CN106282232A - A kind of method expressing total length Cetuximab treatment tumor based on adenovirus vector - Google Patents
A kind of method expressing total length Cetuximab treatment tumor based on adenovirus vector Download PDFInfo
- Publication number
- CN106282232A CN106282232A CN201510308359.XA CN201510308359A CN106282232A CN 106282232 A CN106282232 A CN 106282232A CN 201510308359 A CN201510308359 A CN 201510308359A CN 106282232 A CN106282232 A CN 106282232A
- Authority
- CN
- China
- Prior art keywords
- adenovirus
- carrier
- monoclonal antibody
- former times
- expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
- C12N15/861—Adenoviral vectors
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Wood Science & Technology (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- Virology (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention relates to a kind of method expressing total length Cetuximab treatment tumor based on adenovirus vector.Using adenovirus vector success first, have expressed western appropriate former times monoclonal antibody efficiently, the monoclonal antibody biological activity obtained is good, can reach effective therapeutical effect for animal.
Description
Technical field
The invention belongs to biotechnology and field of virology, more particularly it relates to an based on adenopathy
Poisonous carrier expresses the method for total length Cetuximab treatment tumor.
Background technology
Cetuximab (cetuximab) is first and is approved listing in global multiple countries, is targeting
People Mus mosaic type lgG1 monoclonal antibody (Iressa:first in EGF-R ELISA (EGFR)
angiogenesis inhibitor approved for the treatment of advanced NSCLC.Expert
Rev Anticancer Ther, 2003.3 (3): p.257).Cetuximab can be specific binding with EGFR,
The competitive combination blocking epidermal growth factor and its part, and, the affinity being combined with EGFR is
10 times of native ligand EGF.The heterodimer of EGFR can be suppressed after in conjunction with, and lower downstream
Gene, blocks the signal transduction paths such as PI3K-AKT, RAS-RAF-MAPK, and these approach are in tumor
The propagation of cell, infiltration and inhibited apoptosis play a significant role.Cetuximab can also make EGFR
By endocytosis, thus reduce the expression of EGFR.Furthermore, it is also possible to by antibody-dependant cell mediate thin
Cellular toxicity (ADCC) kills target cell.Cetuximab blocks tumor cell by the above approach and increases
Grow, shift, attack and angiogenesis, reach to treat the purpose of tumor.
Research finds, many carcinoma of the colon and rectum, incidence cancer, nonsmall-cell lung cancer, cancer of pancreas, mammary gland
All there is EGFR process LAN in the cancerous cell of the patients such as cancer, cervical cancer, renal carcinoma, this just imply that western appropriate former times
Monoclonal antibody is likely to become candidate's medicine of these cancers.At present, Cetuximab is as first-line treatment medicine
Combine relevant chemotherapeutic, for transitivity carcinoma of the colon and rectum and the treatment of squamous cell carcinoma of the head and neck.With
Time, Cetuximab combines other Chemotherapeutic treatments nonsmall-cell lung cancers, transitivity cancer of pancreas, advanced gastric
Cancers etc. are also into III clinical trial phase.
At present, the Cetuximab used clinically is at mammalian cell (murine myeloma cell)
Middle cultivation produces.It is long to there is manufacturing cycle in the method, complex process, and hybridoma is unstable and anti-
Property the easy defect such as loss so that the preparation cost of Cetuximab is higher, uses Cetuximab treatment one
The expense of the individual course for the treatment of is about 2.4 ten thousand RMB, within 1 year, then needs 1,150,000 RMB, expensive expense to make
The patient benefiting from Cetuximab is difficult to undertake.
Therefore, this area reduces the method preparing Cetuximab of cost in the urgent need to exploitation, with significantly
Property ground reduce clinical patient treatment cost.
Summary of the invention
It is an object of the invention to provide a kind of swollen based on adenovirus vector expression total length Cetuximab treatment
The method of tumor.
In a first aspect of the present invention, it is provided that a kind of method expressing the western appropriate former times monoclonal antibody of total length, institute
The method of stating includes: the application western appropriate former times monoclonal antibody of gland virus expression total length.
In a preference, in described method, adenovirus vector form described adenovirus, institute
The adenovirus vector stated comprises the element expressing western appropriate former times monoclonal antibody.
In another preference, in described method, form the adenovirus vector of described adenovirus with E1 and E3
People's Hu5 carrier of the vaccine carrier for chimpanzee type AdC68 carrier of disappearance or E1 and E3 disappearance is as skeleton carrier.
In another preference, in described method, the described element expressing western appropriate former times monoclonal antibody depends on
Secondary (according to 5 ' → 3 ' sequentially) including: promoter, signalase 11 coded sequence, western appropriate former times monoclonal anti body weight
Chain coding sequence, catenation sequence, signal peptide 2 coded sequence, western appropriate former times monoclonal antibody light chain code sequence
Row, terminator.
In another preference, in described method, described promoter includes: CASI promoter, CMV
Promoter；Preferably CASI promoter；Or described terminator includes, but is not limited to: SV40PloyA,
BGH PloyA；Preferably BGH PloyA.
In another preference, in described method, described signalase 11 or signal peptide 2 are secretion signals
Peptide；It is preferably comprised: HLA-A*0201 signal peptide；It is preferred that described signalase 11 and signal peptide 2
Identical or different.
In another preference, in described method, described catenation sequence includes: F2A, 2A, IRES；
Preferably F2A.
In another preference, in described method, described western appropriate former times monoclonal antibody heavy coded sequence
Western appropriate former times monoclonal antibody light chain code sequence as shown in 1-1356 position in SEQ ID NO:1 or described
Row are as shown in SEQ ID NO:1 1357-1998 position.
In another preference, in described method, the adenovirus vector described in formation lacks with E1 and E3
Vaccine carrier for chimpanzee type AdC68 carrier or people's AdHu5 carrier as skeleton carrier, described expression western appropriate former times is single
The element of clonal antibody is inserted in this carrier the E1 region being deleted.
In another preference, in described method, the side of the western appropriate former times monoclonal antibody of described expression total length
Method is non-diagnostic or curative method.
In another aspect of this invention, it is provided that a kind of adenovirus expression carrier, this carrier lacks with E1 and E3
The vaccine carrier for chimpanzee type AdC68 carrier lost or people's AdHu5 carrier are as skeleton carrier；And successively (according to 5 ' → 3 '
Sequentially) include the element of the western appropriate former times monoclonal antibody of following expression: promoter, signalase 11 coded sequence,
Western appropriate former times monoclonal antibody heavy coded sequence, catenation sequence, signal peptide 2 coded sequence, western appropriate former times is single
Monoclonal antibody light coded sequence, terminator.
In a preference, in described adenovirus expression carrier, the western appropriate former times monoclonal anti of described expression
The element of body is inserted in this carrier the E1 region being deleted.
In another preference, in described adenovirus expression carrier, described promoter includes: CASI
Promoter, CMV promoter；Preferably CASI promoter；Or described terminator includes (but not limiting
In): SV40PloyA.
In another preference, in described adenovirus expression carrier, described signalase 11 or signal peptide 2
It it is secreting signal peptide；It is preferably comprised: HLA-A*0201 signal peptide；It is preferred that described signalase 11
Identical or different with signal peptide 2.
In another preference, in described adenovirus expression carrier, described catenation sequence includes: F2A,
2A, IRES；Preferably F2A.
In another preference, in described adenovirus expression carrier, described western appropriate former times monoclonal antibody
The western appropriate former times monoclonal anti that heavy chain-coding sequence is as shown in 1-1356 position in SEQ ID NO:1 or described
Body light chain encoding sequences is as shown in SEQ ID NO:1 1357-1998 position.
In another preference, in described adenovirus expression carrier, with the chimpanzee of E1 and E3 disappearance
When type AdC68 carrier is as skeleton carrier, the nucleotide sequence of described gland virus expression Cetuximab is such as
Shown in SEQ ID NO:3；Or using E1 and E3 disappearance people's pHu5 carrier as skeleton carrier time, described
The nucleotide sequence of gland virus expression Cetuximab is as shown in SEQ ID NO:4.
In another aspect of this invention, it is provided that the purposes of described adenovirus expression carrier, it is used for preparing gland
Virus, described adenovirus can express the western appropriate former times monoclonal antibody of total length.
In another aspect of this invention, it is provided that a kind of adenovirus, described adenovirus is by described adenovirus table
Reach carrier to be prepared from.
In a preference, after described adenovirus expression carrier linearisation, proceed to virus production thin
Born of the same parents' such as HEK 293 cell, thus prepare adenovirus.
In another aspect of this invention, it is provided that the purposes of described adenovirus, it is used for preparing antitumor drug.
In another aspect of this invention, it is provided that a kind of antitumor drug, described antitumor drug includes described
Adenovirus, and pharmaceutically acceptable carrier.
In another aspect of this invention, it is provided that a kind of reagent for expressing the western appropriate former times monoclonal antibody of total length
Box, described test kit includes: described adenovirus expression carrier, or described adenovirus；Or it is described
Antitumor drug.
The other side of the present invention, due to this disclosure, is aobvious to those skilled in the art
And be clear to.
Accompanying drawing explanation
Fig. 1, total length Cetuximab expression cassette schematic diagram.Monoclonal antibody gene inserts what adenovirus vector was deleted
E1 region, is started by CASI promoter and expresses, divide before monoclonal antibody heavy chain lgG HC, light chain lgG LC
Not with secreting signal peptide HLA-A*0201, middle connected by F2A, after with SV40 PloyA.
Fig. 2, recombinant adenovirus plasmid enzyme action are identified.A: recombinant adenovirus plasmid pAdC 68-CTB warp
Bgl II, Xho I, Mfe I enzyme action are identified；B: recombinant adenovirus plasmid pHu 5-CTB through Bgl II,
Kpn I, Hind III enzyme action are identified.
Fig. 3, recombinant adenovirus genome enzyme action are identified.A: recombinant adenovirus AdC 68-CTB genome
Identify through Bgl II, Xho I, Mfe I enzyme action；B: recombinant adenovirus Hu 5-CTB genome is through Bgl
II, Kpn I, Hind III enzyme action are identified.
Fig. 4, Western Bolt detects recombinant adenovirus vivoexpression total length Cetuximab.1010Vp/ hole
Recombinant adenovirus AdC68-CTB, Hu5-CTB infect HEK 293 cell, with 1010Vp/ hole
AdC68-empty, Hu5-empty are negative control, collect cell conditioned medium after 24h.With commercialization
Cetuximab is positive control.A is under non reducing conditions, the expression of total length monoclonal antibody；B is reducing condition
Under, heavy chain and the expression respectively of light chain.
Fig. 5, ELISA detect Cetuximab expression in vitro.With 1010vp、109Recombinate in vp/ hole
Adenovirus AdC68-CTB, Hu5-CTB infect MRC 5 cell, with 108vp、107Vp/ hole restructuring gland
Virus infects HEK 293 cell, collects cell conditioned medium at 3 days, 5 days respectively.With 1010vp、109vp、
108vp、107The zero load of vp/ hole adenovirus AdC68-empty, Hu5-empty are negative control.
Cetuximab binding specificity expressed by Fig. 6, indirect immunofluorescene assay recombinant adenovirus.Choose
EGFR+HCEpi C, NCI-H 508 and EGFR-Chinese hamster ovary celI, with inject AdC68-CTB,
Hu5-CTB mice serum is experimental group, and AdC68-empty, Hu5-empty mice serum is negative right
According to group, commercialization Erbitux is positive controls.
The affinity of Cetuximab expressed by Fig. 7, indirect ELISA detection recombinant adenovirus.With injection
AdC68-CTB, Hu5-CTB mice serum is experimental group, and commercialization Erbitux is positive control,
The affinity of Cetuximab monoclonal antibody is by detection EC50Value compares.
Fig. 8, MTT detect the recombinant adenovirus impact on the propagation of colon cancer cell.Colorectal cancer cell
It is that DiFi and NCI-H508 is through 107、108With 109After vp recombinant adenovirus processes 72h, MTT detects
Cell-proliferation activity.
Fig. 9, the nude mouse tumor model assessment recombinant adenovirus inhibitory action to colon cancer.A is early treatment
Group；B is treatment of late stage group.
Figure 10, NCI-H508 tumor is bred the SABC detection of specific proteins Ki-67.Ki-67
Positive signal is brown color, is positioned tumor cell karyon.A: the detection for the treatment of of late stage group Ki-67；B:
Early treatment organizes the detection of Ki-67.
Figure 11, pAdC68-△ E1E3 builds schematic diagram.
Detailed description of the invention
The present inventor is through extensively in-depth study, it has unexpectedly been found that use adenovirus vector, particularly E1
With vaccine carrier for chimpanzee type AdC68 carrier or the western appropriate former times monoclonal antibody of people's Hu5 vector expression of E3 disappearance, can obtain
Obtaining high expressed, and the monoclonal antibody biological activity obtained is good, generated can recombinant expressed western appropriate former times
The adenovirus of monoclonal antibody can be directly used for animal and reaches effective therapeutical effect.The completeest
Become the present invention.
In prior art, the general method using hybridoma to express of preparation of western appropriate former times monoclonal antibody,
Production process complexity is difficult to control to, limits throughput, and scale is limited, and antibody is also easy to lose activity or be subject to
Pollute, use eukaryotic expression system cost high and express difficulty.Therefore, the present inventor is to multiple expression system
Studied, to find the system being suitable for expressing western appropriate former times monoclonal antibody, screened through numerous studies,
It is surprised to find that and uses the adenoviral expression systems optimized to express western appropriate former times monoclonal antibody, expression efficiency
Height, expresses stable, with low cost, and the biological activity of the appropriate former times monoclonal antibody obtained is the best, institute
Generate the adenovirus of recombinant expressed western appropriate former times monoclonal antibody can be directly used for animal and reaches effective
Therapeutical effect.The present invention provides a kind of new method for clinically relevant oncotherapy.
Adenovirus vector
Owing to the genome comparison of adenovirus is big, about 36kb, make Direct Cloning recombinant adenoviral vector
Become technical bottleneck.Therefore, inventor developed the fast method direct construction base that can be connected by enzyme action
In vaccine carrier for chimpanzee type adenovirus AdC68 as expression vector.Additionally, vaccine carrier for chimpanzee type adenovirus AdC6, AdC7
Also it is available with adenovirus hominis AdHu26, AdHu36 etc..As the optimal way of the present invention, with E1
Carry as skeleton with the vaccine carrier for chimpanzee type AdC68 carrier of E3 disappearance or people's Hu5 carrier of E1 and E3 disappearance
Body.
There is heavy chain and light chain in monoclonal antibody, realize the most efficiently expressing and can retentive activity, this
A person of good sense has carried out design studies repeatedly, screen for substantial amounts of Expression element, and final optimization pass is suitable for
Expression element, including promoter, catenation sequence, signal peptide etc..Therefore as the optimal way of the present invention,
The described element expressing western appropriate former times monoclonal antibody (according to 5 ' → 3 ' sequentially) including successively: promoter, letter
Number peptide 1 coded sequence, western appropriate former times monoclonal antibody heavy coded sequence, catenation sequence, signal peptide 2 is compiled
Code sequence, western appropriate former times monoclonal antibody light chain encoding sequences, terminator.
As the optimal way of the present invention, use from foot and mouth disease virus (food-and-mouth disease
Virus, FMDV) ribosomal skip sequence (ribosomal skipping sequence 2A) realize heavy chain of antibody
Coexpression with light chain of antibody.It is high that 2A connexon has self cleavage efficiency, two gene expression balances of upstream and downstream
Property is good, the advantages such as structure is short and small.After adding Furin protease cleavage site RAKR before 2A, can
To remain in the sequence of front end PROTEIN C end after removing 2A self cleavage, improve the shear efficiency of connexon, with
Time avoid the impact on front end protein expression of the 2A residual sequence.The sequence that RAKR Yu 2A connexon is constituted
It is called for short F2A.
As the optimal way of the present invention, using CASI as promoter, it is by CMV, chicken-
β-actin, ubiquitin C composition, it is able to maintain that exogenous gene Cetuximab continuing in muscle
Express.Through the substantial amounts of screening of the present inventor, it is believed that it is single that CASI promoter is highly suitable for carrying out western appropriate former times
Anti-expression, it can extremely efficient improve the expression of exogenous gene Cetuximab, and maintain its
Continuous expression in muscle.
As the optimal way of the present invention, use HLA-A*0201 as signal peptide, the inventors discovered that,
It can guide the polypeptide of new life to enter intracavity by endoplasmic reticulum, is finally secreted into outside born of the same parents.Preferably
Use the HLA-A*0201 signal peptide optimized through GC, the secretion level of antibody can be improved.
Described expression vector is generally possibly together with origin of replication and/or marker gene etc..Carrying according to the present invention
Showing, method well-known to those having ordinary skill in the art can be used for building the expression vector needed for the present invention.These sides
Method includes recombinant DNA technology in vi, DNA synthetic technology, In vivo recombination technology etc..Described DNA
In the suitable promoter (such as CMV) that sequence can be effectively connected in expression vector, to instruct mRNA to synthesize.
Expression vector also includes ribosome binding site and the transcription terminator of translation initiation.Additionally, expression vector
Preferably comprise one or more selected marker, to provide the table of the host cell for selecting conversion
Type character.
In the present invention, described western appropriate former times monoclonal antibody is antibody known in the art, its heavy chain code sequence
Row can be as shown in 1-1356 position in SEQ ID NO:1；Light chain encoding sequences can be such as SEQ ID NO:
Shown in 1 1357-1998 position.On the light chain or heavy chain of monoclonal antibody, through one or more amino acid residues
Replacement, lack or add and formed but antigen binding capacity is identical with western appropriate former times monoclonal antibody or
The monoclonal antibody of approximation is also included in the present invention.The present invention may be used without the modified or Dan Ke of improvement
Grand antibody, such as, can use in order to promote its half-life, effectiveness, metabolism and/or albumen effect and
The monoclonal antibody modified or improve and formed.Monoclonal antibody is not affected it is to say, any
Bioactive light chain and sequence of heavy chain version can be used in the present invention.
Above-mentioned each element of the present invention is that operability connects, thus the effective expression of beneficially monoclonal antibody.As
Used herein, described " operability is connected (or connection) " refers to two or more nucleic acid region or nucleotide sequence
Functional spatial arrangements, the operability of these sequences is connected can produce functional product, such as albumen or
RNA molecule.
Adenovirus
After obtaining described adenovirus expression carrier, it transfected virus is produced cell, carry out the breeding of virus.
After a period of time after transfection, virus can be gathered in the crops.Described virus production cell can be known in this field
Various can the cell of propagating adenovirus, such as 293 cells etc..
As the optimal way of the present invention, the virus of results can repeated infection virus production cell, persistently pass on.
Virus titer (TCID50) mensuration can carry out according to this area conventional method.The recombinant adenovirus obtained
It is also contained in the present invention.
Pharmaceutical composition
Present invention also offers a kind of pharmaceutical composition, it contains effective dose (such as 0.000001-50wt%；
Preferably 0.00001-20wt%；More preferably, 0.0001-10wt%) described adenovirus, and pharmacy
Upper acceptable carrier.
As used herein, term " contain " represent various composition can be applied to together the present invention mixture or
In compositions.Therefore, term " mainly by ... composition " and " consist of " be included in term and " contain
Have " in.
As used herein, term " effective dose " or " effective dose " refer to produce people and/or animal
Function or activity and can by people and/or animal accepted as used herein.
As used herein, the composition of " pharmaceutically acceptable " applies to people and/or mammal and nothing
Excessive bad side reaction (such as toxicity, stimulation and allergy), i.e. has rational benefit/risk ratio
Material.Term " pharmaceutically acceptable carrier " refers to the carrier for Therapeutic Administration, including various
Excipient and diluent.
Generally, described adenovirus can be formulated in nontoxic, inert and pharmaceutically acceptable aqueous carrier
In medium, wherein pH ordinarily be about 5-8, it is preferred that pH is about 6-8.
The pharmaceutical composition of the present invention can be to be made into injection form, such as with normal saline or containing glucose
It is prepared by conventional method with the aqueous solution of other adjuvant.The dosage of active component (adenovirus) is to control
Treat effective dose, such as every day about 0.1 microgram/kg body weight-about 10 mg/kg body weight.Certainly, concrete agent
Amount is it is also contemplated that the factor such as route of administration, patient health situation, within the scope of these are all skilled practitioners technical ability
's.
When being used for suppressing mammal tumor, described adenovirus can systemic administration, or local application,
The factors such as the concrete visual kind of tumor, growth site, progress extent determine.
Test kit or medicine box
New discovery based on the present invention, present invention also offers a kind of for expressing the western appropriate former times monoclonal anti of total length
Test kit/the medicine box of body, described test kit/medicine box includes described adenovirus expression carrier or described
Adenovirus.Described test kit/medicine box may also include virus production cell (such as 293 cells), culture medium etc..
Additionally, the use of adenovirus using method is said after may also include explanation expression in described test kit/medicine box
Bright book.
The present inventor have detected and lives the biology of the Cetuximab utilizing the system expression of the present invention to obtain
Property, and detect that it has good antitumous effect, for tumor in cellular level with animal model
Antybody therapy provides a kind of New Policy.
Recombinant adenovirus energy high-efficiency transfection mammalian cell that the recombinant adenoviral vector of the present invention generates,
Being prone to amplification and purification, toxicity are low, its expression efficiency is high and permanent.The adenovirus vector of the present invention is expressed
Cetuximab production technology is simple, cheap in restructuring, curative effect is lasting, be better than in the market other
The expression of method.
Below in conjunction with specific embodiment, the present invention is expanded on further.Should be understood that these embodiments are only used for
The present invention is described rather than limits the scope of the present invention.The reality of unreceipted actual conditions in the following example
Proved recipe method, generally writes according to normal condition such as J. Pehanorm Brooker etc., Molecular Cloning: A Laboratory guide, the 3rd
Version, Science Press, the condition described in 2002, or according to the condition proposed by manufacturer.
I. materials and methods
1, main agents, bacterial strain and laboratory animal
All of toolenzyme is purchased from New England Biolabs；LipofectatimeTM 2000, ammonia Bian
Penicillins etc. are purchased from Invitrogen；Primer synthesizes in Jin Sirui bio tech ltd；Plasmid is in a small amount
Extraction purification test kit, DNA purification kit, DNA gel reclaim and purification kit is purchased from a day root
Biochemical technology company limited；DMEM culture medium, hyclone, 0.25% pancreatin, two anti-purchased from Hyclone.
Goat-anti people lgG-Kappa is purchased from SouthernBiotech, rabbit anti-human lgG Fc (HRP), lgG H&L (HRP)
Purchased from Abcom, goat-anti people lgG-FITC purchased from Santa Cruz, anti-rabbit lgG (HRP), anti-sheep lgG (HRP)
Purchased from Sigma.
Coli strain Stbl 2 is purchased from Invitrogen；Adenovirus packaging cell system HEK 293 cell,
Human colorectal cancer cells DiFi and NCI-H508 (EGFR+) it is purchased from ATCC；CHO Chinese hamster ovary
Cell (EGFR-), human embryonic lung cell MRC 5 and people colon epithelial cell HCEpi C be purchased from China section
Institute's cell bank.Experiment mice 6-8 week old Balb/C female nude mice has purchased from the smooth biotechnology of Shanghai spirit
Limit company.
2, the structure of the pHu5 that plasmid pAdC68-△ E1E3 and E1 and E3 deletes
The structure of (i) plasmid pNEB193-KE
According to the multiple clone site on pNEB193 carrier (New England Biolabs) and adenovirus AdC68
The sequence of genome, the primer (table 1) of design amplification KE fragment, PCR expands purpose product KE fragment.
The KE fragment of EcoR I and Kpn I double digestion PCR amplification, agarose gel purification KE fragment, connect
To the pNEB193 carrier through identical enzyme action, it is transformed in DH5 α competent cell, picking positive colony,
PNEB193-KE is obtained through enzyme action and order-checking qualification.
Table 1, PCR primer sequence
(ii) structure of plasmid pNEB193-KE-AK
Asc I and Kpn I double digestion AdC68 genome (GenBank accession number AC_000011), low melting point
Agarose gel electrophoresis reclaims AK fragment, is connected to the pNEB193-KE carrier through identical enzyme action, converts
Enter in Stbl2 competent cell, picking positive colony, identify through enzyme action and obtain pNEB193-KE-AK.
(iii) structure of plasmid pNEB193-KE-AK-XA
Xba I and Asc I double digestion AdC68 genome, owing to Asc I exists three at adenovirus AdC68
Restriction enzyme site, carries out partially digested to Asc I, is placed in 37 DEG C of enzyme action AdC68 genome 10s, low melting point
Gel reclaims the maximum XA fragment of enzyme action, is connected to the pNEB193-KE-AK carrier through identical enzyme action,
Enzyme action is identified and is obtained pNEB193-KE-AK-XA.
(iv) structure of plasmid pNEB193-PX
According to the multiple clone site on pNEB193 carrier and the sequence of adenoviral gene group, design amplification PX
The primer (table 1) of fragment, PCR expands purpose product PX fragment.Pme I and Xba I double digestion PCR expands
Increasing the PX fragment reclaimed, agarose gel reclaims purpose product PX fragment, is connected to through identical enzyme action
PNEB193 carrier, is transformed in Stbl2 competent cell, and picking positive colony, wherein near adenovirus
The region of AdC68 left end ITR is identified through order-checking.Xba I enzyme action adenovirus AdC68 genome, low melting point
Agarose gel reclaims the Xba I-Xba I part obtained in AdC68, and replacement is connected to through Xba I enzyme action
PNEB193-PX carrier in, be transformed in Stbl2 competent cell, picking positive colony, enzyme action reflect
Surely pNEB193-PX is obtained.
E1 part in AdC68 genome in (v) deletion pNEB193-PX plasmid
EcoR I and Mfe I double digestion pShuttle-CMV plasmid (Clontech Laboratories, Inc), depends on
According to the character of isocaudarner, empty carrier is connected, be transformed in DH5a competent cell and obtain pShuttle-EM
Plasmid.The primer (table 1) of the sequential design amplification Linker according to pShuttle-EM plasmid, PCR expands
Linker product.The Linker fragment of SnaB I and Nde I double digestion PCR amplification, agarose gel reclaims
Linker product, is connected to the pNEB193-PX carrier through identical enzyme action (by AdC68 genome sequence
Row are analyzed, and utilize SnaB I and two restriction enzyme sites of Nde I its E1 partial sequence to be deleted), it is transformed into
DH5 α competent cell, picking positive colony, identify through enzyme action and obtain pNEB193-PX-Linker.
The sequence of Linker is inserted between AdC68 genome 459-3011 position, replaces the major part of E1
Sequence.The sequence of Linker is following (SEQ ID NO:11):
cgcgcgttgg ccgattcatt aatgcagacc cataataccc ataatgccat ttcattacct 60
ctttctccgc acccgacata gatgaattgt cggtcaagcc ttgccttgtt gtagcttaaa 120
ttttgctcgc gcactactca gcgacctcca acacacaagc agggagcaga tactggctta 180
actatgcggc atcagagcag attgtactga gagtgcacca taggggatcg ggagatctga 240
gctttcgcta ccttaggacc gttatagtta cgtcaggtgg cacttttcgg ggaaatgtgc 300
gcggaac 307
(vi) pAdC68-△ E1 plasmid construction
Xba I and Pme I double digestion pNEB193-PX-Linker plasmid DNA, and utilize agarose gel
Reclaim PX-Linker fragment, be connected to through identical enzyme action low melting-point agarose gel reclaim
PNEB193-KE-AK-XA carrier, is transformed in Stbl2 competent cell, and picking positive colony, through enzyme
Cut qualification and obtain pAdC68-E1-deleted (pAdC68-△ E1).
(vii) pAdC68-△ E1E3 builds
With plasmid pAdC68-△ E1 as template, according to forward primer F:tctcctagggaggaacaacaagca
(SEQ ID NO:12) and downstream primer R:tggcctaggatttaaataGTCGTTGTCGCAGTGGTTG
(SEQ ID NO:13), PCR obtains fragment AA, meanwhile, with Avr II digested plasmid pAdC68-△ E1
Producing identical sticky end with fragment AA, the method connected by low melting point obtains recombinant adenovirus plasmid
PAdC68-△ E1E3, schematic diagram such as Figure 11.
The part that E3 district is deleted by territory is 24679-28414 bit sequence.
(viii) pHu5 (pHu5-△ E1/E3) that E1 and E3 deletes builds
The construction method of the pHu5 that E1 with E3 deletes is identical with pAdC68.
3, the structure of shuttle vector of adenovirus
Total length Cetuximab (weight, sequence of light chain see GenBank accession number GM685459.1 and
GM685461.1.Weight, light chain front end respectively carry a HLA-A*0201 signal peptide, and (its sequence is
atggccgtgatggcgccgcggaccctggtcctcctgctgagcggcgccctcgccctgacgcagacctgggccggg
(SEQ ID NO:14)), and connected by F2A, in its insertion PU57 plasmid of its coded sequence, become
PUC57-CTB plasmid, its full length sequence such as SEQ ID NO:2.
By synthetic vectors PUC57-CTB plasmid through Avr II and Cla I double digestion, will simultaneously
(promoter CASI sequence is shown in GenBank accession number JB974538.1, SV40ployA to PUC-Promoter
Sequence is shown in JB974550.1, is inserted in PU57 plasmid, becomes PUC-Promoter) through Avr II He
Cla I double digestion obtains having identical sticky end, linearizing carrier, uses T4DNA ligase pair
The cohesive end of above-mentioned two products is attached.Product will be connected according to a conventional method convert, containing blocking that resistance
Screen on agar plate, 37 DEG C of incubated overnight in the LB culture medium containing that resistance of card, extract plasmid.
The method such as PCR, enzyme action of employing is identified, obtains positive recombiant plasmid, named pShuttle-CTB.
4, the preparation of recombinant adenovirus plasmid
By pShuttle-CTB plasmid through PI-Sce I and I-Ceu I double digestion, simultaneously by adenovirus vector
PAdC68-△ E1/E3 obtains having identical sticky end, linearisation through PI-Sce I and I-Ceu I double digestion
Carrier.Utilize agarose gel to be separated and recovered from purpose fragment, meanwhile, utilize low melting-point agarose to coagulate
Glue separation adenovirus vector, hatches 5 minutes by the gel 65 DEG C of gland-containing virus carrier, until completely dissolved
With T4DNA ligase, above-mentioned two products are carried out cohesive end connection.In competence bacteria Stbl 2 routinely just
Method will connect product and convert, and will be applied to by converted product subsequently on the agarose plate containing ammonia benzyl resistance, in 30 DEG C
Cultivating 24h, selected clone is 30 DEG C of incubated overnight in the LB culture medium containing ammonia benzyl resistance, extract plasmid,
Carry out electrophoretic mobility analysis with 1% agarose gel, and carry out Bgl II, Xho I, Mfe I restriction enzyme mapping
Analyze.Positive recombinant adenovirus plasmid bacterium solution amplification culture (1:1000) of gained is obtained a large amount of high-quality
Plasmid DNA, named pAdC68-CTB, its full length sequence such as SEQ ID NO:3.
Clone recombinant adenovirus pHu5-CTB method ibid, will pShuttle-CTB plasmid through PI-Sce I
With I-Ceu I double digestion, simultaneously that adenovirus vector pHu5-△ E1/E3 is double through PI-Sce I and I-Ceu I
Enzyme action, connection obtain, and carry out Bgl II, Hind III, Kpn I Cleavage Map.pHu5-CTB
Full length sequence such as SEQ ID NO:4.
5, the preparation of recombinant adenovirus
With restricted enzyme Pac I linearisation recombinant adenovirus plasmid pAdC68-CTB, press
Plasmid is transfected HEK 293 cell by the method in LipofectatimeTM 2000 description, 37 DEG C, 5%
CO2Cultivate 8-12 days, obvious plaque occurs.Cell, multigelation is collected after cell rounding, suspension
Take viral supernatants after three times and infect HEK 293 cell (25cm2Tissue Culture Flask).Then above step is repeated
Suddenly, after receiving poison, 1:3 amplicon virus (infects a 75cm2Tissue Culture Flask), press 1:6 after receiving poison afterwards
Amplicon virus (infects three 150cm2Tissue Culture Flask), press about 1:9 amplicon virus (about after finally receiving poison
25-30 150cm2Tissue Culture Flask), utilize cesium chloride density gradient centrifugation purification of Recombinant adenovirus
[16], surveying OD value, the glycerol adding final concentration of 10% is stored in-80 DEG C.Recombinant adenovirus Hu5-CTB
Preparation method is ibid.
Extract viral genome AdC68-CTB, and carry out Bgl II, Xho I, Mfe I Cleavage Map.
Extract viral genome Hu5-CTB, and carry out Bgl II, Hind III, Kpn I Cleavage Map.
6, Western blot detection recombinant adenovirus expresses Cetuximab monoclonal antibody
Recombinant adenovirus AdC68-CTB, Hu5-CTB are diluted to concentration 1011Vp/ml, then uses 100ul
Recombinant adenovirus infects six orifice plate HEK 293 cells, i.e. every hole 1010Vp adenovirus, with every hole 1010vp
AdC68-empty (empty control plasmid), Hu5-empty (empty control plasmid) are negative control, gather in the crops after 24h
Cell conditioned medium, by the table of Non Western blot method detection Cetuximab destination protein total length
Reach, detect Cetuximab heavy chain, the expression of light chain by reduced form Western blot method.Wherein,
Detection antibody is that HRP labelling mouse-anti human IgG1 (H+L) two resists.
7, detection Cetuximab Expression in Vivo and in Vitro amount
By being in the MRC 5 of exponential phase, HEK 293 cell is laid in 6 orifice plates, 37 DEG C, 5%CO2
Cultivate 24h, when cell density length to 80%, respectively with 1010vp、109Vp/ hole recombinant adenovirus
AdC68-CTB, Hu5-CTB infect MRC 5, with 108vp、107Vp/ hole recombinant adenovirus infects HEK
293 cells, collected cell conditioned medium at 3 days, 5 days respectively.With 1010vp、109vp、108vp、107vp/
Hole zero load adenovirus AdC68-empty, Hu5-empty are negative control.
Use the Balb/c nude mice of 5-6 week old, mice is randomly divided into 4 groups: AdC68-CTB, Hu5-CTB,
AdC68-empty and Hu5-empty, often 6 mices of group.Often group is with 5 × 1010Vp/100ul recombinant adenovirus
Poison single intramuscular injection, antibody expression in taking periodic blood detection bodies.
The expression of indirect ELISA detection albumen: use 50ng goat-anti people lgG Kappa 50ul/ hole, 4 DEG C
Overnight bag elisa plate, 2h closed by 50ul/ hole 5% skim milk 37 DEG C, by cell conditioned medium dilution 10 times,
Serum-dilution 400 times, with 50ul/ hole, hatches 2h for 4 DEG C.The mouse-anti people lgG Fc bis-of HRP labelling resists 1:
10000 dilution 50ul/ holes, hatch 1h for 37 DEG C.Wherein, with business-like Cetuximab with every hole 10ng
For initial amount, 2 times of gradient dilutions draw standard curve.
8, Cetuximab binding specificity expressed by detection recombinant adenovirus
HCEpi C、NCI-H 508(EGFR+) and CHO (EGFR-) cell is laid in 24 orifice plates, 37 DEG C,
5%CO2After cultivating 24h, by cell with after PBS 3 times, fix 5 minutes with 4% paraformaldehyde.
Cell first closes 2h through 5% defatted milk powder 37 DEG C, the most respectively with the Mouse Blood through recombinant adenovirus immunity
Cleer and peaceful commercialization Cetuximab 4 DEG C hatches 2h, then resists 37 DEG C with the goat-anti people lgG bis-of FITC labelling
Hatching after 1h, TBST wash three times, DAPI dyes 5min, finally at fluorescence microscopy Microscopic observation.
9, the affinity of Cetuximab expressed by detection recombinant adenovirus
With 60ng EGFR 50ul/ hole bag elisa plate 4 DEG C overnight, after 2h closed by 5% skim milk, will
Recombinant adenovirus expression monoclonal antibody and commercialization Cetuximab are with every hole 80ng as initial amount, and 2 times of gradients are dilute
Releasing 11 gradients, i.e. every hole is diluted to 0.078125ng, 50ul/ hole, hatch 2h for 4 DEG C.HRP is marked
The mouse-anti people two anti-1:10000 dilution of note, 50ul/ hole, after 37 DEG C hatch 1h, every hole adds TMB
Nitrite ion 50 μ l, lucifuge colour developing 5min, notice that color changes, it is to avoid colour developing excessively, adds 50 μ l in time
Stop buffer.Microplate reader detection OD450 numerical value.
10, the detection recombinant adenovirus impact on the propagation of colon cancer cell
Propagation with MTT (3-(4,5-dimethylthiazole-2)-2,5-diphenyltetrazolium bromide bromide) detection cell
Ability: collect DiFi and the NCI-H508 cell of exponential phase, by 1 × 104/ hole, is laid on 96 orifice plates
In, the often multiple hole of group 6,24h postoperative infection 109、108、107The recombinant adenovirus AdC68-CTB in vp/ hole,
Hu5-CTB, does negative control with AdC68-empty, Hu5-empty of same dose, 37 DEG C, 5%CO2
Adding 20ul, the MTT in hole after cultivating 72h, abandon supernatant after cellar culture 4h, every hole adds 150ul
DMSO, shakes 10min, and microplate reader detects OD490 numerical value, with the time as abscissa, OD490 value
For vertical coordinate, draw cell proliferation block diagram.
11, the nude mouse tumor model assessment recombinant adenovirus inhibitory action to colon cancer
Take the logarithm DiFi, NCI-H508 cell of trophophase, resuspended with Martixgel, by 1 × 10 after counting7
Individual cell/100ul is injected on the right side of nude mice hind leg subcutaneous, constant temperature, ventilation, kept under sterile conditions.Work as shifting
Plant when tumor grows to a certain size that (early treatment of NCI-H508 cell tumor model organizes size and reaches 150
cm3, treatment of late stage group reaches 600cm3；The early treatment of DiFi cell tumor model organizes size and reaches 80
cm3, treatment of late stage group reaches 300cm3), mice is randomly divided into 5 groups: AdC68-CTB, Hu5-CTB,
Erbitux (commercially produced product, purchased from Merck), AdC68-empty, Hu5-empty are wherein, negative right
According to group often 6 mices of group, residue often 10 mices of group.Often group is with 5 × 1010Vp/100ul recombinant adenovirus
Single intramuscular injection, Erbitux group is with the Erbitux biweekly lumbar injection of every 20mg/kg.Start
After treatment, within every 3 days, measure tumor sizes and body weight, with " the path of maximum diameter ×2× 0.5 " formula meter
Calculate gross tumor volume.
Observe to 21 days, euthanasia mice, take tumor body specimen, fix with 4% paraformaldehyde, paraffin bag
Bury, the expression of SABC detection Ki-67, p-EGFR.
II. embodiment
Embodiment 1, the structure of recombinant adenovirus plasmid and qualification
Cetuximab is that a people Mus is fitted together to anti-egfr antibodies, is used for treating colorectal cancer, incidence squama
The monoclonal antibody of the cancers such as shape cell carcinoma.The present invention builds AdC68-△ E1/E3, Hu5-△ E1/E3 table
Reaching total length Cetuximab gene, as a example by colorectal cancer animal model, examination recombinant adenovirus is expressed
The effect of Cetuximab monoclonal antibody treatment tumor.
Connect with F2A between the weight of signal peptide (HLA-A*0201 signal peptide), light chain as it is shown in figure 1, carry,
Total length monoclonal antibody, after Avr II and Cla I double digestion, is connected to carry CASI promoter and SV40polyA
Shuttle vector pUC57 on, build obtain shuttle plasmid pUC57-CASI-CTB.
PUC57-CASI-CTB, pAdC68-△ E1/E3 or pHu5-△ E1/E3 is through PI-Sce I and I-Ceu I
After double digestion and connection, obtain pAdC68-CTB or pHu5-CTB.
The recombinant adenovirus plasmid pAdC68-CTB Bgl II that obtains, Xho I, Mfe I enzyme action are identified point
Analysis, pHu5-CTB Bgl II, Hind III, Kpn I enzyme action identification and analysis, see Fig. 2, with cleavage map
Spectrum clip size is analyzed identical, it was demonstrated that recombinant adenovirus plasmid builds correct.
Embodiment 2, the acquisition of recombinant adenovirus and qualification
Recombinant adenovirus plasmid pAdC68-CTB, pHu5-CTB, after Pac I linearisation, use
LipofectatimeTM 2000 proceeds to, in HEK 293 cell, 8-12 days to be cultivated, to be there is plaque, treats
Cell rounding, suspend after collect cell, multigelation three times after take viral supernatants and infect HEK 293 cell
(25cm2Tissue Culture Flask).Repeat above step to collecting appropriate virus (about 27-30 150cm2Cell
Culture bottle), utilize cesium chloride density gradient centrifugation purification of adenoviral AdC68-CTB, recombinant adenovirus
Hu5-CTB preparation method is ibid.Finally, the present inventor obtains recombinant adenovirus AdC68-CTB concentration and is
8.5×1012Vp/ml, Hu5-CTB concentration is 4.2 × 1012vp/ml。
Extract adenoviral gene group AdC68-CTB, and carry out Bgl II, Xho I, Mfe I restriction enzyme mapping divide
Analysis, is shown in Fig. 3 A.Extract viral genome Hu5-CTB, and carry out Bgl II, Hind III, Kpn I enzyme action
Atlas analysis, is shown in Fig. 3 B, correct with trace analysis display endonuclease bamhi.
Embodiment 3, Western blot detection recombinant adenovirus expresses Cetuximab monoclonal antibody
1010Vp/ hole recombinant adenovirus AdC68-CTB, Hu5-CTB infect HEK 293 cell, with
1010AdC68-empty, Hu5-empty are negative control in vp/ hole, collect cell conditioned medium after 24h.Pass through
The expression of Non Western blot method detection Cetuximab destination protein total length, with business-like
Erbitux is positive control, sees Fig. 4 A, it can be seen that AdC68-CTB, Hu5-CTB and Erbitux
Between 170kb and 130kd, there are a specific band, the i.e. destination protein of 152kd, and feminine gender is right
According to organize then without.
Cetuximab heavy chain, the expression of light chain is detected, with business by reduced form Western blot method
The Erbitux changed is positive control, sees Fig. 4 B, it can be seen that be respectively arranged with one near 55kd and near 25kd
The heavy chain of specific band, i.e. destination protein and light chain, it was demonstrated that the present inventor have successfully been obtained correct purpose
Albumen.
Embodiment 4, ELISA detect Cetuximab expression in vivo and in vitro
With 1010vp、109Vp/ hole recombinant adenovirus AdC68-CTB, Hu5-CTB infect MRC 5, with
108vp、107Vp/ hole recombinant adenovirus infects HEK 293 cell, collects cell at 3 days, 5 days respectively
Supernatant.With 1010vp、109vp、108vp、107The zero load of vp/ hole adenovirus AdC68-empty, Hu5-empty
For negative control.
Detect the expression of monoclonal antibody in each cell line by indirect ELISA, draw mark with commercialization Erbitux
Directrix curve.Vivoexpression is shown in Fig. 5.Figure as upper in Fig. 5, in non-replicating cells system MRC 5, the 3rd
It time, low dosage AdC68-CTB expression reaches 368.8ng/ml, and high dose is 598.9ng/ml；Low
Dosage Hu5-CTB expresses hardly, and high dose is 648.1ng/ml；When the 5th day, AdC68-CTB
High dose group and low dose group expression are almost suitable, respectively 792.9ng/ml, 784.5ng/ml,
Hu5-CTB high dose and low dose group are respectively 382.4ng/ml, 760.1ng/ml.
Such as Fig. 5 figure below, in replication form cell line HEK 293, when the 3rd day, low dosage AdC68-CTB
Expression reaches 945.3ng/ml, and high dose is 1803.9ng/ml；Low dosage Hu5-CTB is 121.58,
High dose is 1925.2ng/ml；When the 5th day, AdC68-CTB high dose group was expressed with low dose group
Amount is almost suitable, respectively 2448.5ng/ml, 2378.3ng/ml, Hu5-CTB high dose and low dosage
Group is respectively 2334.1ng/ml, 2715.4ng/ml.
Cetuximab binding specificity expressed by embodiment 5, indirect immunofluorescene assay recombinant adenovirus
The Cetuximab that AdC68-CTB, Hu5-CTB express is the monoclonal antibody of a kind of anti-EGFR, it is possible to
The EGFR of specific recognition cell surface expression.
As shown in Figure 6, at EGFR+HCEpi C, NCI-H 508 cell surface is it can be seen that the strongest
FITC fluorescence signal, the antibody that this explanation is expressed can be combined with the EGFR of cell surface.EGFR-'s
Fluorescence signal is not observed on Chinese hamster ovary celI surface, and this explanation is owing to lacking the expression of EGFR, Cetuximab
Can not be combined with Chinese hamster ovary celI.And business-like Erbitux is at EGFR+Cell surface have identical
FITC fluorescence signal intensity, this explanation, the monoclonal antibody that recombinant adenovirus is expressed has phase with business-like monoclonal antibody
Same activity.
The affinity of Cetuximab expressed by embodiment 6, indirect ELISA detection recombinant adenovirus
The EC of recombinant adenovirus and commercialization Erbitux is calculated by Binding ELISA50Value, thus compare
Relatively its affinity.
As it is shown in fig. 7, the monoclonal antibody EC50 value that AdC68-CTB, Hu5-CTB express is respectively 0.250
With 0.272, and the EC of commercialization Erbitux50Value is 0.264, not significant difference, display restructuring
The monoclonal antibody of gland virus expression does not has difference with the affinity of the combination EGFR of commercialization monoclonal antibody.
Embodiment 7, MTT detect the recombinant adenovirus impact on the propagation of colon cancer cell
The life of colorectal cancer cell can be suppressed in order to assess recombinant adenovirus AdC68-CTB, Hu5-CTB
Long, the present inventor have evaluated its impact on colorectal cancer cell propagation by MTT experiment.
Result shows, 109、108、107AdC68-CTB, Hu5-CTB can significance suppression DiFi,
The propagation of NCI-H 508 cell, is shown in Fig. 8, it was demonstrated that recombinant adenovirus expresses monoclonal antibody in vitro to colorectal cancer
The propagation of cell has significant inhibitory action.
Embodiment 8, the nude mouse tumor model assessment recombinant adenovirus inhibitory action to colon cancer
The inhibitory action of tumor cell proliferation is verified by recombinant adenovirus at cellular level, the present inventor
Carried out the early and late treatment of tumor by nude mouse tumor model, inquire into recombinant adenovirus further at body
The interior inhibitory action to colorectal cancer.In treatment group in early days, DiFi tumor model and NCI-H508 swell
In tumor model AdC68-CTB, Hu5-CTB and Erbitux group can significance suppression tumor growth,
See Fig. 9 A.
Wherein, in DiFi tumor model, AdC68-CTB group through treatment after 15 days, in 10 mices
Existing 6 cases of complete remission；Hu5-CTB group is after 9 days treat, and in 10 mices, existing 5 are swollen
Tumor is wholly absent.In NCI-H508 tumor model treatment of late stage group, after treating 21 days, AdC68-CTB,
Hu5-CTB and Erbitux group can significance suppression tumor growth, see Fig. 9 B.Meanwhile, Mice Body
Heavily there is no significance to decline, mice sign is normal, illustrates that adenovirus and Cetuximab monoclonal antibody can't be to little
Mus produces harmful effect.Contrast early treatment's group and treatment of late stage group, the effect of early treatment's group is the most excellent
In treatment of late stage group, so early treatment is readily available preferable curative effect.
Taking tumor tissues and do SABC, the expression of detection propagation specific proteins Ki-67, such as Figure 10 institute
Show, treatment group AdC68-CTB, Hu5-CTB with Erbitux compared with matched group, Ki-67 protein expression
Significantly reduce.
Discuss
Cetuximab as first global multiple countries be approved listing, be widely used in colorectal cancer,
The monoclonal antibody of the cancers such as squamous cell carcinoma of the head and neck, has been proved to good curative effect.The present inventor enters one
Walking successfully to demonstrate expresses after total length Cetuximab is administered by single intramuscular injection with recombinant adenovirus,
The colorectal cancer model of nude mice has good cancer resistant effect.
When it is generally acknowledged by engineered method expression biomacromolecule, it is difficult to ensure that its biological activity,
Thus producing a problem: the present inventor applies adenovirus vector to express monoclonal antibody for gene therapy
The most effective.The result of study of the present inventor shows, the gene therapy method of gland virus expression antibody is complete
Feasible.First, monoclonal antibody and the business of gland virus expression has been inventors demonstrated that by indirect immunofluorescence experiment
Industry monoclonal antibody is similar, all has specific affinity interaction with the EGFR of cell surface；Then, the present invention
By Binding ELISA, people finds that the monoclonal antibody of gland virus expression has similar to commercialization monoclonal antibody further
EC50Value, it was demonstrated that it has identical affinity with commercialization monoclonal antibody to EGFR.Meanwhile, external right
Inhibition test and the internal Inhibition test to nude mouse tumor of colorectal cancer cell propagation all show, inside and outside
The total length monoclonal antibody of gland virus expression all has biological activity.Any of the above experiment proves recombinant adenoviral vector
Expressing Cetuximab monoclonal antibody and have high expressed usefulness, the monoclonal antibody of expression has the biological activity of height, swollen
In tumor animal model, recombinant adenovirus can substantially suppress tumor growth, even up to curative effect.
The most clinically the most at present, the using dosage of Cetuximab monoclonal antibody be one week infusion once, initial dose
Being 400mg every square metre body surface area, dosage the most weekly is 250mg every square metre body surface area,
Using dosage is big and frequently [17].Meanwhile, the preparation of monoclonal antibody, purge process are loaded down with trivial details, it is desirable to strict,
Cause the expensive of monoclonal antibody, make the patient benefiting from this monoclonal antibody be extremely restricted when accepting treatment.
Due to adenovirus prepare, the feature such as purification is simple, yield is high, safety is good, heterogenous expression time length,
Therefore the gland virus expression Cetuximab monoclonal antibody low cost of the present inventor's research and development, good effect, can be the most satisfied
Clinical disease Man's Demands.It addition, it is a kind of that the present inventor is cloned in the Cetuximab monoclonal antibody of adenovirus vector
The albumen that can secrete, therefore, the present inventor in addition to recombinant adenovirus can being directly used in injection for curing,
The monoclonal antibody of the Cetuximab of high concentration is gathered in the crops, then with pure after recombinant adenovirus can also be infected suitable cell
The monoclonal antibody changed is applied to oncotherapy or other clinical and scientific research.To sum up, the restructuring gland of the present inventor's research and development
Viral vector is expressed the treatment that Cetuximab monoclonal antibody is clinically relevant tumor and is provided a kind of effective with research
New tool, and there is huge market development prospect.
The all documents mentioned in the present invention are incorporated as reference the most in this application, just as each literary composition
Offer and be individually recited as with reference to like that.In addition, it is to be understood that reading the above-mentioned teachings of the present invention
Afterwards, the present invention can be made various changes or modifications by those skilled in the art, and these equivalent form of values are same
Fall within the application appended claims limited range.
Claims (21)
1. the method expressing the western appropriate former times monoclonal antibody of total length, it is characterised in that described method includes:
The application western appropriate former times monoclonal antibody of gland virus expression total length.
2. the method for claim 1, it is characterised in that formed described by adenovirus vector
Adenovirus, comprises the element expressing western appropriate former times monoclonal antibody in described adenovirus vector.
3. method as claimed in claim 2, it is characterised in that the adenovirus forming described adenovirus carries
People's Hu5 carrier of vaccine carrier for chimpanzee type AdC68 carrier that body lacks using E1 and E3 or E1 and E3 disappearance as
Skeleton carrier.
4. method as claimed in claim 2 or claim 3, it is characterised in that the western appropriate former times monoclonal of described expression
The element of antibody includes successively: promoter, signalase 11 coded sequence, western appropriate former times monoclonal antibody heavy
Coded sequence, catenation sequence, signal peptide 2 coded sequence, western appropriate former times monoclonal antibody light chain encoding sequences,
Terminator.
5. method as claimed in claim 4, it is characterised in that described promoter includes: CASI
Promoter, CMV promoter；Preferably CASI promoter；Or
Described terminator includes: SV40 PloyA, BGH PloyA；Preferably SV40 PloyA.
6. method as claimed in claim 4, it is characterised in that described signalase 11 or signal peptide 2
It it is secreting signal peptide；It is preferably comprised: HLA-A*0201 signal peptide；It is preferred that described signalase 11
Identical or different with signal peptide 2.
7. method as claimed in claim 4, it is characterised in that described catenation sequence includes: F2A,
2A, IRES；Preferably F2A.
8. method as claimed in claim 4, it is characterised in that described western appropriate former times monoclonal anti body weight
The western appropriate former times monoclonal antibody that chain coding sequence is as shown in 1-1356 position in SEQ ID NO:1 or described
Light chain encoding sequences is as shown in SEQ ID NO:1 1357-1998 position.
9. method as claimed in claim 4, it is characterised in that the adenovirus vector described in formation is with E1
The vaccine carrier for chimpanzee type AdC68 carrier lacked with E3 or people's AdHu5 carrier are as skeleton carrier, described table
The element of darcy monoclonal antibody of appropriate former times is inserted in this carrier the E1 region being deleted.
10. an adenovirus expression carrier, it is characterised in that the chimpanzee that this carrier lacks with E1 and E3
Type AdC68 carrier or people's AdHu5 carrier are as skeleton carrier；And include that following expression western appropriate former times single successively
The element of clonal antibody: promoter, signalase 11 coded sequence, western appropriate former times monoclonal antibody heavy encodes
Sequence, catenation sequence, signal peptide 2 coded sequence, western appropriate former times monoclonal antibody light chain encoding sequences, eventually
Only son.
11. adenovirus expression carriers as claimed in claim 10, it is characterised in that described expression is western appropriate
The element of former times monoclonal antibody is inserted in this carrier the E1 region being deleted.
12. adenovirus expression carriers as claimed in claim 10, it is characterised in that described promoter
Including: CASI promoter, CMV promoter；Preferably CASI promoter；Or
Described terminator includes: SV40 PloyA.
13. adenovirus expression carriers as claimed in claim 10, it is characterised in that described signal peptide
1 or signal peptide 2 be secreting signal peptide；It is preferably comprised: HLA-A*0201 signal peptide；It is preferred that institute
Signalase 11 and the signal peptide 2 stated are identical or different.
14. adenovirus expression carriers as claimed in claim 10, it is characterised in that described connection sequence
Row include: F2A, 2A, IRES；Preferably F2A.
15. adenovirus expression carriers as claimed in claim 10, it is characterised in that described western appropriate former times
As shown in 1-1356 position in SEQ ID NO:1 or described western appropriate of monoclonal antibody heavy coded sequence
Former times monoclonal antibody light chain encoding sequences is as shown in SEQ ID NO:1 1357-1998 position.
16. adenovirus expression carriers as claimed in claim 10, it is characterised in that lack with E1 and E3
When the vaccine carrier for chimpanzee type AdC68 carrier lost is as skeleton carrier, the core of described gland virus expression Cetuximab
Nucleotide sequence is as shown in SEQ ID NO:3；Or
Using E1 and E3 disappearance people's pHu5 carrier as skeleton carrier time, described gland virus expression western appropriate former times
The nucleotide sequence of monoclonal antibody is as shown in SEQ ID NO:4.
The purposes of the arbitrary described adenovirus expression carrier of 17. claim 10-16, is used for preparing adenovirus,
Described adenovirus can express the western appropriate former times monoclonal antibody of total length.
18. 1 kinds of adenoviruss, it is characterised in that described adenovirus is arbitrary described by claim 10-16
Adenovirus expression carrier is prepared from.
The purposes of the adenovirus described in 19. claim 18, is used for preparing antitumor drug.
20. 1 kinds of antitumor drug, it is characterised in that described antitumor drug includes: claim 18
Described adenovirus, and pharmaceutically acceptable carrier.
21. 1 kinds for expressing the test kit of the western appropriate former times monoclonal antibody of total length, it is characterised in that described
Test kit includes: the arbitrary described adenovirus expression carrier of claim 10-16, or claim 18
Described adenovirus；Or the antitumor drug described in claim 19.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510308359.XA CN106282232B (en) | 2015-06-05 | 2015-06-05 | A method of tumour is treated based on adenovirus vector expression overall length Cetuximab |
| PCT/CN2016/084223 WO2016192621A1 (en) | 2015-06-05 | 2016-06-01 | Tumor treatment method using full-length cetuximab expressed based on adenovirus carrier |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510308359.XA CN106282232B (en) | 2015-06-05 | 2015-06-05 | A method of tumour is treated based on adenovirus vector expression overall length Cetuximab |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106282232A true CN106282232A (en) | 2017-01-04 |
| CN106282232B CN106282232B (en) | 2019-09-17 |
Family
ID=57440052
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510308359.XA Expired - Fee Related CN106282232B (en) | 2015-06-05 | 2015-06-05 | A method of tumour is treated based on adenovirus vector expression overall length Cetuximab |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN106282232B (en) |
| WO (1) | WO2016192621A1 (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2019114461A1 (en) * | 2017-12-12 | 2019-06-20 | 中国科学院微生物研究所 | Chimpanzee adenovirus vector-based zika virus vaccine and preparation method therefor |
| CN112552380A (en) * | 2020-12-10 | 2021-03-26 | 武汉博沃生物科技有限公司 | Immunogen of SARS-CoV-2 virus and its application |
| CN112831524A (en) * | 2021-02-20 | 2021-05-25 | 苏州相奕生物技术有限公司 | Artificially modified recombinant adenovirus vector, virus packaged by same and application thereof |
| CN114438128A (en) * | 2020-10-30 | 2022-05-06 | 上海市公共卫生临床中心 | Enhanced oncolytic adenovirus and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007134325A2 (en) * | 2006-05-15 | 2007-11-22 | Introgen Therapeutics, Inc. | Methods and compositions for protein production using adenoviral vectors |
| CN103937835A (en) * | 2013-08-19 | 2014-07-23 | 中国科学院上海巴斯德研究所 | Expression vector based on adenovirus AdC68 and construction method thereof |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1632109A (en) * | 2003-12-24 | 2005-06-29 | 钱其军 | Highly expressed recombinant gutted adenovirus containing human constant region whole antibody gene and its use |
| CN103221544A (en) * | 2010-09-24 | 2013-07-24 | 昂克斯治疗有限公司 | Oncolytic adenoviral vectors coding for monoclonal anti-CTLA-4 antibodies |
| CN102690842B (en) * | 2012-06-12 | 2014-04-23 | 北京工业大学 | Recombinant adenovirus (rAdv) vector for expressing human antibody whole genome and method thereof |
-
2015
- 2015-06-05 CN CN201510308359.XA patent/CN106282232B/en not_active Expired - Fee Related
-
2016
- 2016-06-01 WO PCT/CN2016/084223 patent/WO2016192621A1/en active Application Filing
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007134325A2 (en) * | 2006-05-15 | 2007-11-22 | Introgen Therapeutics, Inc. | Methods and compositions for protein production using adenoviral vectors |
| CN103937835A (en) * | 2013-08-19 | 2014-07-23 | 中国科学院上海巴斯德研究所 | Expression vector based on adenovirus AdC68 and construction method thereof |
Non-Patent Citations (1)
| Title |
|---|
| 刘海平: "非增殖性腺病毒携带全长抗体Cetuximab的肿瘤基因治疗的研究", 《中国优秀硕士学位论文全文数据库——医药卫生科技辑》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2019114461A1 (en) * | 2017-12-12 | 2019-06-20 | 中国科学院微生物研究所 | Chimpanzee adenovirus vector-based zika virus vaccine and preparation method therefor |
| CN114438128A (en) * | 2020-10-30 | 2022-05-06 | 上海市公共卫生临床中心 | Enhanced oncolytic adenovirus and application thereof |
| CN112552380A (en) * | 2020-12-10 | 2021-03-26 | 武汉博沃生物科技有限公司 | Immunogen of SARS-CoV-2 virus and its application |
| CN112831524A (en) * | 2021-02-20 | 2021-05-25 | 苏州相奕生物技术有限公司 | Artificially modified recombinant adenovirus vector, virus packaged by same and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2016192621A1 (en) | 2016-12-08 |
| CN106282232B (en) | 2019-09-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US10328136B2 (en) | Identification of mutations in herpes simplex virus envelope glycoproteins that enable or enhance vector retargeting to novel non-HSV receptors | |
| US7429481B2 (en) | Targeting viruses using a modified sindbis glycoprotein | |
| CN109862912A (en) | Carry the adenovirus of bispecific T cell adapter (BiTE) | |
| CN107208069A (en) | Oncolytic virus for expressing immunologic test point regulatory factor | |
| CN102633883B (en) | Fusion protein efficiently combined with epidermal growth factor receptor (EGFR), herstatin 2 (HER2) and vascular endothelial growth factor (VEGF), coded sequence and application of fusion protein | |
| US20180169271A1 (en) | Armed replication-competent oncolytic adenoviruses | |
| HU230364B1 (en) | Simian adeniovirus nucleic acid and amino acid sequences, vectors containing same, and methods of use | |
| JP2021527694A (en) | Treatment with oncolytic virus | |
| CN106282232A (en) | A kind of method expressing total length Cetuximab treatment tumor based on adenovirus vector | |
| CN109554353A (en) | Isolated recombination oncolytic poxvirus, pharmaceutical composition and its purposes in the drug for the treatment of tumour and/or cancer | |
| Zhang et al. | Vaccinia virus-based vector against infectious diseases and tumors | |
| Liu et al. | Oncolytic herpes simplex virus tumor targeting and neutralization escape by engineering viral envelope glycoproteins | |
| CN108220251B (en) | Recombinant infectious pustulosis virus, and preparation method and application thereof | |
| KR102405246B1 (en) | Recombinant Herpes Simplex Virus Having Expression Cassette Expressing Fused Protein of Cancer Cell-Targeting Domain and Extracellular Damain of HVEM and Use Thereof | |
| CN108624607A (en) | Target the Chimeric antigen receptor of mesothelin and method and purposes to its dual modification | |
| CN108624608A (en) | Target the preparation method and purposes of the forth generation Chimeric antigen receptor of mesothelin | |
| CA3101993A1 (en) | Antigenically stealthed oncolytic viruses | |
| CN105924523A (en) | Anti-c-Met single chain variable fragment and application thereof | |
| CN105879060A (en) | Tumor DNA vaccines and virus vector vaccines with fibroblast activation protein alpha as target | |
| KR102418528B1 (en) | Recombinant Herpes Simplex Virus Containing Expression Cassette Expressing a Fused Protein of Tumor Cell-targeting Domain and Extracellular Damain of HVEM and Use of the Same | |
| CN103882057B (en) | Carry structure and the application thereof of p21ras single-chain antibody gene tomour specific adenoviral vectors | |
| CN112996909B (en) | Oncolytic viruses expressing PD-1 binding proteins and uses thereof | |
| CN113832115A (en) | Fusion gene RIL-7 combined CCL19 recombinant oncolytic vaccinia virus and application thereof in preparation of antitumor drugs | |
| CN108728458A (en) | Target the Chimeric antigen receptor of mesothelin and the method and purposes of Combined expression IL-15 | |
| CN1517437B (en) | Vaccine for specificity treating tumour or endocellular infection and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20190917 Termination date: 20200605 |