CN106243208A - A kind of Oryza sativa L. uneven class sizes gene and the protein of coding thereof - Google Patents
A kind of Oryza sativa L. uneven class sizes gene and the protein of coding thereof Download PDFInfo
- Publication number
- CN106243208A CN106243208A CN201610790516.XA CN201610790516A CN106243208A CN 106243208 A CN106243208 A CN 106243208A CN 201610790516 A CN201610790516 A CN 201610790516A CN 106243208 A CN106243208 A CN 106243208A
- Authority
- CN
- China
- Prior art keywords
- gene
- protein
- rice
- seq
- class sizes
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
- C12N15/8281—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for bacterial resistance
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- Wood Science & Technology (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Botany (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Plant Pathology (AREA)
- Gastroenterology & Hepatology (AREA)
- Microbiology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicinal Chemistry (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a kind of protein controlling Oryza sativa L. uneven class sizes character, this protein is made up of the aminoacid sequence shown in SEQ ID NO.2 or its derived sequence in sequence table.The invention also discloses the gene encoding this protein, be made up of the nucleotide sequence shown in SEQ ID NO.1 in sequence table.The water resistant bacterial blight of rice of uneven class sizes gene of the present invention is effective, can be used for improving the bacterial blight-resisting of long-grained nonglutinous rice, and the bacterial blight-resisting breeding for long-grained nonglutinous rice provides a new approach；Secondly, the present invention uses gene knockout new technique, have successfully been obtained the uneven class sizes material under japonica rice background, it is provided that utilize the new method of the japonica rice variety of this gene cultivation bacterial blight-resisting.Additionally, gene of the present invention is identified by single recessive gene control, transgenic or filial generation and selects fairly simple, it is simple to application.
Description
Technical field
The invention belongs to paddy gene engineering field, be specifically related to a kind of Oryza sativa L. uneven class sizes gene, and this gene code
Protein.
Background technology
Plant pathological changes refer to plant not coerced by any apparent adversity, physical hazard or pathogen encroach on
In the case of, plant spontaneously forms and is similar to the phenomenon of the ecthyma gangrenosa of generation after certain pathogen infects.Many uneven class sizes sudden changes
Body all shows the enhancing to pathogen resistance before uneven class sizes is formed or after being formed.Can stable hereditary Oryza sativa L. class disease
Speckle mutant all meets the mendelian inheritance of classics, it has been reported nearly 200 parts of lesion mimic, its uneven class sizes in Oryza sativa L.
Character major part is by recessive monokaryon Gene Handling.Have 10 genes controlling uneven class sizes character at present to be cloned, mainly compile
The SPL5 of code splicing factor 3b subunit, coding E3 ubiquitin ligase SPL11 etc. (Sun Huimin etc. Shanghai Agricultural journal .2014
3rd phase).The disease resistance height of Oryza sativa L. is directly related with the blood relationship background of parent material, the big multi-source of uneven class sizes gene cloned
In japonica rice background, and long-grained nonglutinous rice rarely has report, which also limits uneven class sizes material in the application improved in long-grained nonglutinous rice disease resistance.
Summary of the invention
The present inventor, when extensive to rice variety another name for Sichuan Province 498 carry out EMS (ethylmethane sulfonate) mutation, has been surprisingly found that a Xian
The lesion mimics material a344 of rice background, through research this Oryza sativa L. uneven class sizes character of discovery by single recessive gene control, and
And further study show that, the Oryza sativa L. resistance to bacterial leaf-blight can be significantly improved after this gene generation point mutation.The present invention be
Above-mentioned have been surprisingly found that on the basis of complete.
Present invention aim at providing a kind of protein controlling Oryza sativa L. uneven class sizes character.
Another object of the present invention is to provide the gene encoding above-mentioned protein.This gene can improve Oryza sativa L. to bacterial leaf-blight
Resistance.
The present invention the 3rd purpose is to provide the expression vector containing said gene.
The present invention the 4th purpose is the purposes providing said gene improving on rice bacterial blight resistance.
The method that the present invention the 5th purpose is to provide the rice varieties utilizing said gene cultivation bacterial blight-resisting.
For achieving the above object, technical scheme is as follows:
The invention provides a kind of protein controlling Oryza sativa L. uneven class sizes character, named A344, be following (1) or (2):
(1) protein being made up of the aminoacid sequence shown in SEQ ID NO.2 in sequence table；
(2) aminoacid sequence shown in SEQ ID N0.2 in sequence table is added through one or several aminoacid, replaces
Or lack and derivative and relevant to controlling Oryza sativa L. uneven class sizes character protein.
Present invention also offers the gene encoding above-mentioned protein, named A344, be following (a) or (b):
A () is made up of the nucleotide sequence shown in SEQ ID NO.1 in sequence table；
B nucleotide sequence that () and SEQ ID NO.1 in sequence table limit has the homology of at least 90%, and coding tool
There is the nucleotide sequence controlling Oryza sativa L. uneven class sizes character-related protein matter function；
(c) in sequence table SEQ ID NO.1 limit nucleotide sequence in one or several nucleotide through interpolation,
Replace or disappearance and derivative and coding has the nucleotide sequence controlling Oryza sativa L. uneven class sizes character-related protein matter function.
Present invention also offers the expression vector containing said gene.
Described expression vector refers to plasmid, host cell or plant expression vector.
Described host cell is Bacillus coli cells, agrobatcerium cell or plant cell；
Present invention also offers said gene in the application improved on rice bacterial blight resistance.
The method utilizing said gene to cultivate bacterial blight-resisting rice varieties, is transformed into said gene in rice varieties.
The present invention has the advantage that or beneficial effect: the water resistant bacterial blight of rice effect of (1), uneven class sizes gene of the present invention
Good, and the gene of the lesion mimics that relates to and clone derives from long-grained nonglutinous rice, can be used for improving the bacterial blight-resisting of long-grained nonglutinous rice, for
The bacterial blight-resisting breeding of long-grained nonglutinous rice provides a new approach；(2), the present invention use gene knockout new technique, be successfully obtained
Uneven class sizes material under japonica rice background, it is provided that utilize this gene to cultivate the new method of japonica rice variety of bacterial blight-resisting.
(3), gene of the present invention is identified by single recessive gene control, transgenic or filial generation and selects fairly simple, it is simple to application.
Accompanying drawing explanation
Fig. 1, contrast photo for early tillering stage another name for Sichuan Province extensive 498 and mutant a344 plant phenotype；Wherein 1 is another name for Sichuan Province extensive 498；2 are
Mutant a344.
Fig. 2, early tillering stage another name for Sichuan Province extensive 498 and the young leaves of mutant a344 and Lao Ye phenotype contrast photo, wherein 1 is young leaves；2
For Lao Ye.
Resistance contrast photo after Fig. 3, another name for Sichuan Province extensive 498 and mutant a344 inoculation P2: wherein 1 is IR24；2 is IRBB21；3
For another name for Sichuan Province extensive 498；4 is mutant a344.
Resistance contrast photo after Fig. 4, another name for Sichuan Province extensive 498 and mutant a344 inoculation J3: wherein 1 is IR24；2 is IRBB21；3
For another name for Sichuan Province extensive 498；4 is mutant a344.
Resistance contrast photo after Fig. 5, another name for Sichuan Province extensive 498 and mutant a344 inoculation 8248: wherein 1 is IR24；2 are
IRBB21；3 is another name for Sichuan Province extensive 498；4 is mutant a344.
Resistance contrast photo after Fig. 6, another name for Sichuan Province extensive 498 and mutant a344 inoculation P7: wherein 1 is IR24；2 is IRBB21；3
For another name for Sichuan Province extensive 498；4 is mutant a344.
Resistance contrast photo after Fig. 7, another name for Sichuan Province extensive 498 and mutant a344 inoculation PXO99: wherein 1 is IR24；2 are
IRBB21；3 is another name for Sichuan Province extensive 498；4 is mutant a344.
Fig. 8, uneven class sizes candidate gene of the present invention finely position schematic diagram.
Electrophoresis pattern after the amplification of Fig. 9, primer I 7；Wherein 1 is flower B；2 is mutant a344；3 is exchange individual plant.
Electrophoresis pattern after the amplification of Figure 10, primer I 8；Wherein 1 is flower B；2 is mutant a344；3 is exchange individual plant.
Electrophoresis pattern after Figure 11, primer AA34 amplification；Wherein 1 is DNA Marker；2 is mutant a344.
Electrophoresis pattern after Figure 12, primer P1028 amplification；Wherein 1 is DNA Marker；2 convert for Positive E. coli
Son.
Electrophoresis pattern after Figure 13, primer P1092 amplification；Wherein 1 is DNA Marker；2 is positive transgenic plant.
Figure 14, Crisper-A344 carrier schematic diagram.
Figure 15, turn Crisper-A344 and knock out the blade uneven class sizes phenotype contrast picture of positive plant: wherein 1 for negative right
According to；2 is Cas9-1；3 is Cas9-2；4 is Cas9-3；5 is Cas9-4.
Detailed description of the invention
Embodiment 1 lesion mimics of the present invention a344 separates and tests with genetic analysis
(1) test material
Lesion mimics a344, flower B and another name for Sichuan Province extensive 498 are both from Inst. of Paddy Rice, Sichuan Agriculture Univ.'s hybrid vigor profit
Use laboratory.Wherein lesion mimics a344 derives from EMS (ethylmethane sulfonate) mutation storehouse, warp constructed by another name for Sichuan Province extensive 498
Carrying out many for discovery after backcrossing at Wenjiang, Sichuan and Lingshui, Hainan with another name for Sichuan Province extensive 498, this uneven class sizes phenotype can stable heredity.
(2) test method
Lesion mimics a344, flower B and another name for Sichuan Province extensive 498 are all planted in experimental plot, Inst. of Paddy Rice, Sichuan Agriculture Univ. Wenjiang.
Mutant a344 is utilized to build F with flower B and mutant a344 respectively with another name for Sichuan Province extensive 4982Colony, adds up F1And F2The separation of colony
Ratio.
(1) uneven class sizes phenotype analytical: compared with in the of extensive with wild type another name for Sichuan Province 498, mutant a344 starts blade from tillering stage to be occurred
Necrotic spot (see Fig. 1), the most full exhibition young leaves on speckle spread to blade base by blade tip, the speckle on Lao Ye be then from
Blade base spreads (see Fig. 2) to blade tip.
(2) genetic analysis: utilize mutant a344 respectively extensive with another name for Sichuan Province 498 and flower B hybridization obtain F1, F1It is respectively provided with for plant
Normal leaf morphology and period of duration, F2Wild type in Dai and the segregation ratio (being shown in Table 1) of uneven class sizes phenotype, through X 2 test,
Meet the segregation ratio 3:1 of Mendel's single-gene recessive mutation, illustrate that the uneven class sizes phenotype of mutant a344 is by a pair recessive core
Gene Handling.
The genetic analysis result of the test of table 1 mutant a344
Note: X2 0.05,1=3.84
Embodiment 2 lesion mimics of the present invention a344 is to bacterial leaf-blight Resistance Identification contrast test
(1) test material
1, rice material
(1), mutant a344, another name for Sichuan Province extensive 498 derive from Inst. of Paddy Rice, Sichuan Agriculture Univ.'s heterosis utilization experiment
Room.
(2), high sense bacterial leaf-blight kind IR24 and high resistance to hoja blanca kind IRBB21 are both from Sichuan Agricultural University
The great disease research department of rice research.
2, the biological strain of rice leaf spot bacteria: J9,8248, P2, P6, J3 or J7, both from Sichuan Agricultural University
The great disease research department of rice research.
(2) test method
1, the cultivation of rice leaf spot bacteria
Take the rice leaf spot bacteria that glycerol preserves, spread upon equably on solid medium, be inverted light culture 4 days for 28 DEG C
Standby.Described solid culture based formulas (200ml): sucrose 2g, L-sodium 0.2g.Sucrose and L-sodium are mixed
After, it is adjusted to PH=7.0 with NaOH, adds peptone 2g, in 121 DEG C of sterilizings of sterilizing pressure cooker 20 minutes after mixing.After cooling
Change into flat board, 4 DEG C of storages.
2, inoculate and observe
Mutant a344, another name for Sichuan Province are extensive 498, high sense bacterial leaf-blight kind IR24 and high resistance to hoja blanca kind IRBB21 are all planted
Experimental plot, Inst. of Paddy Rice, Sichuan Agriculture Univ. Wenjiang.Take cultured bacterial leaf spot bacterium and be diluted with water to absorbance OD600 value and be
The suspension bacteria liquid of 1.0.The inoculation when of selecting summer high temperature at dusk and not rain after 3 hours, beneficially infection process and morbidity.Right
The plant being in tillering regularity uses leaf-cutting method inoculation, at bacterial leaf spot susceptible variety IR24, disease-resistant variety IRBB21, mutant
Randomly selecting 10 strain plant in a344 and another name for Sichuan Province extensive 498, each individual plant is chosen 3 full exhibition young leaves and is inoculated.With reference to Oryza sativa L. after 3 weeks
Bacterial leaf-blight mutual affection grade standard (being shown in Table 2), measure lesion area.
The bacterial leaf-blight mutual affection grade standard of table 2 Oryza sativa L.
| Sick level | Resistant reaction | Evaluation of resistance |
| 0 | Lesion area is less than 5.0% | High anti- |
| 1 | Lesion area accounts for leaf area 5.1-12.0% | Anti- |
| 3 | Lesion area accounts for leaf area 12.1-25.0% | In anti- |
| 5 | Lesion area accounts for leaf area 25.1-50.0% | Middle sense |
| 7 | Lesion area accounts for leaf area 50.1-75.0% | Sense |
| 9 | Lesion area is more than leaf area 75.1% | High sense |
Compared with the lesion area of result extensive with another name for Sichuan Province 498 (see Fig. 3 to Fig. 7), after mutant a344 is contaminated by 6 biological strains
Lesion area be all obviously reduced (being shown in Table 3), wherein the resistance to biological strain P6 and J7 reach high water resistant put down.
The 3 four kinds of materials of the table Resistant reaction result to bacterial blight of rice
Embodiment 3: the location test of mutant a344 candidate gene
Carry out as follows:
1. the location of candidate gene
(1) near isogene pond builds
Hybridize, with flower B, the F obtained from mutant a3442In colony, randomly select 30 parts of individual plant leaves having uneven class sizes phenotype
Sheet and 10 parts of normal single-strain blades, the blade mixed in equal amounts of every 10 strains is extracted DNA and is built pond, including 3 recessive ponds and 1 dominant pond
4 ponds are amounted to, the polymorphic detection between mutant a344 and flower 1 B gene group at interior.From a344 498 hybridization extensive with another name for Sichuan Province
The F obtained2In colony, randomly selecting 70 parts of single-strain blades having uneven class sizes phenotype, the blade mixed in equal amounts of every 10 strains extracts DNA
Building pond, 7 ponds are for the coseparation analysis in mutational site altogether.Leaf DNA uses modified Booth's arithmetic to extract.
(2) primer synthesis and gene mapping
First with the 543 pairs of SSR primers being evenly distributed on 12 chromosomes of Oryza sativa L., (particular sequence refers tohttp:// www.gramene.org/bd/markers), expanded by PCR, filter out mutant a344 and flower 1 B gene group between polymorphic
Property primer 98 is right；Subsequently with the polymorphism primer detection near isogene pond filtered out, and the F that mutant a344 builds with flower B2
In colony, recessive individual plant, carries out gene Primary Location；In the interval of just location, foundationhttp://www.gramene.org
Diversity sequence between the fine DNA sequence of 9311 and Japan that website is announced, design Indel primer I 7 and I8 (being shown in Table 4), electrophoretogram
Spectrum is shown in Fig. 9 and Figure 10, continues the F that detection near isogene pond and mutant a344 build with flower B2In colony, recessive individual plant, is carried out
Fine location；Finally, utilize AA34 primer (being shown in Table 4) that detection mutant a344, another name for Sichuan Province extensive 498 and both hybridization are obtained F2Group
7 recessive ponds in body, carry out the coseparation analysis (electrophoresis pattern is shown in Figure 11) in mutational site.
PCR primer used by the test of 4, table
| Primer | Front primer (5'-3') | Rear primer (5'-3') | Fragment length (bp) |
| I7 | CACTCCACCCAATCTCCT | CTTCTGTTCTACTTCTCTACCT | 110 |
| I8 | GAGTCCTCCATGCTCTTAA | CCCAACAGAATCCTCACTA | 120 |
| AA34 | GGATCTGTCTTGCGTGTA | TGCTTGTTGGATGGTATCA | 150 |
Wherein PCR reaction system (20uL): Tap enzyme (5U/ μ L) 0.2uL, Primer (10mmol/L) 2uL, dNTP
(2.5mmol/L) 2uL, DNA profiling (20-100ng/ μ L) 2uL, 10 × Buffer (25mM) 2uL, ddH2O 11.8uL.PCR is anti-
Answer program: 94 DEG C of 5min；94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 45s, 35 circulations；72 DEG C of 8min, 20 DEG C of 2min.
Electrophoresis about 2-3h under the conditions of agarose gel 3.0%, constant voltage 120-150V, uses gel imaging system imaging
And keeping records.
(3) structure of linkage map
The individual plant that banding pattern is mutant a344 is labeled as 0, and banding pattern is that the individual plant of heterozygosis is designated as 1, and banding pattern is the list of parent
Strain is designated as 2, do not go out band individual plant be designated as 3, by with MAPMARKER3.0 software to F2Segregating population Middle molecule labelling and sudden change
The mask data of character carries out linkage analysis, then recombuination value is converted into genetic distance (cent Morgan, cM).
(4) candidate gene just positioning result
First with comparing the 543 pairs of SSR primers being evenly distributed on 12 chromosomes of Oryza sativa L., analyze mutant a344 with
Polymorphism between flower B, has therefrom filtered out 98 polymorphism primers to being evenly distributed on 12 chromosomes of Oryza sativa L..Then utilizing should
98 pairs of polymorphism primers are near isogene pond and F2In colony, 46 recessive individual plants screen, and result (see Fig. 8) finds No. 4
Two SSR marker RM5478 of the long arm end of chromosome and RM1112 all have linkage relationship with candidate gene, and the genetic distance is respectively
1.5cM and 1.3cM.
(5) candidate gene finely positions and predictive genes
By continual exploitation Indel labelling I7 and I8 in this section, candidate gene is finely positioned at No. 4 dye the most at last
In 46Kb section between colour solid I8 and I7 (see Fig. 8).To 7 candidate gene sequencing analysis in this interval, at mutant
A344 finds the 350th that encodes the coding region nucleotide sequence of the LOC_Os04g56480 gene of pelota albumen become by G
For T (see SEQ ID NO.3), cause the tryptophan (W) of this nucleotide coding to become leucine (L) (see SEQ ID NO.4), make
This protein function is impacted.
Extensive with another name for Sichuan Province to a344 498 miscellaneous by comprising the specific primer AA34 in mutational site for a pair in the design of this gene internal
Hand over the F built2The plant in colony with uneven class sizes phenotype carries out common separation detection (Figure 11).Sequencing result shows, the 7 of structure
Individual recessive pond all shows as the sudden change in this site.Therefore, in conjunction with fine location and sequencing result, LOC_Os04g56480 gene is very
It is probably candidate's genes of interest.
Embodiment 4: the checking that knocks out of candidate gene is tested
(1) test material
This test bacillus coli DH 5 alpha used and Agrobacterium EHA105 bacterial strain are both from Sichuan Agricultural University's rice research
Institute's heterosis utilization laboratory.
(2) test method
1, Crisper-A344 gene knockout carrier builds
In wild type, the nucleotides sequence of A344 gene arranges as template, selects suitable region, designs the target site knocked out,
BGK03 carrier reference reagent box (Hangzhou hundred lattice biotech firm) is utilized to build Crisper-A344 carrier.Concrete structure flow process is such as
Under (Fig. 5):
(1) following primer is designed and synthesized to form gRNA target sequence
F:5'-TGTGTGCCAGAGCACGTATTGAAACAT-3'(SEQ ID NO.11)
R:5'-AAACATGTTTCAATACGTGCTCTGGCA-3'(SEQ ID NO.12)
(2) primer dimer is prepared
By the above-mentioned primer of synthesis to being dissolved in water to 10 μMs, after mixing by following reaction system, in PCR instrument 95 DEG C heating
3 minutes, then it is slowly dropped to 20 DEG C with about 0.2 DEG C/sec.Described polymerization system is: annealing Buffer 18ul, gRNA target spot
The each 1ul of primer, adds ddH2O, complements to 20ul.
(3) primer dimer is built to BGK03 carrier.Each component is mixed on ice, mixing by following reaction system
It is standby that rear 20 DEG C of reactions converted escherichia coli after 1 hour.Described reaction system: BGK03 carrier 2ul, Oligo dimer 1ul,
Enzyme mixation 1ul, adds ddH2O, complements to 10ul.
2, escherichia coli convert
(1) from-80 DEG C of refrigerators, take out the competent escherichia coli cell that a control is got ready, be placed in thawed on ice；
(2) every 100ng connects product and adds 100 μ L competent cell suspensions, places 30min after mixing on ice；
(3) 42 DEG C of heat shock 30s, take out rapidly and are immediately placed on 2min on ice；
(4) adding the 500 μ L LB fluid medium without antibiotic, 37 DEG C of 200r/min cultivate about 1 hour activation bacterium
Liquid；
(5) bacterium solution of activation is centrifuged 1min with 5000r/min, aseptically outwells major part supernatant, with shifting
The bacterium of liquid rifle resuspended precipitation gently so that it is be suspended in the LB fluid medium of 100 μ about L, on super-clean bench, bacterium solution turned
Move and be coated onto on the LB screening flat board containing antibiotic；
(6) the LB forehand face scribbling bacterium solution is upwards placed about ten minutes, treat that bacterium solution is completely by LB solid medium
After absorption, the culture medium of coated plate is inverted, incubated overnight in the calorstat of 37 DEG C；
(7) picking list bacterium colony, utilizes P1028 primer to carry out the detection of bacterium solution PCR；Pcr amplification product (see Figure 12) is
900bp.Described P1028 primer to for:
P1028-F:5'-TACACAGGCCATCGGTCCAGA-3'(SEQ ID NO.13)
P1028-R:5'-TAGGAGGGCGTGGATATGTC-3'(SEQ ID NO.14)。
Wherein PCR response procedures: 94 DEG C of 5min；94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 45s, 35 circulations；72 DEG C of 8min, 20
℃2min。
(8) positive colony is added in the LB culture fluid that 3ml contains kanamycin (50mg/L), is placed on 37 DEG C of shaking tables,
200r/min cultivates about 10h, preserves bacterium solution and extracts plasmid.
3, the extraction of escherichia coli plasmid is carried out according to OMEGA Plasmid Extraction Kit product description, will
The plasmid DNA extracted is collected in clean centrifuge tube ,-20 DEG C of preservations.
4, the mensuration of plasmid sequence and sequence analysis
Positive colony plasmid is delivered to Chengdu Qing Ke Science and Technology Co., Ltd. check order.With DNAMAN software to order-checking
Result carries out sequence alignment, the correctness of confirmation gRNA sequence.
5, Agrobacterium-mediated Transformation
(1) Agrobacterium chemical transformation
According to a plasmid: 50ul competent cell from-80 take out time the heart of quickly letting go thaw；Add 0.4-1ug to build
Good CRISPER-A344 plasmid, in 50ul competent cell, is placed 30 minutes on ice；Freezing 2 minutes in liquid nitrogen；37 DEG C of water
Bath 2min, dissolves cell；Adding the nonreactive LB culture medium of 5 times of volumes immediately, 2-3hr (170rpm) cultivated by 28 DEG C of shaking tables；
7000rpm is centrifuged 2 minutes, and suspension cell is in 100ul LB culture medium；It is coated in rifampicin Jia Kana resistance plate, dries up, 28 DEG C
Cultivate 2-3 days；Carry out the detection of bacterium solution PCR with hygromycin molecular marker P1028 primer, will can amplify the positive agriculture of purpose band
Bacillus monoclonal, addition glycerol is placed on-80C as protective agent and saves backup.
(2) During Agrobacterium method rice transformation
1) induction of callus: Japanese fine seed is first with 75% alcohol disinfecting 1 minute, by rinsed with sterile water 3 times, then uses
The sodium hypochlorite of 40% rinses 30 minutes, then with aseptic water washing 5 times, is positioned in the culture dish of band filter paper and is filtered dry, use tweezers
It is inoculated in NMB culture medium, cultivates 7 days in 28 DEG C of light.Every 7 days subcultures are once.After subculture 2～3 times, picking grows from seed
The good callus gone out, they subcultures on pre-culture, 28 DEG C of light culture 4 days.
2) activation of agrobacterium strains: the 30ul Agrobacterium preserved by-80C adds 3mL and contains rifampicin and kanamycin
YEP fluid medium in, shaken cultivation 14h at 28 DEG C；Take again wherein 1mL in the 50mL containing rifampicin and kanamycin
YEP fluid medium in 28 DEG C of shaken cultivation 4h again.
3) conversion is co-cultured: collect thalline, with containing 100 μMs/L acetyl by centrifugal under 5000rpm for the bacterium solution activated
The AAM resuspended thalline of fluid medium 30mL of syringone, is dipped in 20min in bacterium solution by the callus chosen in advance, sucks many
Remaining bacterium solution, is laid in and co-cultures on solid medium, 28 DEG C of light culture 2d.
4) wound healing takes off bacterium and cultivates and wound healing resistance screening: by co-culturing, the callus aseptic water washing after 2d is clear to water
Clearly, then with the sterilized water vibration 30min sterilization containing cephamycin (500mg/L), by callus aseptic filter paper or water suction
Paper thoroughly blots, and is then inoculated on Selective agar medium and cultivates about 3 weeks.
5) differentiation of transfer-gen plant with take root: the above-mentioned resistant calli newly grown is inoculated into division culture medium
On, illumination cultivation 1-2 month, then seedling high for about the 3cm grown forwards to carry out on root media root culture, when
During Miao Changzhi about 10cm, take blade carry DNA utilize hygromycin molecular marker P1028 primer identify positive plant Seedling, finally obtain 4
Strain transgenic positive plant.
6) by after the seedling exercising of positive transgenic plant indoor, then transplant in land for growing field crops.
(3) detection of transgenic paddy rice
The CTAB method of application enhancements extracts paddy DNA, plants expanding transgenic according to following PCR condition with P1092 primer
Sequence after knocking out in strain, PCR primer (see Figure 13) clip size is 559bp.Described P1092 primer to for:
P1092-F:5'-ATTAGACCCAACTGCAAGTGCT-3'(SEQ ID No:15)
P1092-R:5'-TCAGGAAAGCCTGTAGGCAAAT-3'(SEQ ID No:16)
Wherein PCR reaction system (20uL): Tap enzyme (5U/ μ L) 0.2ul, Primer (10mmol/L) 2ul, dNTP
(2.5mmol/L) 2ul, DNA (20-100ng/ μ L) 2ul, 10 × Buffer (25mM) 2ul, ddH2O 11.8ul.PCR reaction interval
Sequence: 94 DEG C of 5min；94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 45s, 35 circulations；72 DEG C of 8min, 20 DEG C of 2min.
(4) recovery of PCR primer
Target DNA segment glue reclaimer operation step is carried out with reference to Omega Gel Extraction Kit product description,
Take 2 μ L glue to reclaim products and be placed in 1% agarose gel and carry out electrophoresis detection, the order-checking of detection Hou Song company.Sequencing result is divided
Analysis finds, the A344 gene in 4 transfer-gen plants there occurs the insertion of single base A/G/T respectively.
By the nucleotide fragments containing gRNA target sequence, it is connected on BGK03 carrier, constitutes gene knockout carrier
Crisper-A344 (see Figure 14).
Being transformed into Agrobacterium EHA105, with Agrobacterium-mediated transformation, Japan is fine.Compared with result comparison fine with Japan, turn base
Because the blade of positive plant all shows as uneven class sizes (see Figure 15), show transgenic by sequencing result (SEQ ID NO.3-6)
In plant, the equal premature translation in the coding region of A344 gene terminates, and produces non-functional protein (SEQ ID NO.7-10).Warp
A344 gene knock out experimental verification, illustrate A344 be control this uneven class sizes phenotype of Oryza sativa L. gene.
Claims (7)
1. the protein controlling Oryza sativa L. uneven class sizes character, it is characterised in that be following (1) or (2):
(1) protein being made up of the aminoacid sequence shown in SEQ ID NO.2 in sequence table；
(2) aminoacid sequence shown in SEQ ID N0.2 in sequence table is added through one or several aminoacid, replaces or lacks
Lose and derivative and relevant to controlling Oryza sativa L. uneven class sizes character protein.
2. the gene of coding protein described in claim 1, is following (a), (b) or (c):
A () is made up of the nucleotide sequence shown in SEQ ID NO.1 in sequence table；
B nucleotide sequence that () and SEQ ID NO.1 in sequence table limit has the homology of at least 90%, and coding has control
The nucleotide sequence of controlling the water circulation rice uneven class sizes character correlation function protein；
One or several nucleotide in c nucleotide sequence that SEQ ID NO.1 in sequence table is limited by () is through adding, replacing
Or disappearance and derivative and coding has the nucleotide sequence controlling Oryza sativa L. uneven class sizes character correlation function protein.
3. contain the expression vector of gene described in claim 2.
Expression vector the most according to claim 3, it is characterised in that described expression vector refer to plasmid, host cell or
Plant expression vector.
Expression vector the most according to claim 4, it is characterised in that described host cell is Bacillus coli cells, agriculture bar
Bacterium cell or plant cell.
6. the gene described in claim 2 is in the application improved on rice bacterial blight resistance.
7. utilize the method that said gene cultivates bacterial blight-resisting rice varieties, it is characterised in that by the base described in claim 2
Because being transformed in rice varieties.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610790516.XA CN106243208A (en) | 2016-08-31 | 2016-08-31 | A kind of Oryza sativa L. uneven class sizes gene and the protein of coding thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610790516.XA CN106243208A (en) | 2016-08-31 | 2016-08-31 | A kind of Oryza sativa L. uneven class sizes gene and the protein of coding thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106243208A true CN106243208A (en) | 2016-12-21 |
Family
ID=58080135
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610790516.XA Pending CN106243208A (en) | 2016-08-31 | 2016-08-31 | A kind of Oryza sativa L. uneven class sizes gene and the protein of coding thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106243208A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106676130A (en) * | 2016-12-30 | 2017-05-17 | 华智水稻生物技术有限公司 | Paddy rice BADH2 gene site-directed mutagenesis method through using CRISPR-CAS9 technology |
| CN106957849A (en) * | 2017-01-20 | 2017-07-18 | 宁波大学 | A kind of rice root elongation and spot leaf character control the protein of gene OsPelota1 and coding |
| CN107475210A (en) * | 2017-09-07 | 2017-12-15 | 四川农业大学 | A kind of Bacterial Blight Resistance in Rice related gene OsABA2 and its application |
| CN115287288A (en) * | 2022-01-24 | 2022-11-04 | 浙江师范大学 | Rice lesion mutant and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102924581A (en) * | 2012-10-15 | 2013-02-13 | 华南农业大学 | Bacterial leaf blight-resistant related protein of rice, and encoding gene and application of bacterial leaf blight-resistant related protein of rice |
| CN103882052A (en) * | 2012-12-20 | 2014-06-25 | 中国科学院遗传与发育生物学研究所 | Method for breeding bacterial leaf blight resistant plant |
| CN104141004A (en) * | 2014-06-30 | 2014-11-12 | 江汉大学 | Method for predicting bacterial blight of rice by utilizing miRNA 1430 genes |
-
2016
- 2016-08-31 CN CN201610790516.XA patent/CN106243208A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102924581A (en) * | 2012-10-15 | 2013-02-13 | 华南农业大学 | Bacterial leaf blight-resistant related protein of rice, and encoding gene and application of bacterial leaf blight-resistant related protein of rice |
| CN103882052A (en) * | 2012-12-20 | 2014-06-25 | 中国科学院遗传与发育生物学研究所 | Method for breeding bacterial leaf blight resistant plant |
| CN104141004A (en) * | 2014-06-30 | 2014-11-12 | 江汉大学 | Method for predicting bacterial blight of rice by utilizing miRNA 1430 genes |
Non-Patent Citations (1)
| Title |
|---|
| 钟光荣: "一份水稻类病变突变体a344的遗传分析及基因定位", 《中国优秀硕士学位论文全文数据库 农科科技辑》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106676130A (en) * | 2016-12-30 | 2017-05-17 | 华智水稻生物技术有限公司 | Paddy rice BADH2 gene site-directed mutagenesis method through using CRISPR-CAS9 technology |
| CN106957849A (en) * | 2017-01-20 | 2017-07-18 | 宁波大学 | A kind of rice root elongation and spot leaf character control the protein of gene OsPelota1 and coding |
| CN107475210A (en) * | 2017-09-07 | 2017-12-15 | 四川农业大学 | A kind of Bacterial Blight Resistance in Rice related gene OsABA2 and its application |
| CN115287288A (en) * | 2022-01-24 | 2022-11-04 | 浙江师范大学 | Rice lesion mutant and application thereof |
| CN115287288B (en) * | 2022-01-24 | 2023-05-16 | 浙江师范大学 | Rice disease spot mutant and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105189533A (en) | Heat-resistant rice gene OsZFP, screening marker and separation method thereof | |
| CN106243208A (en) | A kind of Oryza sativa L. uneven class sizes gene and the protein of coding thereof | |
| CN107475210A (en) | A kind of Bacterial Blight Resistance in Rice related gene OsABA2 and its application | |
| CN105585619B (en) | With rice grain grain length and grain weight GAP-associated protein GAP and its encoding gene GL3-3 and application | |
| CN110283838A (en) | A kind of high shear efficiency ScCas9 gene and its application | |
| CN105063068A (en) | Encoding mutation EPSPS (5-enolpyruvyl-shikimate-3-phosphate synthase) gene, and expression vector, expression product and application of encoding mutation EPSPS gene | |
| CN101006768B (en) | Agrobacterium-mediated Sophora japonica transgene and tissue-culturing rapid propagation method | |
| Collado et al. | Agrobacterium-mediated transformation of Phaseolus vulgaris L. using indirect organogenesis | |
| CN104593380B (en) | For the gene ZmHKT1 for the coding corn HKT transport proteins for improving plant salt endurance;1a and its application | |
| CN104593381B (en) | A kind of corn resistant gene of salt and its application | |
| Marais et al. | Molecular tagging and confirmation of Thinopyrum distichum chromosomes that contribute to its salt tolerance | |
| CN106701895B (en) | Haplotype related to drought resistance of corn and molecular marker thereof | |
| CN106146638B (en) | It is a kind of control Senescence of Rice gene and its coding protein | |
| Alam et al. | Marker-assisted foreground selection for identification of salt tolerant rice genotypes. | |
| CN103348009A (en) | Method for preparing fertility-lowered plant | |
| CN109293758B (en) | Anti-verticillium wilt related protein GbVIP1, and coding gene and application thereof | |
| CN107937363B (en) | Rice spike top degeneration related protein kinase and coding gene thereof | |
| CN113462807B (en) | SNP molecular marker and application thereof in improving barley salt tolerance | |
| CN103451193B (en) | Populus deltoidesx populus nigra PdHSP70 gene and application thereof | |
| CA3125263C (en) | Soybean transgenic event ind-00410-5 | |
| CN103937811B (en) | Tree peony PsSVP gene and application thereof | |
| CN116814846B (en) | Molecular marker linked with salt-tolerant gene qSST4 of Dongxiang ordinary wild rice and application thereof | |
| CN117402910B (en) | Application of PP2C01 gene in regulation and control of salt tolerance of rice | |
| CN111471788B (en) | Flanking sequence of exogenous insertion segment of corn SbSNAC1-466 transformed into SbSNAC1 gene and application thereof | |
| Jin et al. | Techniques for the regeneration and genetic transformation of Arabidopsis pumila: An ephemeral plant suitable for investigating the mechanisms for adaptation to desert environments |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20161221 |