombined adhenovirus AdC68-CTB, Hu5-CTB, the present invention
People has evaluated its influence to colorectal cancer cell proliferation by MTT experiment.
The results show that 109、108、107AdC68-CTB, Hu5-CTB can conspicuousness inhibit DiFi, NCI-H 508 thin
The proliferation of born of the same parents, is shown in Fig. 8, it was demonstrated that recombined adhenovirus, which expresses monoclonal antibody, has significant inhibit to the proliferation of colorectal cancer cell in vitro
Effect.
Embodiment 8, nude mouse tumor model assess recombined adhenovirus to the inhibiting effect of colon cancer
Recombined adhenovirus is verified in inhibiting effect of the cellular level to tumor cell proliferation, and the present inventor passes through nude mice
Tumor model carries out the early and late treatment of tumour, further inquires into recombined adhenovirus and makees in vivo to the inhibition of colorectal cancer
With.In early treatment group, AdC68-CTB, Hu5-CTB and Erbitux in DiFi tumor model and NCI-H508 tumor model
Group can conspicuousness inhibit tumour growth, see Fig. 9 A.
Wherein, in DiFi tumor model, it is complete that AdC68-CTB group has 6 tumours 15 days after treating, in 10 mouse
It totally disappeared mistake；Hu5-CTB group has 5 cases of complete remission after treatment in 9 days in 10 mouse.In NCI-H508 tumor model
In treatment of late stage group, treatment 21 days after, AdC68-CTB, Hu5-CTB and Erbitux group can conspicuousness inhibit tumour growth,
See Fig. 9 B.Meanwhile mouse weight has no conspicuousness decline, mouse sign is normal, illustrates adenovirus and Cetuximab monoclonal antibody not
Adverse effect can be generated to mouse.Comparison early treatment group and treatment of late stage group, the effect of early treatment group are substantially better than advanced stage
Treatment group, so early treatment is easy to get preferable curative effect.
Tumor tissues are taken to do immunohistochemistry, detection is proliferated the expression of specific proteins Ki-67, as shown in Figure 10, treatment group
Compared with the control group, Ki-67 protein expression has significant decrease by AdC68-CTB, Hu5-CTB and Erbitux.
It discusses
Cetuximab is approved to list as first in the multiple countries in the whole world, is widely used in colorectal cancer, incidence squama
The monoclonal antibody of the cancers such as shape cell cancer has been proved to have good curative effect.The present inventor further successfully demonstrates with recombination gland
After expressing viral overall length Cetuximab is administered by single intramuscular injection, there is good suppression in the colorectal cancer model of nude mice
Cancer effect.
It is generally acknowledged that when the method by genetic engineering expresses large biological molecule, it is difficult to ensure that its bioactivity, thus produce
A raw problem: whether the present inventor is effective for gene therapy using adenovirus vector expression monoclonal antibody.The present inventor
Result of study show that the gene therapy method of gland virus expression antibody is feasible.Firstly, passing through indirect immunofluorescence experiment
Inventors demonstrated that the monoclonal antibody of gland virus expression is similar to commercialization monoclonal antibody, all there is the parent of specificity with the EGFR of cell surface
And effect；Then, the present inventor further passes through the monoclonal antibody and commercialization monoclonal antibody tool of Binding ELISA discovery gland virus expression
There is similar EC50Value, it was demonstrated that it is with commercialization monoclonal antibody to EGFR affinity having the same.Meanwhile it is thin to colorectal cancer in vitro
The Inhibition test and the overall length monoclonal antibody of inside and outside gland virus expression is all shown all to the Inhibition test of nude mouse tumor in vivo that born of the same parents are proliferated
With bioactivity.It is above various experiments have shown that recombinant adenoviral vector expresses Cetuximab monoclonal antibody to there is height to express efficiency, table
The monoclonal antibody reached has the bioactivity of height, and in animal model for tumour, recombined adhenovirus can obviously inhibit tumour growth, even
Reach curative effect.
At present clinically, the dosage of Cetuximab monoclonal antibody is to be transfused once in a week, and initial dose is 400mg
Every square metre of body surface area, dosage weekly is every square metre of body surface area of 250mg later, and dosage is big and frequent [17].
Meanwhile the preparation of monoclonal antibody, purification process are cumbersome, it is desirable that it is stringent, lead to the expensive of monoclonal antibody, makes to benefit from the monoclonal antibody
Patient receive treatment when be extremely restricted.Due to adenovirus preparation, purifying is simple, yield is high, safety is good, external source table
Up to the time it is long the features such as, therefore the present inventor research and development gland virus expression Cetuximab monoclonal antibody it is at low cost, good effect can be abundant
Meet clinical disease Man's Demands.In addition, the Cetuximab monoclonal antibody that the present inventor is cloned in adenovirus vector is that one kind can be secreted
Albumen, therefore, recombined adhenovirus other than it can be directly used in injection treatment by the present inventor, moreover it is possible to infect recombined adhenovirus
The monoclonal antibody of the Cetuximab of high concentration is harvested after suitable cell, and oncotherapy is then applied to the monoclonal antibody of purifying or other is faced
Bed and scientific research.To sum up, the recombinant adenoviral vector expression Cetuximab monoclonal antibody of the present inventor's research and development is controlling for clinically relevant tumour
It treats and provides a kind of effective new tool with research, and there is huge market development prospect.
All references mentioned in the present invention is incorporated herein by reference, independent just as each document
It is incorporated as with reference to such.In addition, it should also be understood that, after reading the above teachings of the present invention, those skilled in the art can
To make various changes or modifications to the present invention, such equivalent forms equally fall within model defined by the application the appended claims
It encloses.
Claims (17)
1. a kind of method for expressing the western appropriate former times monoclonal antibody of overall length, which is characterized in that the described method includes: using adenovirus table
Up to the western appropriate former times monoclonal antibody of overall length；Form the vaccine carrier for chimpanzee type AdC68 that the adenovirus vector of the adenovirus is lacked with E1 and E3
As skeleton carrier, the element for expressing western appropriate former times monoclonal antibody is inserted into for carrier or the people AdHu5 carrier of E1 and E3 missing
The region E1 being deleted in the carrier, using CASI promoter as promoter；The western appropriate former times monoclonal antibody heavy coding
Sequence is as shown in 1-1356 in SEQ ID NO:1, and light chain encoding sequences are as shown in SEQ ID NO:1 1357-1998；
The method is non-diagnostic or therapeutic method.
2. the method as described in claim 1, which is characterized in that the element of the western appropriate former times monoclonal antibody of expression successively wraps
It includes: promoter, signalase 11 coded sequence, western appropriate former times monoclonal antibody heavy coded sequence, catenation sequence, 2 code sequence of signal peptide
Column, western appropriate former times monoclonal antibody light chain encoding sequences, terminator.
3. method according to claim 2, which is characterized in that the terminator includes: SV40 PloyA, BGH PloyA.
4. method as claimed in claim 3, which is characterized in that the terminator is SV40 PloyA.
5. method according to claim 2, which is characterized in that the signalase 11 or signal peptide 2 is secreting signal peptide；Institute
The signalase 11 and signal peptide 2 stated are identical or different.
6. method as claimed in claim 5, which is characterized in that the secreting signal peptide is HLA-A*0201 signal peptide.
7. method according to claim 2, which is characterized in that the catenation sequence is F2A.
8. a kind of adenovirus expression carrier, which is characterized in that the carrier is with the E1 and E3 vaccine carrier for chimpanzee type AdC68 carrier lacked or people
AdHu5 carrier is as skeleton carrier；And successively including the element of the appropriate former times monoclonal antibody of following table darcy: promoter, signalase 11
Coded sequence, western appropriate former times monoclonal antibody heavy coded sequence, catenation sequence, 2 coded sequence of signal peptide, western appropriate former times monoclonal are anti-
Body light chain encoding sequences, terminator；The element for expressing western appropriate former times monoclonal antibody is inserted into the area E1 being deleted in the carrier
Domain, using CASI promoter as promoter；In the western appropriate former times monoclonal antibody heavy coded sequence such as SEQ ID NO:1
Shown in 1-1356, light chain encoding sequences are as shown in SEQ ID NO:1 1357-1998.
9. adenovirus expression carrier as claimed in claim 8, which is characterized in that the signalase 11 or signal peptide 2 is secretion
Signal peptide, the signalase 11 and signal peptide 2 are identical or different.
10. adenovirus expression carrier as claimed in claim 9, which is characterized in that the secreting signal peptide is HLA-A*
0201 signal peptide.
11. adenovirus expression carrier as claimed in claim 8, which is characterized in that the catenation sequence is F2A.
12. adenovirus expression carrier as claimed in claim 10, which is characterized in that the vaccine carrier for chimpanzee type lacked with E1 and E3
When AdC68 carrier is as skeleton carrier, the nucleotide sequence of the gland virus expression Cetuximab such as SEQ ID NO:3 institute
Show；Or
When using the people AdHu5 carrier that E1 and E3 is lacked as skeleton carrier, the nucleotide of the gland virus expression Cetuximab
Sequence is as shown in SEQ ID NO:4.
13. the purposes of any adenovirus expression carrier of claim 8-12, is used to prepare adenovirus, the adenovirus
The western appropriate former times monoclonal antibody of overall length can be expressed.
14. a kind of adenovirus, which is characterized in that the adenovirus is by any adenovirus expression carrier of claim 8-12
It is prepared.
15. the purposes of adenovirus described in claim 14, is used to prepare anti-tumor drug.
16. a kind of anti-tumor drug, which is characterized in that the anti-tumor drug includes: adenovirus described in claim 14, with
And pharmaceutically acceptable carrier.
17. a kind of for expressing the kit of the western appropriate former times monoclonal antibody of overall length, which is characterized in that wrapped in the kit
It includes: adenovirus described in claim the 8-12 any adenovirus expression carrier or claim 14；Or claim 16
The anti-tumor drug.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510308359.XA CN106282232B (en) | 2015-06-05 | 2015-06-05 | A method of tumour is treated based on adenovirus vector expression overall length Cetuximab |
| PCT/CN2016/084223 WO2016192621A1 (en) | 2015-06-05 | 2016-06-01 | Tumor treatment method using full-length cetuximab expressed based on adenovirus carrier |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510308359.XA CN106282232B (en) | 2015-06-05 | 2015-06-05 | A method of tumour is treated based on adenovirus vector expression overall length Cetuximab |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106282232A CN106282232A (en) | 2017-01-04 |
| CN106282232B true CN106282232B (en) | 2019-09-17 |
Family
ID=57440052
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510308359.XA Expired - Fee Related CN106282232B (en) | 2015-06-05 | 2015-06-05 | A method of tumour is treated based on adenovirus vector expression overall length Cetuximab |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN106282232B (en) |
| WO (1) | WO2016192621A1 (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107988258B (en) * | 2017-12-12 | 2020-08-04 | 中国科学院微生物研究所 | Zika virus vaccine based on chimpanzee adenovirus vector and preparation method thereof |
| CN114438128A (en) * | 2020-10-30 | 2022-05-06 | 上海市公共卫生临床中心 | Enhanced oncolytic adenovirus and application thereof |
| CN112552380B (en) * | 2020-12-10 | 2021-12-24 | 武汉博沃生物科技有限公司 | Immunogen of SARS-CoV-2 virus and its application |
| CN112831524B (en) * | 2021-02-20 | 2023-06-13 | 苏州相奕生物技术有限公司 | Artificially modified recombinant adenovirus vector, virus packaged by same and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103937835A (en) * | 2013-08-19 | 2014-07-23 | 中国科学院上海巴斯德研究所 | Expression vector based on adenovirus AdC68 and construction method thereof |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1632109A (en) * | 2003-12-24 | 2005-06-29 | 钱其军 | Highly expressed recombinant gutted adenovirus containing human constant region whole antibody gene and its use |
| WO2007134325A2 (en) * | 2006-05-15 | 2007-11-22 | Introgen Therapeutics, Inc. | Methods and compositions for protein production using adenoviral vectors |
| AU2011306845C1 (en) * | 2010-09-24 | 2015-05-14 | Oncos Therapeutics Oy | Oncolytic adenoviral vectors coding for monoclonal anti - CTLA - 4 antibodies |
| CN102690842B (en) * | 2012-06-12 | 2014-04-23 | 北京工业大学 | Recombinant adenovirus (rAdv) vector for expressing human antibody whole genome and method thereof |
-
2015
- 2015-06-05 CN CN201510308359.XA patent/CN106282232B/en not_active Expired - Fee Related
-
2016
- 2016-06-01 WO PCT/CN2016/084223 patent/WO2016192621A1/en active Application Filing
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103937835A (en) * | 2013-08-19 | 2014-07-23 | 中国科学院上海巴斯德研究所 | Expression vector based on adenovirus AdC68 and construction method thereof |
Non-Patent Citations (1)
| Title |
|---|
| 非增殖性腺病毒携带全长抗体Cetuximab的肿瘤基因治疗的研究;刘海平;《中国优秀硕士学位论文全文数据库——医药卫生科技辑》;20110630(第6期);摘要第2段，第6页第倒数第2，3段 * |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2016192621A1 (en) | 2016-12-08 |
| CN106282232A (en) | 2017-01-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106282232B (en) | A method of tumour is treated based on adenovirus vector expression overall length Cetuximab | |
| KR20070111542A (en) | Novel htmc promoter and vectors for the tumor-selective and high-efficient expression of cancer therapeutic genes | |
| EA004329B1 (en) | Antibodies to the ed-b domain of fibronectin, their construction and uses | |
| US20180169271A1 (en) | Armed replication-competent oncolytic adenoviruses | |
| CN107043774B (en) | Chimeric strong promoter and application thereof | |
| CN104974262A (en) | Novel recombinant double-function fusion protein, and preparation method and application thereof | |
| WO2022077591A1 (en) | Use of recombinant adenovirus in preparation of drugs for prevention of virus | |
| CN103319605A (en) | Hepatic targeting peptide and angiogenesis inhibitor fusion protein as well as preparation method and application thereof | |
| WO2023179789A1 (en) | Preparation and anti-tumor application of gene therapy vector interfering cklf-like marvel transmembrane domain-containing protein 6 (cmtm6) expression | |
| JP2006502726A (en) | Improved immunotherapy | |
| CN105879060A (en) | Tumor DNA vaccines and virus vector vaccines with fibroblast activation protein alpha as target | |
| CN112996909B (en) | Oncolytic viruses expressing PD-1 binding proteins and uses thereof | |
| CN108840945A (en) | Pig albumin-interferon-' alpha '-interleukin-22 fusion protein, preparation method and its encoding gene, a boar long-acting interferon | |
| EP2128261A1 (en) | A recombinant adenovirus comprising recombinant khp50 gene and preparation method and uses thereof | |
| CN101302256B (en) | Novel recombinant fusion molecule and antineoplastic treatment function thereof | |
| CN103882057B (en) | Carry structure and the application thereof of p21ras single-chain antibody gene tomour specific adenoviral vectors | |
| CN1517437B (en) | Vaccine for specificity treating tumour or endocellular infection and application | |
| Yuan et al. | Gene therapy in B-NHL cell line using adenovirus-mediated transfer of secretable trimeric TRAIL gene expression driven by CD20 promoter | |
| CN111500632A (en) | Construction and application of oncolytic adenovirus expressing ST13 and TRAI L | |
| CN105420260A (en) | Target recombination Wnt fusion protein and application thereof in preparing anticarcinogen | |
| JP3428666B2 (en) | Recombinant Marek's disease virus and its production | |
| CN102181407B (en) | Recombinant adenovirus and dendritic cell modified by recombinant adenovirus and application of recombinant adenovirus and dendritic cell | |
| US8956606B2 (en) | Malignant tumor cell suppressor protein, malignant tumor cell suppressor gene, maligant tumor cell suppressive viral vector, and kit using the same | |
| Armentano | Adenovirus vectors for gene therapy | |
| Girard | Induction of protection against viral infection |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20190917 Termination date: 20200605 |