CN103319605A - Hepatic targeting peptide and angiogenesis inhibitor fusion protein as well as preparation method and application thereof - Google Patents

Abstract

The invention discloses a hepatic targeting peptide and angiogenesis inhibitor fusion protein as well as a preparation method and an application thereof. According to the invention, 19 amino acids, which can be specifically combined with an acceptor on the hepatocyte surface (namely heparin sulfate proteoglycan), in a circumsporozoite protein (CSP) N-terminal conserved block I (CSPI-plus) are adopted, and are fused on the amino or carboxyl terminal of the angiogenesis inhibitor by a genetic engineering process to prepare the hepatic targeting peptide and angiogenesis inhibitor fusion protein. The fusion protein can specifically target the liver to inhibit the neovascularization, improve the local concentration of focus part, reduce the dosage of a whole body and reduce the toxic and side effects.

Description

A kind of liver targeting peptides and Angiostatin fusion rotein and preparation method thereof and application

Technical field

The invention belongs to the medical biotechnology field, more specifically, relate to a kind of liver targeting peptides and Angiostatin fusion rotein and preparation method thereof and application.

Background technology

Primary hepatocellular carcinoma (HCC) is sickness rate the 5th in all cancers, the serious disease of lethality rate second, and sickness rate increase year after year and lack effective treatment means.Carry out original new drug significant to improving the liver cancer treatment present situation with the research for the treatment of new target drone.The growth of noumenal tumour and transfer depend on the proposition that new vessel generates theory, for a new approach has been opened up in oncotherapy.At present, take tumor-blood-vessel growth as target spot, suppress or destroy tumor-blood-vessel growth by angiogenesis inhibitor (tumor angiogenesis inhibitors, TAI), cut off the tumors of nutrients source and the cancer new therapy of " dying of hunger " tumour has become study hotspot.

The tumor-blood-vessel growth regulatory mechanism relates to the Imbalance between vasculogenesis stimulating factor and the Angiostatin, the vascular stimulation factor concentration rises or the supressor density loss all can cause tumor vascular hypertrophy, finally leads oncogenic infiltration and transfer.Therefore, the methods of the at present many employings of target treatment to tumor blood vessel: a kind of is the effect that suppresses angiogenic factors, comprise vascular endothelial growth factor (VEGF), fibroblast growth factor (FGF), Urogastron (EGF), transforming growth factor (TGF), pHGF (HGF), angiogenin (Angiopoietins, AP) etc.; Another kind is the self-sow amount that increases Angiostatin, comprise angiostatin (Angiostatin, AS), kringles5, endostatin (Endostatin, ES), THBS1 ,-2 (TSP), TNP-470, PF4 (PF-4) and matrix metallo-proteinase inhibitor (TIMP), collagen protein IV enzymatic fragment tumstatin, canstatin and vastatin etc.

Liver cancer is euangiotic solid tumor, and most of liver cancer have the phenomenon of aberrant angiogenesis hyperplasia.Often find multiple angiogenic factors overexpression between liver cancer cell and periphery thereof in the matter, anti-angiogenesis is expressed lower, the inhibition liver cancer vasculogenesis method that exogenous increase Angiostatin is broad research.

At present existing more than 40 plant angiogenesis inhibitors and enters clinical trial, can be divided into two large classes according to its mechanism of action: a class is specific inhibitor, can specificity inhibition tumor vascular endothelial cell, and to non-endotheliocyte without effect.For example: angiostatin (Angiostatin), endostatin (Endostatin), kringles5, tumstatin, canstatin, vastatin and thrombospondin-1 (TSP-1) etc., another kind of is nonspecific inhibitor, be that Human Umbilical Vein Endothelial Cells and tumour cell have inhibiting angiogenesis inhibitor, for example: Interferon, rabbit (interferon, IFN) and interleukin 12 (interlukin-12, and the active fragments of these Angiostatins IL-12) etc.,, mutant, homologue etc.

Be used for the treatment of alone or in combination kinds of tumors with multiple Angiostatin or with its activity unit clinically at present.But the in vivo easily diffusion degraded of these Angiostatins causes relatively average tissue distribution during treatment, fails to form effective antitumour concentration at lesions position, in order to reach clinical effectiveness, only has the increasing drug dose; Yet escalated dose can improve the cost of medicine and cause toxic side effects, as there is potential detrimentally affect in the vascularization under the physiological statuss such as women physiological period, embryo's formation, wound healing.Improve the organ targeting of Angiostatin, medicine is delivered to diseased region effectively, can improve the therapeutic index of medicine, reduce its toxic side effect.

The polypeptide guiding technique is a very fast technology of development in recent years, this technology by the small peptide that can be combined with the target site high degree of specificity as carrier, with material that pharmaceutical activity is arranged (such as radionuclide, chemotherapeutics, toxin, enzyme, biological response modifier, gene and virus etc.) as " bullet ", rely on the special affinity of carrier height, " bullet " material is concentrated on target site as far as possible, bring into play its biological function.The polypeptide guiding technique is to solve one of difficult problem in the drug development for a long time: the specificity that medicine distributes in vivo not so that increase medicine consumption, improve the cost of medicine and cause toxic side effects desirable scheme is provided.With the tumor vascular endothelial cell specific binding peptides NGR construction of fusion protein NGR-TNF that links to each other with TNF, NGR-TNF is with respect to natural TNF in clinical experiment, lethality to tumour significantly improves, and dosage only is 1/30 of natural TNF, and good potential applicability in clinical practice is arranged.Utilize engineered method to make up guidance quality Interferon, rabbit IFN-α 2a-NGR, distributing in the body to test shows with respect to common Interferon, rabbit, and the guidance quality Interferon, rabbit can specificly be enriched in tumor tissues.And the dosage of guidance quality Interferon, rabbit can reach the result for the treatment of same with common Interferon, rabbit at 1/3 o'clock of common Interferon, rabbit dosage.

Circumsporozoite protein (Circumsporozoite protein, CSP) is a kind of important antigen in plasmodium sporozoite surface, thereby sporozoite utilizes itself and surface of hepatocytes acceptor interaction to identify, stick to surface of hepatocytes.By intravenous injection, recombinant C SP just can be incorporated into surface of hepatocytes in several minutes, shows that CSP has efficient and special liver cell targeted.CSP approximately contains 400 amino acid, is made of the conservative I district of N end, central iteron and the conservative II district of C end.Research in recent years show the conservative I district of CSP N end can with the acceptor of surface of hepatocytes---heparan sulfate proteoglycan (heparan sulfateproteoglycans, HSPG) specifically combination, show CSP I district except comprising conserved sequence KLKQP, the heparin sulfate binding sequence is also contained in the upstream of conserved sequence, and this peptide section that contains KLKQP and heparin sulfate binding sequence is called I-plus.Ancsin etc. studies confirm that, CSP I-plus is with saturated mode heparin-binding and heparin sulfate gel column, and suppress the combination of recombinant C SP and heparin gel.Robertson etc. are fixed on Macrogol Ester plastid top with CSP I-plus and are prepared into and contain the CSP liposome, thereby experiment in vivo and vitro shows that all it can be specifically in conjunction with HSPGs target hepatic tissue.After the mouse vein administration, containing CSP liposome 15 minutes can remove from mouse peripheral blood rapidly, and quantitative analysis shows that concentration that mouse liver contains the CSP liposome is heart, kidney and lungs hundreds of times, is 12 times of spleen.Above result of study prompting CSP I-plus is a good liver targeting vector.

Summary of the invention

The objective of the invention is the deficiency for the prior art existence, and based on the efficient anti-angiogenesis effect of efficient and the special liver cell targeted and Angiostatin of CSP I-plus, provide a kind of liver targeting peptides and Angiostatin fusion rotein.This fusion rotein can utilize liver targeting peptides CSP I-plus efficient special liver cell targeted with the Angiostatin liver that leads, and specificity suppresses the vascularization of liver liver cancer, can improve the therapeutic index of medicine, reduces its toxic side effect.Suppress the angiogenesis treatment liver-cancer medicine thinking and scientific basis are provided for developing clinically target, significant to the treatment level of further raising China liver cancer.

Another purpose of the present invention is to provide the application of liver targeting peptides and Angiostatin fusion rotein.

Purpose of the present invention is achieved by the following technical programs:

A kind of liver targeting peptides and Angiostatin fusion rotein, its aminoacid sequence comprise a kind of Angiostatin or its active fragments sequence and CSP I-plus sequence.Angiostatin can suppress take the multiple factor as target the formation of blood vessel.These factors comprise: MMP, various somatomedin or growth factor receptors, endotheliocyte etc.So far, existing at least 20 angiogenesis factors and surpass 300 Angiostatins and be found wherein have at least 32 supressors to be present in Human bodyIn.On the theory, can realize the present invention so long as have supressor or its active fragments of anti-angiogenesis function, preferably, Angiostatin of the present invention is selected from angiostatin (Angiostatin, AS), a kind of in endostatin (Endostatin, ES), human plasminogen kringles5, thrombospondin 1 (TSP-1) or the Canstatin albumen or any one the active fragments among them.Such as, can connect angiostatin with CSP I-plus sequence, CSP I-plus sequence can be connected in amino or the carboxyl terminal of angiostatin,

Liver targeting peptides of the present invention and Angiostatin antigen-4 fusion protein gene can produce by any methods known in the art, for example: chemosynthesis, or from people's fetal hepatocytes cDNA, obtain the Angiostatin gene, obtain antigen-4 fusion protein gene through SOE-PCR again.More preferably in the latter.

The preparation method of a kind of liver targeting peptides and Angiostatin fusion rotein prepares by the following method: the S1. antigen-4 fusion protein gene makes up: utilize the SOE-PCR method to add CSP I-plus gene order at amino or the carboxyl terminal of people's Angiostatin gene; S2. above-mentioned antigen-4 fusion protein gene is made up recombinant expression vector; S3. with the recombinant expression vector transformed host cell, obtain the engineering bacteria of expressed fusion protein, fermentation culture; S4. purifies and separates obtains liver targeting peptides and Angiostatin fusion rotein.

For the convenient recombinant vectors that makes up of the antigen-4 fusion protein gene that will obtain, during making up, the described antigen-4 fusion protein gene of S1 utilize the SOE-PCR method also to add respectively the restriction enzyme site sequence at carboxyl terminal and the aminoterminal of Angiostatin gene.

Preferably, described fusion rotein is liver targeting peptides and human endostatin fusion rotein, and the preparation method of liver targeting peptides and human endostatin fusion rotein is as follows: the S1. antigen-4 fusion protein gene makes up: utilize the SOE-PCR method to add the CSP I-plus gene order of Nucleotide shown in SEQ ID NO:23 at the carboxyl terminal of Human endostatin gene; Utilize the SOE-PCR method also to add the gene fragment of Nucleotide shown in SEQ ID NO:24 at the aminoterminal of Human endostatin gene; S2. above-mentioned antigen-4 fusion protein gene is made up recombinant expression vector; S3. with the recombinant expression vector transformed host cell, obtain the engineering bacteria of expressed fusion protein, fermentation culture; S4. purifies and separates obtains liver targeting peptides and recombinant human endostatin fusion rotein; Preferably, the described antigen-4 fusion protein gene of S1 makes up concrete steps: amplify Human endostatin gene with primer sets 1 first, adopt the SOE-PCR method to add the CSP I-plus gene order of nucleotide sequence shown in SEQ ID NO:3 at the carboxyl terminal of Human endostatin gene with primer sets 2 and primer sets 3 again, add the gene fragment of Nucleotide shown in SEQ ID NO:4 at the endostatin gene aminoterminal, primer sets 1 is comprised of primer P1 and P2, primer sets 2 is comprised of primer P3 and P4, primer sets 3 is comprised of primer P3 and P5, primer P1, P2, P3, the nucleotide sequence of P4 and P5 is shown in SEQ ID NO:5 ~ 9.

Use the associated biomolecule information science analysis tools such as ProtParam, ProtScale that CDD program in the NCBI server and http://expasy.org website provide, NPS@that the liver targeting peptides for preparing and physicochemical property, functional domain, hydrophobicity, the secondary protein structure of recombinant human endostatin fusion rotein are carried out forecast analysis.The result shows that ES-CSP is cationic protein, contain 211 amino acid, wherein ((Arg+Lys) content is respectively 18 and 27 to acidic amino acid residue for Asp+Glu) and alkaline amino acid residue, molecular weight is 23326.4Da, theoretical iso-electric point is 9.69, instability index is 39.19, protein is more stable, be 30h at the Mammals Half-life in vivo, transformation period respectively can be greater than 20h and 10h in yeast and intestinal bacteria, GRAVY index (amphipathic index) is-0.465, carry out hydrophilic amino acid quantity that the hydrophilic/hydrophobic analysis shows this albumen greater than hydrophobic amino acid with ProtScale, be hydrophilic protein, NPS@analyzes and shows that this albumen secondary structure is with alpha-helix, extended chain and random coil are the primary structure element, show, this fusion rotein is fit to in-vitro recombination expression.

A kind of recombinant expression vector inserts as mentioned above liver targeting peptides and Angiostatin protein gene by the multiple clone site of carrier.The present invention relates to the fusion rotein that this invention is expressed by a kind of exogenous protein expression system, for example prokaryotic expression system, yeast expression system, mammal cell line.Preferably, described prokaryotic expression system is e. coli bl21.Described expression vector is pET21b.Introduce in detail the construction step of recombinant expression vector as an example of human endostatin example: the further prokaryotic expression plasmid of gene fusion construct on the basis of successfully cloning fusion gene, carry out respectively Xho I to the recombinant plasmid pMD20-T-ES-CSP that successfully constructs and prokaryotic expression carrier pET21b and be connected with Nde III double digestion and transform after connecting with T4 DNA ligase enzyme.Positive clone shakes bacterium through bacterium colony PCR preliminary evaluation, extract plasmid and carry out Xho I and the evaluation of Nde III double digestion, the result shows that recombinant plasmid contains and expection band of the same size (Fig. 5), through the dna sequencing analysis, without the base mispairing, determine that finally recombinant expression plasmid pET21b-ES-CSP successfully constructs.

A kind of recombinant strain contains aforesaid recombinant expression vector.The concrete construction step of introducing in detail recombinant strain as an example of human endostatin example as: with the recombined pronucleus expression Plasmid Transformation Host Strains E. coli BL21 (DE3) that successfully constructs, utilize isopropyl-β-D-thiogalactoside(IPTG) (Isopropyl-β-D-thiogalactopyranoside, IPTG) abduction delivering, adopt sodium lauryl sulphate-poly amic acid gel electrophoresis (Sodium Dodecyl Sulfate-Polyacrylamine gel electrophoresis, SDS-PAGE), western blotting (Western Blot) method is carried out Analysis and Identification to expression product, the albumen of Explicit Expression is target protein ES-CSP as a result, shows the expressing fusion protein success.Respectively the conventional expression condition that affects exogenous gene expression (inducing temperature, induce thalline initial concentration, inductor pH, inductor concentration, induction time) is optimized, finds that ES-CSP/pET21b recombinant plasmid optimum condition of the expression in e. coli bl21 (DE3) Host Strains is: inducing temperature be 37 ℃, starter bacteria concentration be OD600 approximately 0.6, the final concentration of inductor IPTG is that 0.06mM, induction time are 4 hours.The target protein of abduction delivering exists with the inclusion body form, carrying out ultrasonic bacteria breaking, and inclusion body is collected in washing, with 6M guanidine hydrochloride dissolution inclusion body, gradient renaturation behind the redilution.Because target protein contains 6 * His amino acid, carry out separation and purification with HisTrap HP affinity column, again respectively with the Tris salt eluent wash-out target protein that contains 50 mM, 100 mM, 300 mM imidazoles, the Fractional Collections elutriant, the SDS-PAGE analytical results shows, contain a large amount of target proteins in the elutriant of 100 mM imidazoles, contain hardly target protein in the elutriant of 50 mM, 300mM imidazoles.Target protein behind the purifying is concentrated for subsequent use after desalting.

Fusion rotein of the present invention comprises and comes from plasmodium falciparum circumsporozoite protein CSP N end I-plus district and have 19 liver cell targeted aminoacid sequences and at least a Angiostatin or its activity unit, described Angiostatin is selected from: angiostatin (Angiostatin, AS) and endostatin (Endostatin, ES), human plasminogen kringles5, thrombospondin (TSP-1) Arresten, Canstatin and TNF and active fragments thereof, mutant, homologue etc.More preferably, fusion rotein comprises CSP N end I-plus district and has the novel recombinant human Endostatin (SEQ ID NO:2) that 19 liver cell targeted aminoacid sequences (SEQ ID NO:1) and N-terminal are added with 9 aminoacid sequences (MGGSHHHHH).

Fusion rotein of the present invention can be by the preparation of any methods known in the art, for example: chemosynthesis or produce from expression of nucleic acid.More preferably, this fusion rotein is expressed by the fusion gene (SEQ ID NO:3) of this albumen and is produced.

Compared with prior art, the present invention has following beneficial effect:

Liver targeting peptides CSP I-plus and Angiostatin that the present invention creatively will derive from plasmodium circumsporozoite protein in resisting merge, utilize CSP I-plus efficient special liver cell targeted with the Angiostatin liver that leads, make it in the liver enrichment, thereby improve the specificity of blood vessel supressor anti-angiogenesis, reach the effect of Hepatoma therapy, reduce the whole body consumption, reduce toxic side effects, improve amount effect ratio.

Description of drawings

Fig. 1 .ES gene amplification and fusion gene restructuring schematic diagram.

Fig. 2. the sleeve type PCR clone contains the nucleotide fragments of ES gene; M:DL2000 DNA Marker;

1,2,3,4 is respectively take 2.0,1.5,1.0,0.0 μ l cDNA as template the dna fragmentation that contains the ES gene of pcr amplification.

Fig. 3 .SOE PCR restructuring ES-CSP fusion gene; M::DL2000 DNA Marker; 1,2,3,4,5 is respectively take 0.0,2.0,1.5,1.0,0.5 μ l ES gene fragment as template the ES-CSP fusion gene of SOE pcr amplification.

Fig. 4 .ES-CSP fusion gene TA clone PCR and double digestion are identified; M:DL10000 DNA Marker; 1,2: recombinant plasmid pMD20-T-ES-CSP double digestion; The ES-CSP fusion gene of 3:SOE pcr amplification.

Fig. 5. recombined pronucleus expression plasmid ES-CSP/pET21b single endonuclease digestion, double digestion are identified; M:DL10000 DNA Marker; 1: expression plasmid pET21b-ES-CSP double digestion; 2: expression plasmid pET21b-ES-CSP single endonuclease digestion.

Fig. 6. the SDS-PAGE of fusion rotein ES-CSP and Western-blotting identify; M: protein standard Marker; 1,3,5, B1: the recombinant bacterial strain whole bacterial protein of not inducing; 2,4,6, B2: the recombinant bacterial strain whole bacterial protein of inducing.

Fig. 7. fusion rotein ES-CSP is cell targeted to human liver cancer cell HepG2; A:DAPI dyes nuclear; The anti-Anti-ES of B:PE mark.

Fig. 8. fusion rotein ES-CSP is to the restraining effect of HUVEC.

Fig. 9. fusion rotein ES-CSP is to the restraining effect of HUVEC on cell migration.

Figure 10. fusion rotein ES-CSP suppresses the formation of chick chorioallantoic membrane new vessel.

Embodiment

Below in conjunction with the drawings and specific embodiments the present invention is made further elaborating, but embodiment does not do any type of restriction to the present invention.

The preparation of embodiment 1 liver targeting peptides and endostatin fusion rotein

Liver targeting peptides and ES Fusion gene construction process are seen Fig. 1

S1. ES gene cloning

Cell cultures and total RNA extract: fetal hepatocytes L-02 cultivates and is containing two anti-(100U/ml penicillin, the 100ug/ml Streptomycin sulphate) and in 1640 cell culture fluid of 10% foetal calf serum, be paved with to cell, press TIANGEN TRNzol total RNA extraction reagent box description operation, every 10cm ²Area adds 1ml TRNzol, extracts cell total rna.

The detection of RNA: get RNA sample 2 μ L, add sample loading buffer, 80V 1.0% agarose gel electrophoresis 20 min.EB dyeing, the gel imaging instrument detects the RNA integrity; Use was diluted total RNA product without the ultrapure water of RNA enzyme with 1: 50, nucleic acid-protein analyser reading, concentration and the purity of analysis RNA sample.1.8≤OD ₂₆₀/ OD ₂₈₀≤ 2.0 is pure rna.

Design of primers: according to the collagen X VIII of NCBI announcement and gene order and the plasmodium falciparum CSP I-plus gene order of C-terminal ES thereof, with Primer Premier 5.0 biosoftwares design primer P1 ~ P5, the nucleotide sequence of primer P1, P2, P3, P4 and P5 is shown in SEQ ID NO:25 ~ 29.

P1 (20bp): CCGCACCACAGCTCCTACGT(SEQ ID NO:25); P2 (20bp): TACTGCACCCTGCCTGACCC(SEQ ID NO:26); P3 (55bp): GGAATTCCATATGGGGGGTTCTCATCACCATCACCATCACAGCCACCGCGACTTC(SEQ ID NO:27); P4 (55bp): TTTTATGTTTTGGTTTCCTTAATTTCTCGTTGTCCTTGGAGGCAGTCATGAAGCT(SEQ ID NO:28); P5 (55bp): GGCCGCTCGAGTTAACCATCCGCTGGTTGCTTTAATTTTTTATGTTTTGGTTTCC(SEQ ID NO:29); Sleeve type PCR clone ES gene: from fetal hepatocytes L-02, extract total RNA, reverse transcription reaction (take oligo dT as primer) is done in reverse transcription test kit explanation by Invitrogen, the cDNA that obtains does the PCR template, take P1 and P2 as primer, amplification contains the ES gene fragment, and size is the sequence (see figure 2) of 877bp.

Add item by item following composition in the 0.2 ml Eppendorf pipe:

The preparation of PCR reaction system is all carried out in ice bath, and the pcr amplification parameter is: 94 ℃ of denaturation 5min, and 94 ℃ of reaction of degeneration 60sec, 60 ℃ of annealing reaction 40sec, 72 ℃ of amplified reaction 90sec carry out 30 circulations, extend 10min in 72 ℃.With DNA Purification Kit purified pcr product, dna sequencing analysis, the gene order consistent (such as Fig. 2) of the upper ES of ES gene order and Genebank.

S2. SOE PCR restructuring ES-CSP fusion gene (such as Fig. 1)

Take the 877bp sequence of P1, P2 amplification as template, with primer P3, P4, P5 amplification ES-CSP fusion gene.Primer P3 is ES N terminal sequence, and at 5 ' gene order and the Nde I restriction endonuclease sites of end adding coding MGGSHHHHH, primer P4 contains ES C end complementary sequence and 19 amino acid whose partial sequences of coding CSP I-plus, primer P5 contains and P4 identical sequence, coding 19 amino acid whose rest part sequences of CSP I-plus and Xho I restriction endonuclease sites, and detailed process is as follows: Mg ²⁺Plus

Add item by item the following table ingredients listed in the 0.2 ml Eppendorf pipe:

The preparation of PCR reaction system is all carried out in ice bath, and the pcr amplification parameter is: 94 ℃ of reaction of degeneration 60sec, and 67 ℃ of annealing reaction 40sec, 72 ℃ of amplified reaction 90sec carry out 10 circulations, take out the Eppendorf pipe and add:

94 ℃ of reaction of degeneration 60sec, 68 ℃ of annealing reaction 40sec, 72 ℃ of amplified reaction 90sec carry out 25 circulations, extend 10min in 72 ℃.With DNA Purification Kit purified pcr product, the purpose fragment is cloned into pMD 20-T carrier, obtain recombinant plasmid pMD20-T-ES-CSP, transform bacillus coli DH 5 alpha, through blue hickie screening, bacterium liquid PCR identifies, after enzyme is cut evaluation and dna sequencing analysis, show the fusion gene that obtains to contain nrhES and CSP I-plus sequence, the order and the direction that splice and combine are entirely true, fusion gene recombinate successfully (such as Fig. 3 and Fig. 4) is described, the aminoacid sequence of liver targeting peptides and endostatin fusion rotein (ES-CSP) shown in SEQ ID NO:1, its nucleotide sequence such as SEQ ID NO:12.

S3. the structure of ES-CSP fusion gene expression plasmid

Recombinant plasmid pMD20-T-ES-CSP and expression vector pET21b are carried out double digestion with restriction enzyme Nde I and XhoI respectively, separate through 1.2% agarose gel electrophoresis, reclaim test kit with sepharose and reclaim ES-CSP fusion gene fragment and carrier pET21b, then connect with the T4 ligase enzyme and spend the night, connect product Transformed E .coli DH5 α competent cell, transform bacterial classification and be applied to the flat board that contains penbritin, after cultivating 16 ~ 18h, picking list bacterium colony carries out bacterium liquid PCR after cultivating, enzyme is cut and is identified and dna sequencing checking (such as Fig. 5), and the result shows that fusion gene expression plasmid pET21b-ES-CSP successfully constructs.

S4. the expression of fusion rotein ES-CSP and evaluation

S41. the expressive host bacterium E.coli BL21(DE3 that the pET21b-ES-CSP Plasmid Transformation has been prepared) competent cell, through ammonia benzyl resistance screening, the positive single bacterium colony of picking pET21b-ES-CSP is in 5ml LB liquid nutrient medium, 37 ℃, 220rpm jolting spend the night, then this bacterium liquid is inoculated in the fresh LB liquid nutrient medium in the 1:100 ratio, 37 ℃, 220rpm jolting are to OD ₆₀₀Approximately 0.6 o'clock, the adding final concentration was that the IPTG of 1.0mmol/L induces 4h.Centrifugal collection mycetocyte adds 1 * SDS-PAGE Buffer, boils 5min, and is centrifugal, gets supernatant and carries out SDS-PAGE.SDS-PAGE result shows: induce rear thalline to have obvious band of expression to conform to expection near 23KD.Because fusion rotein contains 6 * His label, adopting mouse source His monoclonal antibody is that primary antibodie is carried out Western Blotting, the result shows that the expression of recombinant plasmid bacterial strain that contains after inducing has a specific band and not having of not inducing at the 23kDa place, has confirmed that further the albumen of expressing is the target protein (the results are shown in Figure 6) with the His label.

S42. the preparation of the optimization of fusion rotein ES-CSP expression condition and activated protein

The conventional expression condition (inducing thalline initial concentration, inducing temperature, inducing culture pH, inductor concentration, induction time) that affects exogenous gene expression is optimized.Transformed bacteria is inoculated in the LB substratum that contains 100 μ g/ml penbritins, and 37 ℃ of shaking culture are spent the night.Next day, according to the ratio of volume ratio 1:100 incubated overnight bacterium liquid is joined shaking culture in the 250 ml triangular flasks of LB substratum that 50 ml contain 100 μ g/ml penbritins is housed, grow to OD600 approximately 0.2 at cell concentration respectively, 0.4,0.6,0.8,1.0,2.0 the time, add respectively inductor IPTG to final concentration be 0.00,0.06,0.12,0.24,0.48,0.96,1.92 mmol is placed on 42 ℃, 37 ℃, 32 ℃, and carry out abduction delivering under 28 ℃ of culture temperature, and respectively at inducing rear 1h, 2 h, 3 h, 4h, 5 h, 6h, 7h, 8h receives bacterium.Expression product is through 15% SDS-PAGE electrophoresis detection, and the result shows that pET21b-ES-CSP recombinant plasmid optimum condition of the expression in e. coli bl21 (DE3) Host Strains is: inducing temperature is that 37 ℃, starter bacteria concentration are OD ₆₀₀Approximately 0.6, the final concentration of inductor IPTG is that 0.06 mM, induction time are 4 hours.

By the condition induced gene engineering recombinant bacterium after optimizing, expression product is after renaturation, utilize HisTrap HP affinity column to carry out the affinity chromatography purifying, RP-HPLC detects the purity of the ES-CSP that expresses, the result shows that the purity of the ES-CSP fusion rotein behind the abduction delivering Purification reaches 95%, can carry out next step activity experiment.

S43. the biological information analysis of ES-CSP fusion gene encoding fusion protein

The associated biomolecule information science analysis tools such as ProtParam, the ProtScale that the CDD program in the utilization NCBI server and http://expasy.org website provide, NPS@are carried out forecast analysis to physicochemical property, functional domain, hydrophobicity, the secondary protein structure of fusion rotein.The result shows that ES-CSP is cationic protein, contain 211 amino acid, wherein ((Arg+Lys) content is respectively 18 and 27 to acidic amino acid residue for Asp+Glu) and alkaline amino acid residue, molecular weight is 23326.4Da, theoretical iso-electric point is 9.69, instability index is 39.19, protein is more stable, be 30h at the Mammals Half-life in vivo, transformation period respectively can be greater than 20h and 10h in yeast and intestinal bacteria, GRAVY index (amphipathic index) is-0.465, carry out hydrophilic amino acid quantity that the hydrophilic/hydrophobic analysis shows this albumen greater than hydrophobic amino acid with ProtScale, be hydrophilic protein, NPS@analyzes and shows that this albumen secondary structure is with alpha-helix, extended chain and random coil are the primary structure element, show, this fusion rotein is fit to in-vitro recombination expression.CDD program in the utilization NCBI server is searched for its conserved domain and is shown that this fusion rotein contains ES structural domain and ligand binding site; And the space conformation of utilization SWISS-MODEL fully automatic mode model prediction ES-CSP, the result shows: the template code of mating most that finds is: 1bn1D (2.90); The matching degree of sequence is: 99.44%; Evaluating: 5.64e-100 shows that the fusion rotein that the method is expressed has endostatin ES active structure domain.

S5. fusion rotein ES-CSP is to the liver cell targeting effect

S51. the Cell binding of ES-CSP experiment: to contain 5.0,2.5,1.25 μ g/ml ES, the culture medium culturing normal hepatocytes of ES-CSP, the heart, spleen, lung and kidney derived cell and human liver cancer cell, select different time point collecting cells, adding successively two of Anti-ES and PE mark resists, carry out the cellular immunofluorescence test, adopt fluorescent microscope and flow cytometer to detect the fluorescence intensity (the results are shown in Figure 7) of cell surface, as seen HepG 2 cells that contain ES-CSP have shiny red fluorescence, and prompting ES-CSP has higher combination activity to human liver cancer cell HepG 2 cells.

S52. human hepatoma cell strain HepG 2 is injected under the Balb/c nude mice armpit, make up hepatocellular carcinoma in nude mice transplanted tumor model, be divided at random blank (physiological saline) group, ES group, ES-CSP group.By the mouse tail vein administration, respectively at after the administration 15,30,60, the blood sampling of 120min eye socket, centrifugation serum, the ELISA method detects human endostatin concentration in the serum.Put to death immediately after the mouse blood sampling, get respectively liver, kidney, heart, spleen, lung and tumor tissues and prepare homogenate, ELISA measures human endostatin concentration in each sample, and calculates liver target and hepatoma-targeting index.Make Mouse Liver, kidney, heart, spleen, lung and tumor tissue section, add successively two of Anti-ES and PE mark and resist, carry out image analysis on the fluorescence microscopy images analytical system.

S6. fusion rotein ES-CSP suppresses angiogenic action

S61. mtt assay is measured ES-CSP to the restraining effect of cell

Take Human umbilical vein endothelial cells (HUVEC) as research object.The cell of taking the logarithm vegetative period, add in the 96 porocyte culture plates after the cell counting, behind the cell attachment, add 10.0,5.0,2.5,1.25,0.625,0.312,0.156,0.0 μ g/ml ES, ES-CSP, 6 multiple holes, cultivate 48h, mtt assay is measured the 490nm OD of place value, calculates the growth inhibition ratio of cell.Inhibiting rate (%)=(the average OD of the average OD/ control group of 1-experimental group) * 100%(the results are shown in Figure 8).Result's demonstration, ES-CSP can suppress the propagation of HUVEC, and has certain concentration dependent.

S62. the impact of Flow cytometry ES-CSP cell growth cycle and apoptosis

Take Human umbilical vein endothelial cells (HUVEC) as research object, the cell in the vegetative period of taking the logarithm, being adjusted to cell concn after the cell counting is 5 * 10 ⁴Individual/ml, add in (2ml/ hole) in the 6 porocyte culture plates, behind the cell attachment, add respectively certain density ES, ES-CSP, establish the blank group, collecting cell, adopt PI singly to dye Flow Cytometry Assay cycle changing conditions, adopt the two Apoptosis by Flow Cytometry situations of dying of AnnexinV and PI.

S63. scratch experiment, Transwell detect the impact of ES-CSP on cell migration

Take Human umbilical vein endothelial cells (HUVEC) as research object.

Scratch experiment: use first the marker pen at 6 orifice plates behind, comparing with ruler, evenly must draw horizontal line, approximately every 0.5 ~ 1cm together, cross via hole.5 lines are passed in every hole at least.In the hole, add approximately 5 * 10 ⁵Individual cell.Second day is comparing ruler with the rifle head, hangs down as for horizontal line cut behind as far as possible, and it is vertical that the rifle head is wanted, and can not tilt.Wash cell 3 times with PBS, remove the cell under drawing, add respectively the ES serum free medium that contains 1.25 μ g/ml and the serum free medium that contains the ES-CSP of 1.25 μ g/ml, blank is set simultaneously, namely do not contain the serum free medium of any material.Put into 37 ℃, 5%CO ₂Incubator is cultivated.By sampling in 0,6,12,24 hours, take pictures (result such as Fig. 9), the result shows, ES-CSP has the biological activity that ES suppresses the HUVEC migration.

Transwell: the cell in the vegetative period of taking the logarithm, being adjusted to cell concn after the cell counting is 1 * 10 ⁶Individual/ml, the indoor cell suspension 100 μ l that add respectively serum-free medium on the Transwell cell, lower chamber adds the conditioned medium 600 μ l that contain 10% FBS and medicine, and incubator is cultivated 18 h.Take out chamber liquid on the cell reject, wipe with cotton swab and go up to the greatest extent the cell that film is not worn in the chamber, the fixing 30min of 10% formaldehyde under the room temperature, conventional brazilwood extract dyeing is counted the migrating cell number in 5 visuals field under 200 times of light borders, get its mean value, the computation migration inhibiting rate.Every group is repeated 3 times.Inhibiting rate (%)=(the 1-experimental group is worn theca cell number/control group and worn the theca cell number) * 100%.

S64. chick chorioallantoic membrane (CAM) modelling verification ES-CSP is to the effect of new vessel formation

Get the 7th day chicken embryo, find the embryo head by illumination, peel off gently the eggshell that diameter is about 1cm with hand drill, carefully remove shell membrane, expose chick chorioallantoic membrane.Add respectively 30 μ l physiological saline (NS), 50 and 250 μ g/ml ES, ES-CSP on chick chorioallantoic membrane, seal breach with sealed membrane, put into thermostat container and cultivate (37 ℃, humidity 70%).Take out the chicken embryo behind 72 h, local acetone and the dehydrated alcohol of adopting fixed 10 min.Cut the chick chorioallantoic membrane photograph and observe (result such as Figure 10), as seen, ES-CSP can suppress the formation of chick chorioallantoic membrane new vessel.

The preparation of embodiment 2 liver targeting peptides and angiostatin fusion rotein (AS-CSP)

The design primer utilizes the SOE-PCR method to add CSP I-plus gene order at amino or the carboxyl terminal of angiostatin gene; The aminoacid sequence of fusion rotein is shown in SEQ ID NO:2 when adding aminoterminal, and its corresponding nucleotide sequence is shown in SEQ ID NO:13; The aminoacid sequence of fusion rotein is shown in SEQ ID NO:3 when adding carboxyl terminal, and its corresponding nucleotide sequence is shown in SEQ ID NO:14.Antigen-4 fusion protein gene after connecting is carried out eukaryotic expression, and purifying obtains fusion rotein, and concrete grammar is with embodiment 1.

The preparation of embodiment 3 liver targeting peptides and human plasminogen kringles5 fusion rotein

The design primer utilizes the SOE-PCR method to add CSP I-plus gene order at amino or the carboxyl terminal of human plasminogen kringles5 gene; The aminoacid sequence of fusion rotein is shown in SEQ ID NO:4 when adding aminoterminal, and its corresponding nucleotide sequence is shown in SEQ ID NO:15; The aminoacid sequence of fusion rotein is shown in SEQ ID NO:5 when adding carboxyl terminal, and its corresponding nucleotide sequence is shown in SEQ ID NO:16.Antigen-4 fusion protein gene after connecting is carried out eukaryotic expression, and purifying obtains fusion rotein, and concrete grammar is with embodiment 1.

The preparation of embodiment 4 liver targeting peptides and tumor chalone fusion rotein

The design primer utilizes the SOE-PCR method to add CSP I-plus gene order at amino or the carboxyl terminal of tumor chalone gene; The aminoacid sequence of fusion rotein is shown in SEQ ID NO:6 when adding aminoterminal, and its corresponding nucleotide sequence is shown in SEQ ID NO:17; The aminoacid sequence of fusion rotein is shown in SEQ ID NO:7 when adding carboxyl terminal, and its corresponding nucleotide sequence is shown in SEQ ID NO:18.Antigen-4 fusion protein gene after connecting is carried out eukaryotic expression, and purifying obtains fusion rotein, and concrete grammar is with embodiment 1.

The preparation of the fusion rotein of embodiment 5 liver targeting peptides and Canstatin albumen

The design primer utilizes the SOE-PCR method to add CSP I-plus gene order at amino or the carboxyl terminal of Canstatin protein gene; The aminoacid sequence of fusion rotein is shown in SEQ ID NO:8 when adding aminoterminal, and its corresponding nucleotide sequence is shown in SEQ ID NO:19; The aminoacid sequence of fusion rotein is shown in SEQ ID NO:9 when adding carboxyl terminal, and its corresponding nucleotide sequence is shown in SEQ ID NO:20.Antigen-4 fusion protein gene after connecting is carried out eukaryotic expression, and purifying obtains fusion rotein, and concrete grammar is with embodiment 1.

The preparation of the fusion rotein of embodiment 6 liver targeting peptides and thrombospondin-1

The design primer utilizes the SOE-PCR method to add CSP I-plus gene order at amino or the carboxyl terminal of Canstatin protein gene; The aminoacid sequence of fusion rotein is shown in SEQ ID NO:10 when adding aminoterminal, and its corresponding nucleotide sequence is shown in SEQ ID NO:21; The aminoacid sequence of fusion rotein is shown in SEQ ID NO:11 when adding carboxyl terminal, and its corresponding nucleotide sequence is shown in SEQ ID NO:22.Antigen-4 fusion protein gene after connecting is carried out eukaryotic expression, and purifying obtains fusion rotein, and concrete grammar is with embodiment 1.

Measure fusion rotein that embodiment 2 ~ 6 prepares to hepatocellular targeting, and measure fusion rotein that embodiment 2 ~ 6 prepares to suppressing angiogenic action, concrete operation step is with step S5 and the step S6 of embodiment 1.The result shows, after adding liver targeting peptides CSP I-plus gene order, the amino of Angiostatin or carboxyl terminal can obviously increase the liver targeting of Angiostatin, and the CSP I-plus gene order of adding can not affect Angiostatin to the restraining effect of vasculogenesis.

SEQUENCE LISTING

＜110〉Guangdong Pharmaceutical University

＜120〉a kind of liver targeting peptides and Angiostatin fusion rotein and preparation method thereof and application

<130>

<160> 29

<170> PatentIn version 3.3

<210> 1

<211> 211

<212> PRT

＜213〉liver targeting peptides and recombinant human endostatin fusion rotein aminoacid sequence

<400> 1

Met Gly Gly Ser His His His His His His Ser His Arg Asp Phe Gln

1 5 10 15

Pro Val Leu His Leu Val Ala Leu Asn Ser Pro Leu Ser Gly Gly Met

20 25 30

Arg Gly Ile Arg Gly Ala Asp Phe Gln Cys Phe Gln Gln Ala Arg Ala

35 40 45

Val Gly Leu Ala Gly Thr Phe Arg Ala Phe Leu Ser Ser Arg Leu Gln

50 55 60

Asp Leu Tyr Ser Ile Val Arg Arg Ala Asp Arg Ala Ala Val Pro Ile

65 70 75 80

Val Asn Leu Lys Asp Glu Leu Leu Phe Pro Ser Trp Glu Ala Leu Phe

85 90 95

Ser Gly Ser Glu Gly Pro Leu Lys Pro Gly Ala Arg Ile Phe Ser Phe

100 105 110

Asp Gly Lys Asp Val Leu Arg His Pro Thr Trp Pro Gln Lys Ser Val

115 120 125

Trp His Gly Ser Asp Pro Asn Gly Arg Arg Leu Thr Glu Ser Tyr Cys

130 135 140

Glu Thr Trp Arg Thr Glu Ala Pro Ser Ala Thr Gly Gln Ala Ser Ser

145 150 155 160

Leu Leu Gly Gly Arg Leu Leu Gly Gln Ser Ala Ala Ser Cys His His

165 170 175

Ala Tyr Ile Val Leu Cys Ile Glu Asn Ser Phe Met Thr Ala Ser Lys

180 185 190

Asp Asn Glu Lys Leu Arg Lys Pro Lys His Lys Lys Leu Lys Gln Pro

195 200 205

Ala Asp Gly

210

<210> 2

<211> 413

<212> PRT

＜213〉liver targeting peptides and angiostatin fusion rotein aminoacid sequence 1

<400> 2

Asp Asn Glu Lys Leu Arg Lys Pro Lys His Lys Lys Leu Lys Gln Pro

1 5 10 15

Ala Asp Gly Met Ala Glu Asn Arg Lys Ser Ser Ile Ile Ile Arg Met

20 25 30

Arg Asp Val Val Leu Phe Glu Lys Lys Val Tyr Leu Ser Glu Cys Lys

35 40 45

Thr Gly Asn Gly Lys Asn Tyr Arg Gly Thr Met Ser Lys Thr Lys Asn

50 55 60

Gly Ile Thr Cys Gln Lys Trp Ser Ser Thr Ser Pro His Arg Pro Arg

65 70 75 80

Phe Ser Pro Ala Thr His Pro Ser Glu Gly Leu Glu Glu Asn Tyr Cys

85 90 95

Arg Asn Pro Asp Asn Asp Pro Gln Gly Pro Trp Cys Tyr Thr Thr Asp

100 105 110

Pro Glu Lys Arg Tyr Asp Tyr Cys Asp Ile Leu Glu Cys Glu Glu Glu

115 120 125

Cys Met His Cys Ser Gly Glu Asn Tyr Asp Gly Lys Ile Ser Lys Thr

130 135 140

Met Ser Gly Leu Glu Cys Gln Ala Trp Asp Ser Gln Ser Pro His Ala

145 150 155 160

His Gly Tyr Ile Pro Ser Lys Phe Pro Asn Lys Asn Leu Lys Lys Asn

165 170 175

Tyr Cys Arg Asn Pro Asp Arg Glu Leu Arg Pro Trp Cys Phe Thr Thr

180 185 190

Asp Pro Asn Lys Arg Trp Glu Leu Cys Asp Ile Pro Arg Cys Thr Thr

195 200 205

Pro Pro Pro Ser Ser Gly Pro Thr Tyr Gln Cys Leu Lys Gly Thr Gly

210 215 220

Glu Asn Tyr Arg Gly Asn Val Ala Val Thr Val Ser Gly His Thr Cys

225 230 235 240

Gln His Trp Ser Ala Gln Thr Pro His Thr His Asn Arg Thr Pro Glu

245 250 255

Asn Phe Pro Cys Lys Asn Leu Asp Glu Asn Tyr Cys Arg Asn Pro Asp

260 265 270

Gly Lys Arg Ala Pro Trp Cys His Thr Thr Asn Ser Gln Val Arg Trp

275 280 285

Glu Tyr Cys Lys Ile Pro Ser Cys Asp Ser Ser Pro Val Ser Thr Glu

290 295 300

Gln Leu Ala Pro Thr Ala Pro Pro Glu Leu Thr Pro Val Val Gln Asp

305 310 315 320

Cys Tyr His Gly Asp Gly Gln Ser Tyr Arg Gly Thr Ser Ser Thr Thr

325 330 335

Thr Thr Gly Lys Lys Cys Gln Ser Trp Ser Ser Met Thr Pro His Arg

340 345 350

His Gln Lys Thr Pro Glu Asn Tyr Pro Asn Ala Gly Leu Thr Met Asn

355 360 365

Tyr Cys Arg Asn Pro Asp Ala Asp Lys Gly Pro Trp Cys Phe Thr Thr

370 375 380

Asp Pro Ser Val Arg Trp Glu Tyr Cys Asn Leu Lys Lys Cys Ser Gly

385 390 395 400

Thr Glu Ala Ser Val Val Ala Pro Pro Pro Val Val Leu

405 410

<210> 3

<211> 413

<212> PRT

＜213〉liver targeting peptides and angiostatin fusion rotein aminoacid sequence 2

<400> 3

Met Ala Glu Asn Arg Lys Ser Ser Ile Ile Ile Arg Met Arg Asp Val

1 5 10 15

Val Leu Phe Glu Lys Lys Val Tyr Leu Ser Glu Cys Lys Thr Gly Asn

20 25 30

Gly Lys Asn Tyr Arg Gly Thr Met Ser Lys Thr Lys Asn Gly Ile Thr

35 40 45

Cys Gln Lys Trp Ser Ser Thr Ser Pro His Arg Pro Arg Phe Ser Pro

50 55 60

Ala Thr His Pro Ser Glu Gly Leu Glu Glu Asn Tyr Cys Arg Asn Pro

65 70 75 80

Asp Asn Asp Pro Gln Gly Pro Trp Cys Tyr Thr Thr Asp Pro Glu Lys

85 90 95

Arg Tyr Asp Tyr Cys Asp Ile Leu Glu Cys Glu Glu Glu Cys Met His

100 105 110

Cys Ser Gly Glu Asn Tyr Asp Gly Lys Ile Ser Lys Thr Met Ser Gly

115 120 125

Leu Glu Cys Gln Ala Trp Asp Ser Gln Ser Pro His Ala His Gly Tyr

130 135 140

Ile Pro Ser Lys Phe Pro Asn Lys Asn Leu Lys Lys Asn Tyr Cys Arg

145 150 155 160

Asn Pro Asp Arg Glu Leu Arg Pro Trp Cys Phe Thr Thr Asp Pro Asn

165 170 175

Lys Arg Trp Glu Leu Cys Asp Ile Pro Arg Cys Thr Thr Pro Pro Pro

180 185 190

Ser Ser Gly Pro Thr Tyr Gln Cys Leu Lys Gly Thr Gly Glu Asn Tyr

195 200 205

Arg Gly Asn Val Ala Val Thr Val Ser Gly His Thr Cys Gln His Trp

210 215 220

Ser Ala Gln Thr Pro His Thr His Asn Arg Thr Pro Glu Asn Phe Pro

225 230 235 240

Cys Lys Asn Leu Asp Glu Asn Tyr Cys Arg Asn Pro Asp Gly Lys Arg

245 250 255

Ala Pro Trp Cys His Thr Thr Asn Ser Gln Val Arg Trp Glu Tyr Cys

260 265 270

Lys Ile Pro Ser Cys Asp Ser Ser Pro Val Ser Thr Glu Gln Leu Ala

275 280 285

Pro Thr Ala Pro Pro Glu Leu Thr Pro Val Val Gln Asp Cys Tyr His

290 295 300

Gly Asp Gly Gln Ser Tyr Arg Gly Thr Ser Ser Thr Thr Thr Thr Gly

305 310 315 320

Lys Lys Cys Gln Ser Trp Ser Ser Met Thr Pro His Arg His Gln Lys

325 330 335

Thr Pro Glu Asn Tyr Pro Asn Ala Gly Leu Thr Met Asn Tyr Cys Arg

340 345 350

Asn Pro Asp Ala Asp Lys Gly Pro Trp Cys Phe Thr Thr Asp Pro Ser

355 360 365

Val Arg Trp Glu Tyr Cys Asn Leu Lys Lys Cys Ser Gly Thr Glu Ala

370 375 380

Ser Val Val Ala Pro Pro Pro Val Val Leu Asp Asn Glu Lys Leu Arg

385 390 395 400

Lys Pro Lys His Lys Lys Leu Lys Gln Pro Ala Asp Gly

405 410

<210> 4

<211> 101

<212> PRT

＜213〉liver targeting peptides and human plasminogen kringles5 fusion rotein aminoacid sequence 1

<400> 4

Asp Asn Glu Lys Leu Arg Lys Pro Lys His Lys Lys Leu Lys Gln Pro

1 5 10 15

Ala Asp Gly Met Phe Gly Asn Gly Lys Gly Tyr Arg Gly Lys Arg Ala

20 25 30

Thr Thr Val Thr Gly Thr Pro Cys Gln Asp Trp Ala Ala Gln Glu Pro

35 40 45

His Arg His Ser Ile Phe Thr Pro Glu Thr Asn Pro Arg Ala Gly Leu

50 55 60

Glu Lys Asn Tyr Cys Arg Asn Pro Asp Gly Asp Val Gly Gly Pro Trp

65 70 75 80

Cys Tyr Thr Thr Asn Pro Arg Lys Leu Tyr Asp Tyr Cys Asp Val Pro

85 90 95

Gln Cys Ala Ala Pro

100

<210> 5

<211> 101

<212> PRT

＜213〉liver targeting peptides and human plasminogen kringles5 fusion rotein aminoacid sequence 2

<400> 5

Met Phe Gly Asn Gly Lys Gly Tyr Arg Gly Lys Arg Ala Thr Thr Val

1 5 10 15

Thr Gly Thr Pro Cys Gln Asp Trp Ala Ala Gln Glu Pro His Arg His

20 25 30

Ser Ile Phe Thr Pro Glu Thr Asn Pro Arg Ala Gly Leu Glu Lys Asn

35 40 45

Tyr Cys Arg Asn Pro Asp Gly Asp Val Gly Gly Pro Trp Cys Tyr Thr

50 55 60

Thr Asn Pro Arg Lys Leu Tyr Asp Tyr Cys Asp Val Pro Gln Cys Ala

65 70 75 80

Ala Pro Asp Asn Glu Lys Leu Arg Lys Pro Lys His Lys Lys Leu Lys

85 90 95

Gln Pro Ala Asp Gly

100

<210> 6

<211> 264

<212> PRT

＜213〉liver targeting peptides and tumor chalone fusion rotein aminoacid sequence 1

<400> 6

Asp Asn Glu Lys Leu Arg Lys Pro Lys His Lys Lys Leu Lys Gln Pro

1 5 10 15

Ala Asp Gly Pro Gly Leu Lys Gly Lys Arg Gly Asp Ser Gly Ser Pro

20 25 30

Ala Thr Trp Thr Thr Arg Gly Phe Val Phe Thr Arg His Ser Gln Thr

35 40 45

Thr Ala Ile Pro Ser Cys Pro Glu Gly Thr Val Pro Leu Tyr Ser Gly

50 55 60

Phe Ser Phe Leu Phe Val Gln Gly Asn Gln Arg Ala His Gly Gln Asp

65 70 75 80

Leu Gly Thr Leu Gly Ser Cys Leu Gln Arg Phe Thr Thr Met Pro Phe

85 90 95

Leu Phe Cys Asn Val Asn Asp Val Cys Asn Phe Ala Ser Arg Asn Asp

100 105 110

Tyr Ser Tyr Trp Leu Ser Thr Pro Ala Leu Met Pro Met Asn Met Ala

115 120 125

Pro Ile Thr Gly Arg Ala Leu Glu Pro Tyr Ile Ser Arg Cys Thr Val

130 135 140

Cys Glu Gly Pro Ala Ile Ala Ile Ala Val His Ser Gln Thr Thr Asp

145 150 155 160

Ile Pro Pro Cys Pro His Gly Trp Ile Ser Leu Trp Lys Gly Phe Ser

165 170 175

Phe Ile Met Phe Thr Ser Ala Gly Ser Glu Gly Thr Gly Gln Ala Leu

180 185 190

Ala Ser Pro Gly Ser Cys Leu Glu Glu Phe Arg Ala Ser Pro Phe Leu

195 200 205

Glu Cys His Gly Arg Gly Thr Cys Asn Tyr Tyr Ser Asn Ser Tyr Ser

210 215 220

Phe Trp Leu Ala Ser Leu Asn Pro Glu Arg Met Phe Arg Lys Pro Ile

225 230 235 240

Pro Ser Thr Val Lys Ala Gly Glu Leu Glu Lys Ile Ile Ser Arg Cys

245 250 255

Gln Val Cys Met Lys Lys Arg His

260

<210> 7

<211> 264

<212> PRT

＜213〉liver targeting peptides and tumor chalone fusion rotein aminoacid sequence 2

<400> 7

Pro Gly Leu Lys Gly Lys Arg Gly Asp Ser Gly Ser Pro Ala Thr Trp

1 5 10 15

Thr Thr Arg Gly Phe Val Phe Thr Arg His Ser Gln Thr Thr Ala Ile

20 25 30

Pro Ser Cys Pro Glu Gly Thr Val Pro Leu Tyr Ser Gly Phe Ser Phe

35 40 45

Leu Phe Val Gln Gly Asn Gln Arg Ala His Gly Gln Asp Leu Gly Thr

50 55 60

Leu Gly Ser Cys Leu Gln Arg Phe Thr Thr Met Pro Phe Leu Phe Cys

65 70 75 80

Asn Val Asn Asp Val Cys Asn Phe Ala Ser Arg Asn Asp Tyr Ser Tyr

85 90 95

Trp Leu Ser Thr Pro Ala Leu Met Pro Met Asn Met Ala Pro Ile Thr

100 105 110

Gly Arg Ala Leu Glu Pro Tyr Ile Ser Arg Cys Thr Val Cys Glu Gly

115 120 125

Pro Ala Ile Ala Ile Ala Val His Ser Gln Thr Thr Asp Ile Pro Pro

130 135 140

Cys Pro His Gly Trp Ile Ser Leu Trp Lys Gly Phe Ser Phe Ile Met

145 150 155 160

Phe Thr Ser Ala Gly Ser Glu Gly Thr Gly Gln Ala Leu Ala Ser Pro

165 170 175

Gly Ser Cys Leu Glu Glu Phe Arg Ala Ser Pro Phe Leu Glu Cys His

180 185 190

Gly Arg Gly Thr Cys Asn Tyr Tyr Ser Asn Ser Tyr Ser Phe Trp Leu

195 200 205

Ala Ser Leu Asn Pro Glu Arg Met Phe Arg Lys Pro Ile Pro Ser Thr

210 215 220

Val Lys Ala Gly Glu Leu Glu Lys Ile Ile Ser Arg Cys Gln Val Cys

225 230 235 240

Met Lys Lys Arg His Asp Asn Glu Lys Leu Arg Lys Pro Lys His Lys

245 250 255

Lys Leu Lys Gln Pro Ala Asp Gly

260

<210> 8

<211> 246

<212> PRT

＜213〉liver targeting peptides and Canstatin fusion protein aminoacid sequence 1

<400> 8

Asp Asn Glu Lys Leu Arg Lys Pro Lys His Lys Lys Leu Lys Gln Pro

1 5 10 15

Ala Asp Gly Val Ser Ile Gly Tyr Leu Leu Val Lys His Ser Gln Thr

20 25 30

Asp Gln Glu Pro Met Cys Pro Val Gly Met Asn Lys Leu Trp Ser Gly

35 40 45

Tyr Ser Leu Leu Tyr Phe Glu Gly Gln Glu Lys Ala His Asn Gln Asp

50 55 60

Leu Gly Leu Ala Gly Ser Cys Leu Ala Arg Phe Ser Thr Met Pro Phe

65 70 75 80

Leu Tyr Cys Asn Pro Gly Asp Val Cys Tyr Tyr Ala Ser Arg Asn Asp

85 90 95

Lys Ser Tyr Trp Leu Ser Thr Thr Ala Pro Leu Pro Met Met Pro Val

100 105 110

Ala Glu Asp Glu Ile Lys Pro Tyr Ile Ser Arg Cys Ser Val Cys Glu

115 120 125

Ala Pro Ala Ile Ala Ile Ala Val His Ser Gln Asp Val Ser Ile Pro

130 135 140

His Cys Pro Ala Gly Trp Arg Ser Leu Trp Ile Gly Tyr Ser Phe Leu

145 150 155 160

Met His Thr Ala Ala Gly Asp Glu Gly Gly Gly Gln Ser Leu Val Ser

165 170 175

Pro Gly Ser Cys Leu Glu Asp Phe Arg Ala Thr Pro Phe Ile Glu Cys

180 185 190

Asn Gly Gly Arg Gly Thr Cys His Tyr Tyr Ala Asn Lys Tyr Ser Phe

195 200 205

Trp Leu Thr Thr Ile Pro Glu Gln Ser Phe Gln Gly Ser Pro Ser Ala

210 215 220

Asp Thr Leu Lys Ala Gly Leu Ile Arg Thr His Ile Ser Arg Cys Gln

225 230 235 240

Val Cys Met Lys Asn Leu

245

<210> 9

<211> 246

<212> PRT

＜213〉liver targeting peptides and Canstatin fusion protein aminoacid sequence 2

<400> 9

Val Ser Ile Gly Tyr Leu Leu Val Lys His Ser Gln Thr Asp Gln Glu

1 5 10 15

Pro Met Cys Pro Val Gly Met Asn Lys Leu Trp Ser Gly Tyr Ser Leu

20 25 30

Leu Tyr Phe Glu Gly Gln Glu Lys Ala His Asn Gln Asp Leu Gly Leu

35 40 45

Ala Gly Ser Cys Leu Ala Arg Phe Ser Thr Met Pro Phe Leu Tyr Cys

50 55 60

Asn Pro Gly Asp Val Cys Tyr Tyr Ala Ser Arg Asn Asp Lys Ser Tyr

65 70 75 80

Trp Leu Ser Thr Thr Ala Pro Leu Pro Met Met Pro Val Ala Glu Asp

85 90 95

Glu Ile Lys Pro Tyr Ile Ser Arg Cys Ser Val Cys Glu Ala Pro Ala

100 105 110

Ile Ala Ile Ala Val His Ser Gln Asp Val Ser Ile Pro His Cys Pro

115 120 125

Ala Gly Trp Arg Ser Leu Trp Ile Gly Tyr Ser Phe Leu Met His Thr

130 135 140

Ala Ala Gly Asp Glu Gly Gly Gly Gln Ser Leu Val Ser Pro Gly Ser

145 150 155 160

Cys Leu Glu Asp Phe Arg Ala Thr Pro Phe Ile Glu Cys Asn Gly Gly

165 170 175

Arg Gly Thr Cys His Tyr Tyr Ala Asn Lys Tyr Ser Phe Trp Leu Thr

180 185 190

Thr Ile Pro Glu Gln Ser Phe Gln Gly Ser Pro Ser Ala Asp Thr Leu

195 200 205

Lys Ala Gly Leu Ile Arg Thr His Ile Ser Arg Cys Gln Val Cys Met

210 215 220

Lys Asn Leu Asp Asn Glu Lys Leu Arg Lys Pro Lys His Lys Lys Leu

225 230 235 240

Lys Gln Pro Ala Asp Gly

245

<210> 10

<211> 567

<212> PRT

＜213〉liver targeting peptides and thrombospondin-1 fusion rotein aminoacid sequence 1

<400> 10

Asp Asn Glu Lys Leu Arg Lys Pro Lys His Lys Lys Leu Lys Gln Pro

1 5 10 15

Ala Asp Gly Met Gly Leu Ala Trp Gly Leu Gly Val Leu Phe Leu Met

20 25 30

His Val Cys Gly Thr Asn Arg Ile Pro Glu Ser Gly Gly Asp Asn Ser

35 40 45

Val Phe Asp Ile Phe Glu Leu Thr Gly Ala Ala Arg Lys Gly Ser Gly

50 55 60

Arg Arg Leu Val Lys Gly Pro Asp Pro Ser Ser Pro Ala Phe Arg Ile

65 70 75 80

Glu Asp Ala Asn Leu Ile Pro Pro Val Pro Asp Asp Lys Phe Gln Asp

85 90 95

Leu Val Asp Ala Val Arg Ala Glu Lys Gly Phe Leu Leu Leu Ala Ser

100 105 110

Leu Arg Gln Met Lys Lys Thr Arg Gly Thr Leu Leu Ala Leu Glu Arg

115 120 125

Lys Asp His Ser Gly Gln Val Phe Ser Val Val Ser Asn Gly Lys Ala

130 135 140

Gly Thr Leu Asp Leu Ser Leu Thr Val Gln Gly Lys Gln His Val Val

145 150 155 160

Ser Val Glu Glu Ala Leu Leu Ala Thr Gly Gln Trp Lys Ser Ile Thr

165 170 175

Leu Phe Val Gln Glu Asp Arg Ala Gln Leu Tyr Ile Asp Cys Glu Lys

180 185 190

Met Glu Asn Ala Glu Leu Asp Val Pro Ile Gln Ser Val Phe Thr Arg

195 200 205

Asp Leu Ala Ser Ile Ala Arg Leu Arg Ile Ala Lys Gly Gly Val Asn

210 215 220

Asp Asn Phe Gln Gly Val Leu Gln Asn Val Arg Phe Val Phe Gly Thr

225 230 235 240

Thr Pro Glu Asp Ile Leu Arg Asn Lys Gly Cys Ser Ser Ser Thr Ser

245 250 255

Val Leu Leu Thr Leu Asp Asn Asn Val Val Asn Gly Ser Ser Pro Ala

260 265 270

Ile Arg Thr Asn Tyr Ile Gly His Lys Thr Lys Asp Leu Gln Ala Ile

275 280 285

Cys Gly Ile Ser Cys Asp Glu Leu Ser Ser Met Val Leu Glu Leu Arg

290 295 300

Gly Leu Arg Thr Ile Val Thr Thr Leu Gln Asp Ser Ile Arg Lys Val

305 310 315 320

Thr Glu Glu Asn Lys Glu Leu Ala Asn Glu Leu Arg Arg Pro Pro Leu

325 330 335

Cys Tyr His Asn Gly Val Gln Tyr Arg Asn Asn Glu Glu Trp Thr Val

340 345 350

Asp Ser Cys Thr Glu Cys His Cys Gln Asn Ser Val Thr Ile Cys Lys

355 360 365

Lys Val Ser Cys Pro Ile Met Pro Cys Ser Asn Ala Thr Val Pro Asp

370 375 380

Gly Glu Cys Cys Pro Arg Cys Trp Pro Ser Asp Ser Ala Asp Asp Gly

385 390 395 400

Trp Ser Pro Trp Ser Glu Trp Thr Ser Cys Ser Thr Ser Cys Gly Asn

405 410 415

Gly Ile Gln Gln Arg Gly Arg Ser Cys Asp Ser Leu Asn Asn Arg Cys

420 425 430

Glu Gly Ser Ser Val Gln Thr Arg Thr Cys His Ile Gln Glu Cys Asp

435 440 445

Lys Arg Phe Lys Gln Asp Gly Gly Trp Ser His Trp Ser Pro Trp Ser

450 455 460

Ser Cys Ser Val Thr Cys Gly Asp Gly Val Ile Thr Arg Ile Arg Leu

465 470 475 480

Cys Asn Ser Pro Ser Pro Gln Met Asn Gly Lys Pro Cys Glu Gly Glu

485 490 495

Ala Arg Glu Thr Lys Ala Cys Lys Lys Asp Ala Cys Pro Ile Asn Gly

500 505 510

Gly Trp Gly Pro Trp Ser Pro Trp Asp Ile Cys Ser Val Thr Cys Gly

515 520 525

Gly Gly Val Gln Lys Arg Ser Arg Leu Cys Asn Asn Pro Thr Pro Gln

530 535 540

Phe Gly Gly Lys Asp Cys Val Gly Asp Val Thr Glu Asn Gln Ile Cys

545 550 555 560

Asn Lys Gln Asp Cys Pro Ile

565

<210> 11

<211> 567

<212> PRT

＜213〉liver targeting peptides and thrombospondin-1 fusion rotein aminoacid sequence 2

<400> 11

Met Gly Leu Ala Trp Gly Leu Gly Val Leu Phe Leu Met His Val Cys

1 5 10 15

Gly Thr Asn Arg Ile Pro Glu Ser Gly Gly Asp Asn Ser Val Phe Asp

20 25 30

Ile Phe Glu Leu Thr Gly Ala Ala Arg Lys Gly Ser Gly Arg Arg Leu

35 40 45

Val Lys Gly Pro Asp Pro Ser Ser Pro Ala Phe Arg Ile Glu Asp Ala

50 55 60

Asn Leu Ile Pro Pro Val Pro Asp Asp Lys Phe Gln Asp Leu Val Asp

65 70 75 80

Ala Val Arg Ala Glu Lys Gly Phe Leu Leu Leu Ala Ser Leu Arg Gln

85 90 95

Met Lys Lys Thr Arg Gly Thr Leu Leu Ala Leu Glu Arg Lys Asp His

100 105 110

Ser Gly Gln Val Phe Ser Val Val Ser Asn Gly Lys Ala Gly Thr Leu

115 120 125

Asp Leu Ser Leu Thr Val Gln Gly Lys Gln His Val Val Ser Val Glu

130 135 140

Glu Ala Leu Leu Ala Thr Gly Gln Trp Lys Ser Ile Thr Leu Phe Val

145 150 155 160

Gln Glu Asp Arg Ala Gln Leu Tyr Ile Asp Cys Glu Lys Met Glu Asn

165 170 175

Ala Glu Leu Asp Val Pro Ile Gln Ser Val Phe Thr Arg Asp Leu Ala

180 185 190

Ser Ile Ala Arg Leu Arg Ile Ala Lys Gly Gly Val Asn Asp Asn Phe

195 200 205

Gln Gly Val Leu Gln Asn Val Arg Phe Val Phe Gly Thr Thr Pro Glu

210 215 220

Asp Ile Leu Arg Asn Lys Gly Cys Ser Ser Ser Thr Ser Val Leu Leu

225 230 235 240

Thr Leu Asp Asn Asn Val Val Asn Gly Ser Ser Pro Ala Ile Arg Thr

245 250 255

Asn Tyr Ile Gly His Lys Thr Lys Asp Leu Gln Ala Ile Cys Gly Ile

260 265 270

Ser Cys Asp Glu Leu Ser Ser Met Val Leu Glu Leu Arg Gly Leu Arg

275 280 285

Thr Ile Val Thr Thr Leu Gln Asp Ser Ile Arg Lys Val Thr Glu Glu

290 295 300

Asn Lys Glu Leu Ala Asn Glu Leu Arg Arg Pro Pro Leu Cys Tyr His

305 310 315 320

Asn Gly Val Gln Tyr Arg Asn Asn Glu Glu Trp Thr Val Asp Ser Cys

325 330 335

Thr Glu Cys His Cys Gln Asn Ser Val Thr Ile Cys Lys Lys Val Ser

340 345 350

Cys Pro Ile Met Pro Cys Ser Asn Ala Thr Val Pro Asp Gly Glu Cys

355 360 365

Cys Pro Arg Cys Trp Pro Ser Asp Ser Ala Asp Asp Gly Trp Ser Pro

370 375 380

Trp Ser Glu Trp Thr Ser Cys Ser Thr Ser Cys Gly Asn Gly Ile Gln

385 390 395 400

Gln Arg Gly Arg Ser Cys Asp Ser Leu Asn Asn Arg Cys Glu Gly Ser

405 410 415

Ser Val Gln Thr Arg Thr Cys His Ile Gln Glu Cys Asp Lys Arg Phe

420 425 430

Lys Gln Asp Gly Gly Trp Ser His Trp Ser Pro Trp Ser Ser Cys Ser

435 440 445

Val Thr Cys Gly Asp Gly Val Ile Thr Arg Ile Arg Leu Cys Asn Ser

450 455 460

Pro Ser Pro Gln Met Asn Gly Lys Pro Cys Glu Gly Glu Ala Arg Glu 465

470 475 480

Thr Lys Ala Cys Lys Lys Asp Ala Cys Pro Ile Asn Gly Gly Trp Gly

485 490 495

Pro Trp Ser Pro Trp Asp Ile Cys Ser Val Thr Cys Gly Gly Gly Val

500 505 510

Gln Lys Arg Ser Arg Leu Cys Asn Asn Pro Thr Pro Gln Phe Gly Gly

515 520 525

Lys Asp Cys Val Gly Asp Val Thr Glu Asn Gln Ile Cys Asn Lys Gln

530 535 540

Asp Cys Pro Ile Asp Asn Glu Lys Leu Arg Lys Pro Lys His Lys Lys

545 550 555 560

Leu Lys Gln Pro Ala Asp Gly

565

<210> 12

<211> 636

<212> DNA

＜213〉liver targeting peptides and recombinant human endothelial statin fusion rotein corresponding nucleotide sequence

<400> 12

atggggggtt ctcatcacca tcaccatcac agccaccgcg acttccagcc ggtgctccac 60

ctggttgcgc tcaacagccc cctgtcaggc ggcatgcggg gcatccgcgg ggccgacttc 120

cagtgcttcc agcaggcgcg ggccgtgggg ctggcgggca ccttccgcgc cttcctgtcc 180

tcgcgcctgc aggacctgta cagcatcgtg cgccgtgccg accgcgcagc cgtgcccatc 240

gtcaacctca aggacgagct gctgtttccc agctgggagg ctctgttctc aggctctgag 300

ggtccgctga agcccggggc acgcatcttc tcctttgacg gcaaggacgt cctgaggcac 360

cccacctggc cccagaagag cgtgtggcat ggctcggacc ccaacgggcg caggctgacc 420

gagagctact gtgagacgtg gcggacggag gctccctcgg ccacgggcca ggcctcctcg 480

ctgctggggg gcaggctcct ggggcagagt gccgcgagct gccatcacgc ctacatcgtg 540

ctctgcattg agaacagctt catgactgcc tccaaggaca acgagaaatt aaggaaacca 600

aaacataaaa aattaaagca accagcggat ggttaa 636

<210> 13

<211> 1242

<212> DNA

＜213〉liver targeting peptides and angiostatin fusion rotein corresponding nucleotide sequence 1

<400> 13

gacaacgaga aattaaggaa accaaaacat aaaaaattaa agcaaccagc ggatggtatg 60

gctgaaaaca ggaagtcctc cataatcatt aggatgagag atgtagtttt atttgaaaag 120

aaagtgtatc tctcagagtg caagactggg aatggaaaga actacagagg gacgatgtcc 180

aaaacaaaaa atggcatcac ctgtcaaaaa tggagttcca cttctcccca cagacctaga 240

ttctcacctg ctacacaccc ctcagaggga ctggaggaga actactgcag gaatccagac 300

aacgatccgc aggggccctg gtgctatact actgatccag aaaagagata tgactactgc 360

gacattcttg agtgtgaaga ggaatgtatg cattgcagtg gagaaaacta tgacggcaaa 420

atttccaaga ccatgtctgg actggaatgc caggcctggg actctcagag cccacacgct 480

catggataca ttccttccaa atttccaaac aagaacctga agaagaatta ctgtcgtaac 540

cccgataggg agctgcggcc ttggtgtttc accaccgacc ccaacaagcg ctgggaactt 600

tgtgacatcc cccgctgcac aacacctcca ccatcttctg gtcccaccta ccagtgtctg 660

aagggaacag gtgaaaacta tcgcgggaat gtggctgtta ccgtgtccgg gcacacctgt 720

cagcactgga gtgcacagac ccctcacaca cataacagga caccagaaaa cttcccctgc 780

aaaaatttgg atgaaaacta ctgccgcaat cctgacggaa aaagggcccc atggtgccat 840

acaaccaaca gccaagtgcg gtgggagtac tgtaagatac cgtcctgtga ctcctcccca 900

gtatccacgg aacaattggc tcccacagca ccacctgagc taacccctgt ggtccaggac 960

tgctaccatg gtgatggaca gagctaccga ggcacatcct ccaccaccac cacaggaaag 1020

aagtgtcagt cttggtcatc tatgacacca caccggcacc agaagacccc agaaaactac 1080

ccaaatgctg gcctgacaat gaactactgc aggaatccag atgccgataa aggcccctgg 1140

tgttttacca cagaccccag cgtcaggtgg gagtactgca acctgaaaaa atgctcagga 1200

acagaagcga gtgttgtagc acctccgcct gttgtcctgt aa 1242

<210> 14

<211> 1242

<212> DNA

＜213〉liver targeting peptides and angiostatin fusion rotein corresponding nucleotide sequence 2

<400> 14

atggctgaaa acaggaagtc ctccataatc attaggatga gagatgtagt tttatttgaa 60

aagaaagtgt atctctcaga gtgcaagact gggaatggaa agaactacag agggacgatg 120

tccaaaacaa aaaatggcat cacctgtcaa aaatggagtt ccacttctcc ccacagacct 180

agattctcac ctgctacaca cccctcagag ggactggagg agaactactg caggaatcca 240

gacaacgatc cgcaggggcc ctggtgctat actactgatc cagaaaagag atatgactac 300

tgcgacattc ttgagtgtga agaggaatgt atgcattgca gtggagaaaa ctatgacggc 360

aaaatttcca agaccatgtc tggactggaa tgccaggcct gggactctca gagcccacac 420

gctcatggat acattccttc caaatttcca aacaagaacc tgaagaagaa ttactgtcgt 480

aaccccgata gggagctgcg gccttggtgt ttcaccaccg accccaacaa gcgctgggaa 540

ctttgtgaca tcccccgctg cacaacacct ccaccatctt ctggtcccac ctaccagtgt 600

ctgaagggaa caggtgaaaa ctatcgcggg aatgtggctg ttaccgtgtc cgggcacacc 660

tgtcagcact ggagtgcaca gacccctcac acacataaca ggacaccaga aaacttcccc 720

tgcaaaaatt tggatgaaaa ctactgccgc aatcctgacg gaaaaagggc cccatggtgc 780

catacaacca acagccaagt gcggtgggag tactgtaaga taccgtcctg tgactcctcc 840

ccagtatcca cggaacaatt ggctcccaca gcaccacctg agctaacccc tgtggtccag 900

gactgctacc atggtgatgg acagagctac cgaggcacat cctccaccac caccacagga 960

aagaagtgtc agtcttggtc atctatgaca ccacaccggc accagaagac cccagaaaac 1020

tacccaaatg ctggcctgac aatgaactac tgcaggaatc cagatgccga taaaggcccc 1080

tggtgtttta ccacagaccc cagcgtcagg tgggagtact gcaacctgaa aaaatgctca 1140

ggaacagaag cgagtgttgt agcacctccg cctgttgtcc tggacaacga gaaattaagg 1200

aaaccaaaac ataaaaaatt aaagcaacca gcggatggtt aa 1242

<210> 15

<211> 306

<212> DNA

＜213〉liver targeting peptides and human plasminogen kringles5 fusion rotein corresponding nucleotide sequence 1

<400> 15

gacaacgaga aattaaggaa accaaaacat aaaaaattaa agcaaccagc ggatggtatg 60

tttgggaatg ggaaaggata ccgaggcaag agggcgacca ctgttactgg gacgccatgc 120

caggactggg ctgcccagga gccccataga cacagcattt tcactccaga gacaaatcca 180

cgggcgggtc tggaaaaaaa ttactgccgt aaccctgatg gtgatgtagg tggtccctgg 240

tgctacacga caaatccaag aaaactttac gactactgtg atgtccctca gtgtgcggcc 300

ccttaa 306

<210> 16

<211> 306

<212> DNA

＜213〉liver targeting peptides and human plasminogen kringles5 fusion rotein corresponding nucleotide sequence 2

<400> 16

atgtttggga atgggaaagg ataccgaggc aagagggcga ccactgttac tgggacgcca 60

tgccaggact gggctgccca ggagccccat agacacagca ttttcactcc agagacaaat 120

ccacgggcgg gtctggaaaa aaattactgc cgtaaccctg atggtgatgt aggtggtccc 180

tggtgctaca cgacaaatcc aagaaaactt tacgactact gtgatgtccc tcagtgtgcg 240

gcccctgaca acgagaaatt aaggaaacca aaacataaaa aattaaagca accagcggat 300

ggttaa 306

<210> 17

<211> 795

<212> DNA

＜213〉liver targeting peptides and tumor chalone fusion rotein corresponding nucleotide sequence 1

<400> 17

gacaacgaga aattaaggaa accaaaacat aaaaaattaa agcaaccagc ggatggtcca 60

ggtttgaaag gaaaacgtgg agacagtgga tcacctgcaa cctggacaac gagaggcttt 120

gtcttcaccc gacacagtca aaccacagca attccttcat gtccagaggg gacagtgcca 180

ctctacagtg ggttttcttt tctttttgta caaggaaatc aacgagccca cggacaagac 240

cttggaactc ttggcagctg cctgcagcga tttaccacaa tgccattctt attctgcaat 300

gtcaatgatg tatgtaattt tgcatctcga aatgattatt catactggct gtcaacacca 360

gctctgatgc caatgaacat ggctcccatt actggcagag cccttgagcc ttatataagc 420

agatgcactg tttgtgaagg tcctgcgatc gccatagccg ttcacagcca aaccactgac 480

attcctccat gtcctcacgg ctggatttct ctctggaaag gattttcatt catcatgttc 540

acaagtgcag gttctgaggg caccgggcaa gcactggcct cccctggctc ctgcctggaa 600

gaattccgag ccagcccatt tctagaatgt catggaagag gaacgtgcaa ctactattca 660

aattcctaca gtttctggct ggcttcatta aacccagaaa gaatgttcag aaagcctatt 720

ccatcaactg tgaaagctgg ggaattagaa aaaataataa gtcgctgtca ggtgtgcatg 780

aagaaaagac actga 795

<210> 18

<211> 795

<212> DNA

＜213〉liver targeting peptides and tumor chalone fusion rotein corresponding nucleotide sequence 2

<400> 18

ccaggtttga aaggaaaacg tggagacagt ggatcacctg caacctggac aacgagaggc 60

tttgtcttca cccgacacag tcaaaccaca gcaattcctt catgtccaga ggggacagtg 120

ccactctaca gtgggttttc ttttcttttt gtacaaggaa atcaacgagc ccacggacaa 180

gaccttggaa ctcttggcag ctgcctgcag cgatttacca caatgccatt cttattctgc 240

aatgtcaatg atgtatgtaa ttttgcatct cgaaatgatt attcatactg gctgtcaaca 300

ccagctctga tgccaatgaa catggctccc attactggca gagcccttga gccttatata 360

agcagatgca ctgtttgtga aggtcctgcg atcgccatag ccgttcacag ccaaaccact 420

gacattcctc catgtcctca cggctggatt tctctctgga aaggattttc attcatcatg 480

ttcacaagtg caggttctga gggcaccggg caagcactgg cctcccctgg ctcctgcctg 540

gaagaattcc gagccagccc atttctagaa tgtcatggaa gaggaacgtg caactactat 600

tcaaattcct acagtttctg gctggcttca ttaaacccag aaagaatgtt cagaaagcct 660

attccatcaa ctgtgaaagc tggggaatta gaaaaaataa taagtcgctg tcaggtgtgc 720

atgaagaaaa gacacgacaa cgagaaatta aggaaaccaa aacataaaaa attaaagcaa 780

ccagcggatg gttga 795

<210> 19

<211> 741

<212> DNA

＜213〉liver targeting peptides and Canstatin fusion protein corresponding nucleotide sequence 1

<400> 19

gacaacgaga aattaaggaa accaaaacat aaaaaattaa agcaaccagc ggatggtgtc 60

agcatcggct acctcctggt gaagcacagc cagacggacc aggagcccat gtgcccggtg 120

ggcatgaaca aactctggag tggatacagc ctgctgtact tcgagggcca ggagaaggcg 180

cacaaccagg acctggggct ggcgggctcc tgcctggcgc ggttcagcac catgcccttc 240

ctgtactgca accctggtga tgtctgctac tatgccagcc ggaacgacaa gtcctactgg 300

ctctctacca ctgcgccgct gcccatgatg cccgtggccg aggacgagat caagccctac 360

atcagccgct gttctgtgtg tgaggccccg gccatcgcca tcgcggtcca cagtcaggat 420

gtctccatcc cacactgccc agctgggtgg cggagtttgt ggatcggata ttccttcctc 480

atgcacacgg cggcgggaga cgaaggcggt ggccaatcac tggtgtcacc gggcagctgt 540

ctagaggact tccgcgccac accattcatc gaatgcaatg gaggccgcgg cacctgccac 600

tactacgcca acaagtacag cttctggctg accaccattc ccgagcagag cttccagggc 660

tcgccctccg ccgacacgct caaggccggc ctcatccgca cacacatcag ccgctgccag 720

gtgtgcatga agaacctgtg a 741

<210> 20

<211> 741

<212> DNA

＜213〉liver targeting peptides and Canstatin fusion protein corresponding nucleotide sequence 2

<400> 20

gtcagcatcg gctacctcct ggtgaagcac agccagacgg accaggagcc catgtgcccg 60

gtgggcatga acaaactctg gagtggatac agcctgctgt acttcgaggg ccaggagaag 120

gcgcacaacc aggacctggg gctggcgggc tcctgcctgg cgcggttcag caccatgccc 180

ttcctgtact gcaaccctgg tgatgtctgc tactatgcca gccggaacga caagtcctac 240

tggctctcta ccactgcgcc gctgcccatg atgcccgtgg ccgaggacga gatcaagccc 300

tacatcagcc gctgttctgt gtgtgaggcc ccggccatcg ccatcgcggt ccacagtcag 360

gatgtctcca tcccacactg cccagctggg tggcggagtt tgtggatcgg atattccttc 420

ctcatgcaca cggcggcggg agacgaaggc ggtggccaat cactggtgtc accgggcagc 480

tgtctagagg acttccgcgc cacaccattc atcgaatgca atggaggccg cggcacctgc 540

cactactacg ccaacaagta cagcttctgg ctgaccacca ttcccgagca gagcttccag 600

ggctcgccct ccgccgacac gctcaaggcc ggcctcatcc gcacacacat cagccgctgc 660

caggtgtgca tgaagaacct ggacaacgag aaattaagga aaccaaaaca taaaaaatta 720

aagcaaccag cggatggttg a 741

<210> 21

<211> 1701

<212> DNA

＜213〉liver targeting peptides and thrombospondin-1 fusion rotein corresponding nucleotide sequence 1

<400> 21

gacaacgaga aattaaggaa accaaaacat aaaaaattaa agcaaccagc ggatggtatg 60

gggctggcct ggggactagg cgtcctgttc ctgatgcatg tgtgtggcac caaccgcatt 120

ccagagtctg gcggagacaa cagcgtgttt gacatctttg aactcaccgg ggccgcccgc 180

aaggggtctg ggcgccgact ggtgaagggc cccgaccctt ccagcccagc tttccgcatc 240

gaggatgcca acctgatccc ccctgtgcct gatgacaagt tccaagacct ggtggatgct 300

gtgcgggcag aaaagggttt cctccttctg gcatccctga ggcagatgaa gaagacccgg 360

ggcacgctgc tggccctgga gcggaaagac cactctggcc aggtcttcag cgtggtgtcc 420

aatggcaagg cgggcaccct ggacctcagc ctgaccgtcc aaggaaagca gcacgtggtg 480

tctgtggaag aagctctcct ggcaaccggc cagtggaaga gcatcaccct gtttgtgcag 540

gaagacaggg cccagctgta catcgactgt gaaaagatgg agaatgctga gttggacgtc 600

cccatccaaa gcgtcttcac cagagacctg gccagcatcg ccagactccg catcgcaaag 660

gggggcgtca atgacaattt ccagggggtg ctgcagaatg tgaggtttgt ctttggaacc 720

acaccagaag acatcctcag gaacaaaggc tgctccagct ctaccagtgt cctcctcacc 780

cttgacaaca acgtggtgaa tggttccagc cctgccatcc gcactaacta cattggccac 840

aagacaaagg acttgcaagc catctgcggc atctcctgtg atgagctgtc cagcatggtc 900

ctggaactca ggggcctgcg caccattgtg accacgctgc aggacagcat ccgcaaagtg 960

actgaagaga acaaagagtt ggccaatgag ctgaggcggc ctcccctatg ctatcacaac 1020

ggagttcagt acagaaataa cgaggaatgg actgttgata gctgcactga gtgtcactgt 1080

cagaactcag ttaccatctg caaaaaggtg tcctgcccca tcatgccctg ctccaatgcc 1140

acagttcctg atggagaatg ctgtcctcgc tgttggccca gcgactctgc ggacgatggc 1200

tggtctccat ggtccgagtg gacctcctgt tctacgagct gtggcaatgg aattcagcag 1260

cgcggccgct cctgcgatag cctcaacaac cgatgtgagg gctcctcggt ccagacacgg 1320

acctgccaca ttcaggagtg tgacaagaga tttaaacagg atggtggctg gagccactgg 1380

tccccgtggt catcttgttc tgtgacatgt ggtgatggtg tgatcacaag gatccggctc 1440

tgcaactctc ccagccccca gatgaacggg aaaccctgtg aaggcgaagc gcgggagacc 1500

aaagcctgca agaaagacgc ctgccccatc aatggaggct ggggtccttg gtcaccatgg 1560

gacatctgtt ctgtcacctg tggaggaggg gtacagaaac gtagtcgtct ctgcaacaac 1620

cccacacccc agtttggagg caaggactgc gttggtgatg taacagaaaa ccagatctgc 1680

aacaagcagg actgtccaat t 1701

<210> 22

<211> 1701

<212> DNA

＜213〉liver targeting peptides and thrombospondin-1 fusion rotein corresponding nucleotide sequence 2

<400> 22

atggggctgg cctggggact aggcgtcctg ttcctgatgc atgtgtgtgg caccaaccgc 60

attccagagt ctggcggaga caacagcgtg tttgacatct ttgaactcac cggggccgcc 120

cgcaaggggt ctgggcgccg actggtgaag ggccccgacc cttccagccc agctttccgc 180

atcgaggatg ccaacctgat cccccctgtg cctgatgaca agttccaaga cctggtggat 240

gctgtgcggg cagaaaaggg tttcctcctt ctggcatccc tgaggcagat gaagaagacc 300

cggggcacgc tgctggccct ggagcggaaa gaccactctg gccaggtctt cagcgtggtg 360

tccaatggca aggcgggcac cctggacctc agcctgaccg tccaaggaaa gcagcacgtg 420

gtgtctgtgg aagaagctct cctggcaacc ggccagtgga agagcatcac cctgtttgtg 480

caggaagaca gggcccagct gtacatcgac tgtgaaaaga tggagaatgc tgagttggac 540

gtccccatcc aaagcgtctt caccagagac ctggccagca tcgccagact ccgcatcgca 600

aaggggggcg tcaatgacaa tttccagggg gtgctgcaga atgtgaggtt tgtctttgga 660

accacaccag aagacatcct caggaacaaa ggctgctcca gctctaccag tgtcctcctc 720

acccttgaca acaacgtggt gaatggttcc agccctgcca tccgcactaa ctacattggc 780

cacaagacaa aggacttgca agccatctgc ggcatctcct gtgatgagct gtccagcatg 840

gtcctggaac tcaggggcct gcgcaccatt gtgaccacgc tgcaggacag catccgcaaa 900

gtgactgaag agaacaaaga gttggccaat gagctgaggc ggcctcccct atgctatcac 960

aacggagttc agtacagaaa taacgaggaa tggactgttg atagctgcac tgagtgtcac 1020

tgtcagaact cagttaccat ctgcaaaaag gtgtcctgcc ccatcatgcc ctgctccaat 1080

gccacagttc ctgatggaga atgctgtcct cgctgttggc ccagcgactc tgcggacgat 1140

ggctggtctc catggtccga gtggacctcc tgttctacga gctgtggcaa tggaattcag 1200

cagcgcggcc gctcctgcga tagcctcaac aaccgatgtg agggctcctc ggtccagaca 1260

cggacctgcc acattcagga gtgtgacaag agatttaaac aggatggtgg ctggagccac 1320

tggtccccgt ggtcatcttg ttctgtgaca tgtggtgatg gtgtgatcac aaggatccgg 1380

ctctgcaact ctcccagccc ccagatgaac gggaaaccct gtgaaggcga agcgcgggag 1440

accaaagcct gcaagaaaga cgcctgcccc atcaatggag gctggggtcc ttggtcacca 1500

tgggacatct gttctgtcac ctgtggagga ggggtacaga aacgtagtcg tctctgcaac 1560

aaccccacac cccagtttgg aggcaaggac tgcgttggtg atgtaacaga aaaccagatc 1620

tgcaacaagc aggactgtcc aattgacaac gagaaattaa ggaaaccaaa acataaaaaa 1680

ttaaagcaac cagcggatgg t 1701

<210> 23

<211> 57

<212> DNA

＜213〉liver targeting peptides CSP I-plus

<400> 23

gacaacgaga aattaaggaa accaaaacat aaaaaattaa agcaaccagc ggatggt 57

<210> 24

<211> 27

<212> DNA

＜213〉nucleotide sequence of human endostatin aminoterminal adding

<400> 24

atggggggtt ctcatcacca tcaccat 27

<210> 25

<211> 20

<212> DNA

＜213〉primer P1

<400> 25

ccgcaccaca gctcctacgt 20

<210> 26

<211> 20

<212> DNA

＜213〉primer P2

<400> 26

tactgcaccc tgcctgaccc 20

<210> 27

<211> 55

<212> DNA

＜213〉primer P3

<400> 27

ggaattccat atggggggtt ctcatcacca tcaccatcac agccaccgcg acttc 55

<210> 28

<211> 55

<212> DNA

＜213〉primer P4

<400> 28

ttttatgttt tggtttcctt aatttctcgt tgtccttgga ggcagtcatg aagct 55

<210> 29

<211> 55

<212> DNA

＜213〉primer P5

<400> 29

ggccgctcga gttaaccatc cgctggttgc tttaattttt tatgttttgg tttcc 55

Claims (10)

1. a liver targeting peptides and Angiostatin fusion rotein is characterized in that, its aminoacid sequence comprises a kind of Angiostatin or its active fragments sequence and CSP I-plus sequence.

2. according to claim 1 described liver targeting peptides and Angiostatin fusion rotein, it is characterized in that, described Angiostatin is endostatin, angiostatin, human plasminogen kringles5, tumor chalone, Canstatin albumen or thrombospondin-1; The aminoacid sequence of described liver targeting peptides and Angiostatin fusion rotein is shown in SEQ ID NO:1 ~ 11, and its corresponding nucleotide sequence is shown in SEQ ID NO:12 ~ 22.

3. the preparation method of a claim 1 or 2 described liver targeting peptides and Angiostatin fusion rotein is characterized in that, prepares by the following method:

S1. antigen-4 fusion protein gene makes up: utilize the SOE-PCR method to add CSP I-plus gene order at amino or the carboxyl terminal of people's Angiostatin gene;

S2. above-mentioned antigen-4 fusion protein gene is made up recombinant expression vector;

S3. with the recombinant expression vector transformed host cell, obtain the engineering bacteria of expressed fusion protein, fermentation culture;

S4. purifies and separates obtains liver targeting peptides and Angiostatin fusion rotein.

4. the preparation method of described fusion rotein according to claim 3 is characterized in that, utilizes the SOE-PCR method also to add respectively the restriction enzyme site sequence at carboxyl terminal and the aminoterminal of Angiostatin gene during the described antigen-4 fusion protein gene of S1 makes up.

5. according to claim 1 ~ 2 each described liver targeting peptides and Angiostatin fusion rotein, it is characterized in that, described fusion rotein is liver targeting peptides and human endostatin fusion rotein, and the preparation method of liver targeting peptides and human endostatin fusion rotein is as follows:

S1. antigen-4 fusion protein gene makes up: utilize the SOE-PCR method to add the CSP I-plus gene order of Nucleotide shown in SEQ ID NO:23 at the carboxyl terminal of Human endostatin gene; Utilize the SOE-PCR method also to add the gene fragment of Nucleotide shown in SEQ ID NO:24 at the aminoterminal of Human endostatin gene;

S2. above-mentioned antigen-4 fusion protein gene is made up recombinant expression vector;

S3. with the recombinant expression vector transformed host cell, obtain the engineering bacteria of expressed fusion protein, fermentation culture;

S4. purifies and separates obtains liver targeting peptides and recombinant human endostatin fusion rotein.

6. according to claim 5 described liver targeting peptides and Angiostatin fusion rotein, it is characterized in that, the described antigen-4 fusion protein gene of S1 makes up concrete steps: amplify Human endostatin gene with primer sets 1 first, adopt the SOE-PCR method to add the CSP I-plus gene order of nucleotide sequence shown in SEQ ID NO:3 at the carboxyl terminal of Human endostatin gene with primer sets 2 and primer sets 3 again, add the gene fragment of Nucleotide shown in SEQ ID NO:4 at the endostatin gene aminoterminal, primer sets 1 is comprised of primer P1 and P2, primer sets 2 is comprised of primer P3 and P4, primer sets 3 is comprised of primer P3 and P5, primer P1, P2, P3, the nucleotide sequence of P4 and P5 is shown in SEQ ID NO:25 ~ 29.

7. a recombinant expression vector is characterized in that, is inserted the gene order of the described liver targeting peptides of claim 1 and Angiostatin fusion rotein by the multiple clone site of carrier.

8. described recombinant expression vector according to claim 7 is characterized in that, described recombinant expression vector is recombinant prokaryotic expression vector.

9. a recombinant strain is characterized in that, contains claim 7 or 8 described recombinant expression vectors.

10. the described liver targeting peptides of claim 1 and the Angiostatin fusion rotein application in preparation inhibition liver liver cancer vascularization medicine.

Images