CN106222276B

CN106222276B - Liquid-phase chip miRNAs detection method based on HCR

Info

Publication number: CN106222276B
Application number: CN201610643310.4A
Authority: CN
Inventors: 李富荣; 杨璐
Original assignee: Shenzhen Peoples Hospital
Current assignee: Shenzhen Peoples Hospital
Priority date: 2016-08-08
Filing date: 2016-08-08
Publication date: 2019-12-10
Anticipated expiration: 2036-08-08
Also published as: CN106222276A

Abstract

The invention discloses a liquid chip miRNAs detection method based on HCR, and provides a method for detecting the content of target miRNA in RNA to be detected, which comprises the following steps: 1) designing and synthesizing a probe M, a probe 1 and a probe 2 which respectively correspond to 1 or more target miRNAs, 2) carrying out HCR reaction on the probe M corresponding to the target miRNAs, microspheres corresponding to the target miRNAs, the probe 1 and the probe 2 to obtain HCR reaction products; 3) and (4) detecting the fluorescent label, and determining whether 1 or more target miRNAs are contained according to whether the fluorescent signal is contained. The method of the invention not only greatly improves the sensitivity of the traditional liquid chip, but also has good performance in the aspects of quantitative range, specificity and accuracy, and foresees that a detection means is provided for establishing a faster, more sensitive and simpler miRNAs liquid chip detection system to the new marker in the early stage of the tumor.

Description

Liquid-phase chip miRNAs detection method based on HCR

Technical Field

the invention relates to the technical field of biology, in particular to a liquid chip miRNAs detection method based on HCR.

background

although circulating miRNAs are non-invasive tumor markers that can be translated to the clinic, isolation and detection of miRNAs in cell-free body fluid samples remains a challenge because most detection methods are now sensitivity-limited and many diagnostically valuable circulating miRNAs may be overlooked because they are not detected. In addition, although techniques such as PCR have made significant progress in single marker detection, monitoring a single marker is often insufficient for clinical disease diagnosis. Whether for early screening of diseases such as cancer or to elucidate the expression pattern of miRNAs in biological systems, there is a need to be able to detect multiple short-chain miRNAs at very low expression levels. However, at the present time, such highly sensitive detection methods for multiple miRNAs have not yet been established.

the liquid phase chip can mix the capture microspheres of different miRNAs in a reaction hole, high-throughput detection is realized, and simultaneously, better flexibility is provided for index selection, so that the liquid phase chip is widely used for quantitative detection of the miRNAs. Biscontin et al found that the lower limit of sensitivity of the liquid phase chip was 0.073 fmol. Wang et al simultaneously detected the contents of miR-21, miR-31 and miR-222 in lung cancer tissues by using a liquid-phase chip system, and showed that the detection limit of the method is 1fmol/μ l. However, absolute quantitative PCR data indicate that lung cancer-specific miRNAs are present in serum at about 18.57fM to 1.74 pM. Therefore, the liquid-phase chip technology can not finish the detection of the sample with low miRNAs content such as plasma and the like due to the omission of the amplification step and the lack of an effective signal amplification system.

Hybridization Chain Reaction (HCR) is a technique that is initiated by short chains and does not require enzymes to achieve amplification at room temperature. The biotin-labeled hairpin structure probe can be enriched on the surface of the magnetic bead through HCR reaction, and signal amplification directly carried out on the magnetic bead is realized.

Disclosure of Invention

The invention aims to provide a method for detecting the content of target miRNA in RNA to be detected.

the method provided by the invention realizes the detection of the content of the target miRNA in the RNA to be detected through the fluorescent signal of the target miRNA in the RNA to be detected when the HCR reaction enhanced liquid chip detection platform is used for detecting.

the method for detecting the content of the target miRNA in the RNA to be detected comprises the following steps:

A. establishing a standard curve, wherein the method comprises the following steps:

1) designing and synthesizing a probe M, a probe 1 and a probe 2 which respectively correspond to each target miRNA,

the probe M, probe 1 and probe 2 for each target miRNA are as follows:

the probe M sequentially comprises an HCR initiation chain A, a segment B specifically combined with the target miRNA and a segment C specifically combined with the capture sequence of the microsphere corresponding to the target miRNA from the 5' end;

the HCR initiating chain A sequentially consists of a single-stranded DNA molecule b and a single-stranded DNA molecule c from the 5' end;

The single-stranded DNA molecule c is not the same as or specifically combined with the target miRNA sequence, and has the size of 6-8 nt;

the fragment B specifically combined with the target miRNA is composed of a single-stranded DNA molecule b and a single-stranded DNA molecule a from the 5' end in sequence;

The single-stranded DNA molecule b and the single-stranded DNA molecule b are specifically combined and paired to enable the probe M to form a stem-loop structure with a sticky end;

The probe 1 sequentially comprises a specific binding fragment of the HCR priming strand A and the target miRNA from the 5' end;

the specific binding fragment of the HCR priming strand consists of a single-stranded DNA molecule c and a single-stranded DNA molecule b from the 5' end in sequence;

the target miRNA is composed of a single-stranded DNA molecule a and a single-stranded DNA molecule b from the 5' end in sequence;

The single-stranded DNA molecule b and the single-stranded DNA molecule b are specifically combined and paired to enable the probe 1 to form a stem-loop structure with a sticky end;

The probe 2 sequentially comprises an HCR initiation chain A and a segment B specifically combined with the target miRNA from the 5' end

the specific binding pair of the single-stranded DNA molecule b and the single-stranded DNA molecule b enables the probe 2 to form a stem-loop structure with a sticky end;

2) fixing the probe M corresponding to the target miRNA on a microsphere, and performing HCR reaction on the microsphere with the fixed probe M and target miRNA standard solutions with different concentrations under the action of the probe 1 and the probe 2 corresponding to the target miRNA to obtain an HCR reaction product;

each target miRNA corresponds to one microsphere;

the fluorescence color of each microsphere is different;

3) Fluorescence labeling the HCR reaction product to obtain a product to be detected; detecting the fluorescence color and the fluorescence intensity of the product to be detected, taking the logarithm of different concentrations of the target miRNA standard solution as an abscissa, and taking the logarithm of the fluorescence intensity corresponding to the different concentrations of the target miRNA standard solution as an ordinate to make a standard curve;

B. Replacing the target miRNA standard solutions with different concentrations by the RNA to be detected, and repeating the step A to obtain the fluorescence intensity of the target miRNA in the RNA to be detected;

C. And substituting the fluorescence intensity of the target miRNA in the RNA to be detected into the standard curve to obtain the content of the target miRNA in the RNA to be detected.

in the method, the target miRNA standard solutions of different concentrations are 1 target miRNA standard solution or a mixture of a plurality of target miRNA standard solutions;

In the above method, the specific binding is complementary; the target miRNA may be 1 or more mirnas; a is complementarily paired with a, c is complementarily paired with c; 1 target miRNA corresponds to 1 microsphere.

In the above method, the step 2) comprises the following steps a-c:

a. uniformly mixing a probe M solution corresponding to the target miRNA with a microsphere solution to obtain a reaction system 1, and reacting to obtain a system containing a microsphere-probe compound;

b. target miRNA standard solutions with different concentrations are respectively mixed with the system containing the microsphere-probe compound to obtain a reaction system 2, and the reaction system is reacted to obtain different systems containing the sample-microsphere-probe compound;

c. and uniformly mixing the probe 1 solution corresponding to the target miRNA, the probe 2 solution corresponding to the target miRNA and different systems containing the sample-microsphere-probe compound to obtain a reaction system 3, and carrying out HCR reaction to obtain different HCR reaction products.

the solvent of the standard solution is buffer A: 1.925g NaCl, 0.19g MgCl were weighed₂dissolved in 50ml of RNasefree water, and 2ml of Tris-HCl (1M, pH8) was added to bring the volume of RNasefree water to 100 ml.

In the method, in the step 2), the solute ratios of the added solutions are as follows:

the probe M comprises the following components: the target miRNA standard solutions with different concentrations are as follows: the probe 1: the probe 2 is 100 fmol: 2500: 5X 10^-7pmol-5×10^-2pmol：500fmol：500fmol。

or in the step B, the probes M comprise the following components: the probe 1: the probe 2 is 100 fmol: 2500: 500 fmol: 500 fmol;

or in the step B, the probes M comprise the following components: miRNAs in the RNA to be detected: the probe 1: the probe 2 is 100 fmol: 2500: 5X 10^-7pmol-5×10^-2pmol：500fmol：500fmol。

In the method, the concentration of the probe M solution is 10 nM; the adding volume of the probe M solution is 10 mu l;

or, the concentration of the microsphere solution is 2.5 multiplied by 10⁵The addition volume of the microsphere solution is 10 mul;

Or, the concentration of the target miRNA standard solutions with different concentrations is 10^-1pM-10⁴pM, the adding volume of the target miRNA standard solution with different concentrations is 5 mul;

or, the concentration of the probe 1 solution is 50nM, and the adding volume of the probe 1 solution is 10 ul;

or, the concentration of the probe 2 solution is 50nM, and the adding volume of the probe 2 solution is 10 ul.

in the method, the reaction conditions are all incubation for 1h at 37 ℃ at the rotating speed of 400 rpm;

alternatively, the HCR reaction conditions were 400rpm, 37 ℃ incubation for 20 min.

in the method, the 5 'end and the 3' end of the probe 1 and the probe 2 are labeled with biotin;

The fluorescence-labeled marker is streptomycin-phycoerythrin;

the labeled reaction conditions were 20 ℃ incubation for 30min at 200 rpm.

in the above method, the following steps are further included between step 1) and step 2): performing denaturation annealing on the probe M, the probe 1 and the probe 2 to obtain a treated probe M, a treated probe 1 and a treated probe 2;

The conditions of the denaturation annealing are 95 ℃ for 5min, 90 ℃ for 3min, 85 ℃ for 3min, 80 ℃ for 3min, 75 ℃ for 3min, 70 ℃ for 3min, 65 ℃ for 3min, 60 ℃ for 3min, 55 ℃ for 3min, 50 ℃ for 3min, 45 ℃ for 3min, 40 ℃ for 3min, and 37 ℃ for 30 min.

Or, between the steps 2) and 3), the following steps are further included: sequentially blocking and washing the HCR reaction product;

or, in the step 3), a flow type fluorescence detector is adopted for detection.

In the method, the RNA to be detected is specifically RNA with low target miRNA content, and the RNA to be detected is derived from a cell-free body fluid sample;

or the cell-free body fluid sample is in particular isolated serum or isolated plasma.

in the above method, the target miRNA is let-7a or miR 21;

the nucleotide sequence of the probe M corresponding to the let-7a is sequence 1;

The nucleotide sequence of the probe 1 corresponding to the let-7a is a sequence 2;

The nucleotide sequence of the probe 2 corresponding to the let-7a is a sequence 3;

the nucleotide sequence of the probe M corresponding to the miR-21 is sequence 4;

The nucleotide sequence of the probe 1 corresponding to the miR-21 is sequence 5;

The nucleotide sequence of the probe 2 corresponding to the miR-21 is sequence 6.

The application of HCR reaction in detecting the content of target miRNAs in RNA to be detected by liquid chromatography is also within the protection scope of the invention.

in order to fully utilize the advantages of liquid chip multiplex detection and simultaneously improve the sensitivity of the method, the invention designs a probe M hybridized with a specific microsphere sequence and target miRNAs and a pair of stem-loop structure probes 1 and 2 capable of being hybridized with each other, and establishes a new method for detecting the miRNAs based on HCR liquid chip. The new signal amplification system is added, so that the quantitative limit of the liquid-phase chip to let-7a can reach 0.1pM level, and the dynamic quantitative range can reach 0.1pM to 10 nM. The sensitivity of the method is higher than that of the traditional liquid phase chip, and the method is similar to or even better than the detection limit of other miRNAs related to HCR. The wide dynamic quantitative range suggests that this method has the potential to simultaneously detect miRNAs with significantly different expression levels. The let-7a probe designed by the invention can well distinguish the sequence difference between different miRNAs, only completes signal amplification on specific target miRNAs, shows better specificity and lays a foundation for multiple detection. The method for detecting the plasma miRNAs after 5-time dilution has better recovery rate, and provides basis for further utilizing the method for clinical application.

in order to further verify the multiplex detection capability of the method, miR-21 and let-7a are quantitatively analyzed at the same time. In order to realize signal amplification, probes 21-M, 21-1 and 21-2 with 10-fold concentration are selected during multiple detection, and the result shows that the miRNAs subjected to multiple detection have no mutual influence, and the fluorescence intensity of miR-21 is linearly related to the actual content of the miRNAs in the range of 0.01pM to 10 nM. Since each fluorescently-encoded microsphere is specific only to the corresponding hairpin-structure probe, the type and concentration of miRNAs can be directly obtained by reading the fluorescent signals on different microspheres, and thus the HCR-based liquid chip is a method suitable for multiple detection of miRNAs.

In conclusion, the invention designs the hairpin structure probe and preliminarily explores the HCR-based multiple miRNAs detection method by means of a Luminex X MAP liquid phase chip detection platform. The method not only greatly improves the sensitivity of the traditional liquid phase chip, but also has excellent performance in the aspects of quantitative range, specificity and accuracy, and provides important help for improving the cure rate and survival rate of cancer patients.

drawings

FIG. 1 is a schematic diagram of liquid phase chip detection of miRNAs based on HCR.

FIG. 2 shows an agarose gel electrophoresis verified the HCR reaction of let-7 a.

fig. 3 shows the effect of probe concentration (a) and HCR reaction time (B) on the fluorescence signal value (n is 3).

Fig. 4 shows a calibration curve (a) and a log-log calibration curve (B) (n is 3).

FIG. 5 shows the specificity of detection of miRNAs on HCR-based liquid phase chip.

FIG. 6 shows the fluorescence intensity comparison between single-index and multiplex assays for let-7a (A) and mi-21(B) (n-3).

fig. 7 is a log-log calibration curve for miR-21 (n ═ 3).

Detailed Description

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.

materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

part of the main reagents are as follows:

chemical reagent of NaCl national drug group Co Ltd

MgCl₂Tianjin Jianyuanzhi reagent Co Ltd

Tris-HCl Ambion Co

RNasefree Water (1.25ml) Thermo Fisher Scientific Co

RNasefree Water (500ml) Beijing kang is a century Biotechnology Co., Ltd

TE buffer solution Beijing Ding Guoshang biotechnology Limited liability company

Bovine serum Albumin BSA Sigma Co

takara Corp. DNA Stem-Loop Probe

MiRNAs standards Takara Co Ltd

-TAG^TMMicrospheres Luminex Co

Streptavidin-phycoerythrin (SA-PE) Invitrogen

50 XTAE buffer solution for Shanghai engineering

Agarose BIOWEST

10X Loading Buffer TaKaRa Co

50bp DNA Ladder (Dye Plus) TaKaRa Co

MiRcute miRNA Isolation Kit Tiangen Biochemical technology (Beijing) Co., Ltd

East Honghua factory of Guangzhou city of chloroform

Guangzhou city east Honghua factory for isopropyl alcohol

guangzhou Dong Honghua factory for anhydrous alcohol

Part of the main reagents are prepared as follows:

and (3) buffer solution A: 1.925g NaCl, 0.19g MgCl were weighed₂dissolved in 50ml of RNasefree water, and 2ml of Tris-HCl (1M, pH8) was added to bring the volume of RNasefree water to 100 ml.

2.5% BSA solution: 2.5g BSA were weighed and dissolved in 100ml RNasefree water.

1 × TAE buffer: 50ml of 50 XTAE buffer was diluted with 2450ml of deionized water.

example 1 establishment of liquid chip detection method for miRNAs based on HCR

First, miRNAs liquid phase chip detection principle based on HCR

the schematic diagram of the principle of liquid chip detection of miRNAs based on HCR is shown in figure 1.

The probe M consists of 68 bases and comprises a sequence complementary to a capture sequence on the microsphere; a sequence (a-b) complementary to the miRNA of interest; and a sequence (c-b) that triggers the chain reaction of the HCR. The probe M forms a stem-loop secondary structure after denaturation and annealing, and is firstly coated in the system-TAG^TMAnd (4) capturing the microspheres. When the target miRNA (a-b) is added, the miRNA is hybridized to the probe M, and the hairpin structure of the probe M is opened through a strand displacement reaction, so that the HCR is exposed to initiate a chain reaction initiating chain (c-b).

probes 1 and 2 are each composed of 44 bases, and are labeled with biotin at 5 'and 3' ends, respectively, and are pretreated to form a hairpin structure comprising a 16bp stem, a 6nt loop, and a 6nt sticky end.

The newly released priming strand of probe M (c-b) is complementary paired with the sticky end of probe 1 (c-b), releasing the sticky end that opens probe 2 (a-b), and after probe 2 is opened, releasing the sticky end that opens probe 1 (c-b), allowing the next probe 1 to be opened, thereby initiating a new round of strand hybridization. As the reaction time is extended, biotin is brought to the microspheres by probes 1, 2. After streptomycin avidin-phycoerythrin (SA-PE) is added into the system, a large amount of fluorescent signals can be enriched on the microspheres, so that the amplification of the signals is realized.

according to different sequences of miRNAs to be detected and different microsphere capturing sequences, corresponding probes M, 1 and 2 are designed, so that specific miRNAs can only be combined to microspheres with corresponding colors, and a series of HCR reactions are initiated. When the reaction solution is detected by a Luminex 200 instrument, the color and the fluorescence intensity of the microspheres are simultaneously identified by the instrument, and qualitative and quantitative analysis is carried out on the miRNAs in the sample.

second, establishment of method

detecting whether target miRNA is contained in RNA to be detected

step I:

1. Designing and synthesizing a probe M, a probe 1 and a probe 2 which respectively correspond to 1 or more target miRNAs,

the probe M, probe 1 and probe 2 for each target miRNA are as follows:

the probe M sequentially comprises an HCR initiation strand A, a segment B which is complementary with the target miRNA and a segment C which is complementary with the capture sequence of the microsphere corresponding to the target miRNA from the 5' end;

The segment B which is complementary with the target miRNA is composed of a single-stranded DNA molecule b and a single-stranded DNA molecule a from the 5' end in sequence;

complementary pairing of the single-stranded DNA molecule b and the single-stranded DNA molecule b allows the probe M to form a stem-loop structure with a sticky end;

The probe 1 comprises a complementary segment of the HCR priming strand and the target miRNA from the 5' end in sequence;

the complementary fragment of the HCR priming strand consists of a single-stranded DNA molecule c and the single-stranded DNA molecule b in turn from the 5' end; the target miRNA is composed of a single-stranded DNA molecule a and a single-stranded DNA molecule b in sequence from the 5' end;

Complementary pairing of the single-stranded DNA molecule b and the single-stranded DNA molecule b forms a stem-loop structure with a sticky end in the probe 1;

The probe 2 sequentially comprises an HCR initiation chain A and a segment B which is complementary with the target miRNA from the 5' end

complementary pairing of the single-stranded DNA molecule b and the single-stranded DNA molecule b forms a stem-loop structure with a sticky end for the probe 2;

performing denaturation annealing on the probe M, the probe 1 and the probe 2 to obtain a treated probe M, a treated probe 1 and a treated probe 2;

2. Fixing a probe M corresponding to the target miRNA on a microsphere corresponding to the target miRNA, and carrying out HCR reaction on the microsphere with the probe M fixed and a sample to be detected under the action of a probe 1 and a probe 2 corresponding to the target miRNA to obtain an HCR reaction product;

The method comprises the following specific steps:

B. Mixing the RNA solution to be detected with the system containing the microsphere-probe compound to obtain a reaction system 2, and reacting to obtain a system containing a sample-microsphere-probe compound;

C. and uniformly mixing the solution of the probe 1 corresponding to the target miRNA, the solution of the probe 2 corresponding to the target miRNA and the system containing the sample-microsphere-probe compound to obtain a reaction system 3, and carrying out HCR reaction to obtain an HCR reaction product.

Sequentially closing and washing the HCR reaction product;

3. Fluorescence labeling the HCR reaction product to obtain a product to be detected; detecting the fluorescent signal of the product to be detected by adopting a flow type fluorescent detector, and determining whether 1 or more target miRNAs are contained according to whether the fluorescent signal is contained; if the fluorescence signal exists, the target miRNA exists, and if the fluorescence signal does not exist, the target miRNA does not exist.

(II) detecting the content of target miRNA in the RNA to be detected

1. Establishing a standard curve:

Replacing the RNA to be detected in the method (I) with target miRNA standard products with different concentrations to obtain the fluorescence intensities of the target miRNA standard products with different concentrations, and making a standard curve by using the concentrations of the target miRNA standard products with different concentrations and the respective corresponding fluorescence intensities;

2. detecting the RNA to be detected by adopting the step I in the method to obtain the fluorescence intensity of the target miRNA in the RNA to be detected;

3. and substituting the fluorescence intensity of the target miRNA in the RNA to be detected into the standard curve to obtain the content of the target miRNA in the RNA to be detected.

Example 2 detection of the inclusion of let-7a by liquid-phase chip of HCR-based miRNAs

and (3) querying the sequences of let-7a and miR-21 by using a miRBase database:

let-7a：5'-UGAGGUAGUAGGUUGUAUAGUU-3'；

miR-21：5'-UAGCUUAUCAGACUGAUGUUGA-3'。

Artificially synthesizing let-7a and miR-21, diluting to 100 mu M with TE buffer solution, and storing at-20 ℃ to obtain a standard substance solution of let-7a to be detected and a standard substance solution of miRNA21 to be detected.

HCR-based miRNAs liquid-phase chip for detecting let-7a content

1. selection of microspheres and design Synthesis of DNA hairpin probes

1) selection of microspheres

Purchase Nos. 12 and 26-TAG^TMthe microspheres are respectively used for detecting the content of let-7a and miR-21. Among them, number 12-TAG^TMthe capture sequence crosslinked on the microspheres is: 5'-AGTAGAAAGTTGAAATTGATTATG-3' (microsphere No. 12 for detecting let-7a), No. 26-TAG^TMThe capture sequence of microsphere cross-linking is: 5'-TTTGATTTAAGAGTGTTGAATGTA-3' (microsphere No. 26 for detection of miR-21).

all microspheres were stored at 4 ℃ in the dark.

Each probe-immobilized microsphere has a unique fluorescent code.

2) Designing and synthesizing a probe M, a probe 1 and a probe 2 corresponding to let-7a and miR-21

Designing and synthesizing corresponding DNA hairpin structure probes 7a-M, 7a-1 and 7a-2 (see table 1) according to the let-7a sequence and the capture sequence on the No. 12 microsphere;

According to the miR-21 sequence and the capture sequence on the microsphere No. 26, corresponding DNA hairpin structure probes 21-M, 21-1 and 21-2 are designed and synthesized (see table 1).

probes 7 a-M: the 45 th to 68 th sites of the sequence 1 are complementary sequences of the capture sequence of the microsphere No. 12, the 23 th to 44 th sites are complementary sequences of let-7a, and the 1 st to 22 th sites of HCR priming strand;

Probe 7 a-1: the 1 st to 22 th sites of the sequence 2 are HCR priming strand complementary sequences, and the 23 rd to 44 th sites are let-7a nucleotide sequences;

probe 7 a-2: AACTATACAACCTACTACCTCA at positions 23-44 of the sequence 3 are complementary sequences of let-7a, and HCR priming strands at positions 1-22;

probe 21-M: the 45 th to 68 th of the sequence 4 are complementary sequences of a capture sequence of the microsphere No. 26, the 23 th to 44 th sites are complementary sequences of miR-21, and the 1 st to 22 th sites are HCR initiation chains;

Probe 21-1: the 1 st to 22 th sites of the sequence 5 are HCR initiation strand complementary sequences, and the 23 th to 44 th sites are miR-21 nucleotide sequences;

Probe 21-2: 23 th to 44 th sites of the sequence 6 are complementary sequences of miR-21, and 1 st to 22 th sites are HCR priming strands.

The 3' end of the probe M is complementary to the capture sequence on the microsphere, and the 5' end of the probe 1 and the 3' end of the probe 2 are labeled with biotin.

the probes used in the experiments were purified by High Performance Liquid Chromatography (HPLC), diluted to 100. mu.M in TE buffer and stored at-20 ℃.

Table 1 shows DNA hairpin probe sequences and labels used for let-7a and miR-21 liquid-phase chip detection

3) probe pretreatment

The prepared buffer solution A is used to dilute the probe 7a-M to 10nM, and the probe 7a-1 and the probe 7a-2 are respectively diluted to 50 nM. After the three probes are diluted, the three probes are put into a PCR instrument for pretreatment to obtain a pretreated probe 7a-M solution, a pretreated probe 7a-1 solution and a pretreated probe 7a-2 solution which are in a stem-loop structure.

The pretreatment procedure of the PCR instrument is as follows: 95 deg.C for 5min, 90 deg.C for 3min, 85 deg.C for 3min, 80 deg.C for 3min, 75 deg.C for 3min, 70 deg.C for 3min, 65 deg.C for 3min, 60 deg.C for 3min, 55 deg.C for 3min, 50 deg.C for 3min, 45 deg.C for 3min, 40 deg.C for 3min, and 37 deg.C for 30 min.

The treatment methods of the probes 21-M, 21-1 and 21-2 are the same as above.

2、

1) Attaching probes M to microspheres to obtain microsphere-probe complexes

Number 12 to be purchased-TAG^TMthe microspheres were diluted to 2.5X 10 with buffer A⁵After each ml, taking 10 mul, namely ensuring that each reaction system contains 2500 microspheres, mixing with 10 mul of pretreated probe 7a-M solution (10nM), putting into a constant-temperature mixer, and incubating for 1h at 37 ℃ at the rotating speed of 400rpm (rotating radius of 3mm) to obtain 20 mul of microsphere-probe composite system; the proportion of the microspheres to the pretreated probes 7a-M is 2500: 100 fmol.

2) hybridization of the sample to be tested with the microsphere-probe complex

Adding 5 mul of let-7a standard substance solution to be detected (the concentration of RNA is 10) into 20 mul of the microsphere-probe complex system obtained in the step 1)⁷fM, amount of substance 5X 10^-7pmol), vortex mixing for 5s, placing into a constant temperature mixer, incubating for 1h at 37 ℃ at the rotation speed of 400rpm, and hybridizing let-7a and the microsphere-probe complex to obtain 25 mul of a hybridized system, wherein the hybridized system contains a sample-microsphere-probe complex.

3) HCR reaction

and mixing 10 mu l of the solution 7a-1 of the probe after 50nM pretreatment and 10 mu l of the solution 7a-2 of the probe after 50nM pretreatment in equal volume (molar ratio is 1:1), adding 20 mu l of the mixed solution into 25 mu l of the system after hybridization obtained in the step 3), uniformly mixing by vortex for 5s, putting into a constant-temperature mixer, and incubating for 20min at 37 ℃ at the rotating speed of 400rpm to perform HCR reaction, thereby obtaining 45 mu l of HCR reaction system, wherein the reaction product contains HCR reaction products.

and (3) sealing: before fluorescent labeling, 10 mul of BSA aqueous solution with the mass percentage content of 2.5% is added into the HCR reaction system, and the incubation is carried out for 10min at 37 ℃, so as to obtain a reaction system after sealing.

Washing the plate: and (3) placing the reaction system after the sealing on a magnetic separation plate, standing for 5min, removing the supernatant by a pipette gun, adding 25 mu l of buffer solution A for resuspending microspheres, and collecting all suspensions to obtain the reaction system before labeling.

3、

1) fluorescent markers

streptomycin-Phycoerythrin (Streptavidin R-Phycoerythrin, SA-PE) was diluted to 2 ng/. mu.l with rnaefree water for fluorescent labeling, and prepared for each experiment to give a SA-PE solution.

and adding 75 mul of diluted SA-PE solution into 25 mul of the reaction system before marking, mixing uniformly by vortex for 5s, and incubating for 30min at 20 ℃ in a constant-temperature mixer at the rotating speed of 200rpm to obtain the system to be detected.

2) luminex detection of fluorescent signals

and transferring the system to be detected into a 96-hole detection plate, and detecting the fluorescence signal of each hole by a flow type fluorescence detector Luminex 200.

For each assay, a volume of 80. mu.l of reaction solution was aspirated, and the fluorescence signals of 100 # 12 microspheres were read.

and determining whether the target miRNA is contained according to whether the fluorescent signal is contained, wherein if the fluorescent signal is contained, the target miRNA exists, and if the fluorescent signal is not contained, the target miRNA does not exist.

the standard solution of the let-7a to be detected can be detected by the method.

The miRNA21 standard solution to be detected can be detected by the same method.

secondly, verifying whether let-7a can trigger HCR reaction

The stem-loop probes designed in this experiment were verified by electrophoresis in 3% agarose gel to determine whether the HCR reaction could be initiated by the miRNAs of interest.

and (3) adding 1 mul of 10 Xloading Buffer into 9 mul of sample to be detected, mixing uniformly and Loading. The gel was placed under a voltage of 200V and run for 25 min. And observing the running strip under an ultraviolet lamp, and taking a picture by a gel imaging system for storage.

the results are shown in fig. 2, and the sequence of the samples to be tested is as follows: 1 mu M let-7 a; ② 1 μ M probe 7 a-M; ③ 2 μ M of the probe 7 a-1; 2 mu M probe 7 a-2; fifthly, 1 mu M7a-M, 2 mu M7 a-1 and 2 mu M7 a-2 are mixed and incubated for 1 h; sixthly, mixing 1 mu M7a-M and 1 mu M let-7a, and incubating for 1 h; seventhly, mixing and incubating 1 mu M7a-M, 2 mu M7 a-1, 2 mu M7 a-2 and 1 mu M let-7a for 1 h. When 7a-M, 7a-1 and 7a-2 were present in the mixture at the same time, the electrophoresis showed only one band (band 5), indicating that no HCR was formed at this time [7a-1/7a22 ]]_nand (3) a composite structure. When let-7a is added into the system and mixed and incubated for 1h, a band larger than 100bp appears, and bands at the positions of 7a-1 and 7a-2 are obviously weakened (band 7), which indicates that the existence of let-7a triggers HCR reaction.

Third, optimization of parameters in method

Optimizing each parameter in the first step, specifically as follows:

A. optimizing probe concentration

1. Selection of microspheres and design Synthesis of DNA hairpin probes

1) And selecting the microspheres: is the same as one;

2) and designing and synthesizing a probe M, a probe 1 and a probe 2 corresponding to the let-7 a: is the same as one;

3) And probe pretreatment: diluting the probe 7a-M to 10nM with the prepared buffer solution A, and respectively diluting the probe 7a-1 and the probe 7a-2 to 20nM, 50nM and 100 nM;

2、

1) Attaching the probe M to the microsphere to obtain a microsphere-probe complex: adding the 10nM probes M into the reaction according to the method of one;

2) Let-7a standard solution to be tested was diluted with buffer A to 6 consecutive concentration gradients (10)²fM～10⁷fM) and performing addition reaction according to the method in the step one;

3) HCR reaction: adding probes 7a-1 and 7a-2 of 20nM, 50nM and 100nM and probes 7a-1 and 20nM, 50nM and 100nM, respectively, into the reaction according to the method of one;

3、

1) fluorescence labeling: is the same as one;

2) luminex detection of fluorescence signals: is the same as one;

3 replicate wells were made for each reaction to find the optimal probe concentration for detecting let-7 a.

As a result, as shown in FIG. 3A, although the fluorescence signal increases with the increase in the concentration of the probes 7a-1 and 7a-2, the dispersion(s) of the respective detection values also increases, which indicates that the stability and reproducibility of the detection system are significantly reduced. In order to make the liquid-phase chip detection system realize signal amplification and have optimal quantitative capability, the DNA hairpin structure probe concentration of 50nM is selected for subsequent experiments.

Therefore, the optimal probe concentrations were 10nM probe 7a-M solution, 50nM probe 7a-1 solution and 50nM 7a-2 solution.

B. Optimization of reaction time

1. Selection of microspheres and design Synthesis of DNA hairpin probes

1) And selecting the microspheres: is the same as one;

3) And probe pretreatment: diluting the probe 7a-M to 10nM with the prepared buffer solution A, and respectively diluting the probe 7a-1 and the probe 7a-2 to 50 nM;

2、

3) HCR reaction: as for one, 50nM probe 7a-1 and 50nM probe 7a-2 were added to the reaction according to one method, respectively; except that the incubation is performed under oscillation at 37 ℃ for 10min, 20min, 30min, 40min, 50min and 60min respectively;

3、

1) fluorescence labeling: is the same as one;

2) luminex detection of fluorescence signals: is the same as one;

the effect of different HCR reaction times on the fluorescence signal was observed. 3 replicates were done per reaction.

As a result, as shown in FIG. 3B, the fluorescence signal value was observed as a function of the reaction time of HCR at a probe concentration of 50nM, and the correlation coefficient R between the fluorescence intensity and let-7a was found²Gradually rises along with the prolonging of the incubation time within the range of 10min to 20min, slowly falls after 20min, and simultaneously falls of the stability of the detection system. Thus, an HCR reaction time of 20min was selected for subsequent experiments.

the HCR reaction time was therefore 20 min.

Fourth, specific detection

the sequences of miRNAs detecting the let-7 family were as follows:

let-7a UGAGGUAGUAGGUUGUAUAGUU

let-7b UGAGGUAGUAGGUUGUGUGGUU

let-7c UGAGGUAGUAGGUUGUAUGGUU

let-7d AGAGGUAGUAGGUUGCAUAGUU

let-7e UGAGGUAGGAGGUUGUAUAGUU

let-7f UGAGGUAGUAGAUUGUAUAGUU

let-7g UGAGGUAGUAGUUUGUACAGUU

let-7i UGAGGUAGUAGUUUGUGCUGUU。

And diluting 1pM with buffer solution A to obtain the RNA solution to be detected, wherein the buffer solution A is used for diluting let-7a, let-7b, let-7c, let-7d, let-7e, let-7f, let-7g and let-7 i.

1. selection of microspheres and design Synthesis of DNA hairpin probes

1) And selecting the microspheres: is the same as one;

2、

2) Adding the RNA solution to be detected into the buffer solution A for reaction according to the method in the step I;

3) HCR reaction: adding 50nM probe 7a-1 and 50nM probe 7a-2 into the reaction according to one method;

3、

1) Fluorescence labeling: is the same as one;

2) Luminex detection of fluorescence signals: is the same as one;

Each sample was tested in duplicate 3 times.

The results are shown in fig. 5, and under the same experimental conditions, the fluorescence signals of 7 miRNAs except let-7a are close to the background value, which shows that only let-7a can trigger HCR reaction to generate high-intensity fluorescence signals, suggesting that the method can effectively distinguish sequence differences of different miRNAs and has good specificity.

Example 3 detection of target miRNA content in test RNA

(one) establishing a standard curve

And diluting 100 mu M of the standard solution of the let-7a to be detected into 6 continuous concentration gradients of 0.1pM, 1pM, 10pM, 100pM, 1nM and 10nM by using the buffer solution A as the standard solution of the let-7a to be detected with different concentrations.

1. Selection of microspheres and design Synthesis of DNA hairpin probes

1) Selecting microspheres: same as one of embodiment 2;

2) Designing and synthesizing a probe M, a probe 1 and a probe 2 which respectively correspond to the let-7a and the miR-21: same as one of embodiment 2;

3) Pretreatment of the probe: same as one of embodiment 2;

2、

1) Attaching the probe M to the microsphere to obtain a microsphere-probe complex: same as one of embodiment 2;

2) Hybridizing a sample to be detected with the microsphere-probe complex: the RNA solutions to be detected are 0.1pM, 1pM, 10pM, 100pM, 1nM and 10nM standard solutions of let-7a to be detected respectively, and the rest of the methods are the same as those in the embodiment 2;

3) HCR reaction: same as one of embodiment 2;

3、

1) fluorescence labeling: same as one of embodiment 2;

2) luminex detection of fluorescence signals: same as one of embodiment 2;

Each sample was tested in duplicate 3 times. Analyzing and drawing a standard curve by using Excel software and calculating a correlation coefficient R²。

results fig. 4 shows that there is a significant correlation between fluorescence intensity and actual amount of let-7a (R)²0.97946) and is linearly related in the range of 0.1pM to 10nM, expressed as log₁₀I＝0.0628log₁₀C +2.9714, wherein I is fluorescence intensity and C is let-7a concentration. According to the result, the limit of quantitation of the miRNAs detected by the method is 0.1pM, which indicates that the method has higher sensitivity.

Fig. 4B is a standard curve.

(II) detecting the content of let-7a in the RNA sample to be detected

Firstly, preparing RNA to be detected containing let-7a

1. Extracting RNA in sample to be detected

taking 800 mu l of mixed plasma of healthy people, averagely dividing into 4 parts, and extracting miRNAs by using a miRcute miRNA Isolation Kit, wherein the extraction steps are as follows:

1) mu.l of plasma was added to 200. mu.l of the lysate, shaken vigorously for 30s, and allowed to stand at room temperature for 5 min.

2) centrifuge at 12,000rpm for 10min and take the supernatant and add to another centrifuge tube.

3) 200. mu.l of chloroform was added thereto, followed by vigorous shaking for 15 seconds and standing at room temperature for 5 min.

4) The mixture was centrifuged at 12,000rpm for 15min, and 200. mu.l of the upper aqueous phase was taken.

5) adding 60 μ l of anhydrous ethanol, mixing, and transferring to an adsorption column miRspin.

6) after the column was left at room temperature for 2min, it was centrifuged at 12,000rpm for 30s, and the column was discarded to leave the liquid.

7) Adding 180. mu.l of absolute ethyl alcohol into the residual liquid, uniformly mixing, and transferring to an adsorption column miRelute.

8) after standing at room temperature for 2min, the column was centrifuged at 12,000rpm for 30s, and the column was retained.

9) adding 500 μ l deproteinized solution into MIRelute, standing for 2min, centrifuging at 12,000rpm for 30s, and discarding the solution.

10) Add 500. mu.l of washing solution to MiRelute, let stand for 2min, centrifuge at 12,000rpm for 30s, discard the solution. And repeating the steps once.

11) after centrifugation at 12,000rmp for 1min, air dried to remove residual liquid.

12) Transferring the adsorption column miRelute into a new 1.5ml centrifuge tube, adding 20. mu.l of RNase-free water, and standing at room temperature for 5 min.

13) centrifuging at 12,000rmp for 2min, and collecting RNA solution to obtain 4 parts of RNA extract.

(2) Detecting fluorescent signals

2. Dilution of

Mixing 4 parts of RNA extract into 80 μ l, taking 10 μ l, adding 40 μ l buffer A to prepare 20% (volume percentage, in the embodiment of dilution multiple) plasma RNA diluent; mu.l of the buffer A was added to 20. mu.l of the sample to prepare a 50% plasma RNA dilution.

After diluting the let-7a standard solution to 5pM, 500pM and 50nM, respectively, 2. mu.l of the above 20%, 50% and undiluted (100%) RNA extracts were added to 8. mu.l of each sample to obtain different concentrations of let-7 a-containing test RNA.

Secondly, detecting the content of let-7a in the RNA to be detected

1. Selection of microspheres and design Synthesis of DNA hairpin probes

1) Selecting microspheres: same as one of embodiment 2;

3) pretreatment of the probe: same as one of embodiment 2;

2、

2) Hybridizing a sample to be detected with the microsphere-probe complex: the RNA solutions to be detected are respectively the prepared RNA to be detected containing let-7a with different concentrations, and the rest methods are the same as those of the embodiment 2;

3) HCR reaction: same as one of embodiment 2;

3、

1) fluorescence labeling: same as one of embodiment 2;

2) Luminex detection of fluorescence signals: same as one of embodiment 2;

Detecting the background signal of let-7a in plasma RNA extract at each concentration, and the fluorescence signal after adding let-7a with known concentration, and calculating the concentration of corresponding let-7a by using a standard curve.

The recovery rate is [ (measured value) - (background value)/amount added ] × 100%. Each sample was tested in duplicate.

the results are shown in Table 2. Because the content of endogenous let-7 in blood plasma is lower than the detection limit of the method, the background content is set as 0 because the content cannot be detected. According to the results, the recovery rate of let-7a in 20% of plasma RNA extract detected by the liquid phase chip is 81.06% -117.99%, which indicates that the method has better accuracy in detecting the plasma miRNAs under the dilution factor. However, recovery rates of greater than 80% or less than 120% occurred when the dilution factor was increased to 50% or 100%, indicating that complex components in plasma interfere with the detection of fluorescent signals with increasing plasma concentration, and that this interference appears primarily as signal suppression when the concentration of miRNAs in serum is low.

TABLE 2 HCR-based liquid phase chip assay for let-7a in plasma

example 4 simultaneous detection of let-7a and miR-21 in RNA to be detected

let-7a and miR-21 standards were diluted to 1. mu.M with TE buffer, 10. mu.l each was added to 80. mu.l of TE buffer to give 100nM concentration of each miRNAs, and the mixed miRNAs were diluted to 7 consecutive concentration gradients with buffer A: 10⁷fM、10⁶fM、10⁵fM、10⁴fM、10³fM、10²fM, 10 fM.

1. Selection of microspheres and design Synthesis of DNA hairpin probes

1) Selecting microspheres: same as one of embodiment 2;

3) Pretreatment of the probe: probe 7a-M was diluted to 20nM with TE buffer; diluting 7a-1 and 7a-2 to 100 nM; probe 21-M was diluted to 200 nM; probes 21-1 and 21-2 were diluted to 1000nM and then pre-treated in a PCR machine (same as in example 1). After pretreatment, mixing 7a-M and 21-M in equal volume; 7a-1, 7a-2, 21-1, 21-2 are mixed in equal volumes.

2、

1) attaching the probe M to the microsphere to obtain a microsphere-probe complex: essentially the same as in example 1, except that:

the purchased microspheres No. 12 and No. 26 were mixed in equal volumes and diluted with buffer A to a concentration of 2.5X 10 per microsphere⁵One per ml. Adding 10 μ l of mixed microspheres into 10 μ l of pretreated probe M mixed solution, and mixing at constant temperatureThe mixture was incubated at 37 ℃ for 1h at 400 rpm.

2) hybridizing a sample to be detected with the microsphere-probe complex: the RNA solutions to be tested were 10 each⁷fM、10⁶fM、10⁵fM、10⁴fM、10³fM、10²the samples to be tested of fM and 10fM are basically the same as in example 1, except that:

adding 5 mul of miRNAs mixed solution with each concentration into the system, vortex mixing uniformly for 5s, putting into a constant temperature mixer, and incubating for 1h at 37 ℃ at the rotating speed of 400rpm to enable each miRNAs to be hybridized with the corresponding microsphere-probe compound.

3) HCR reaction: basically the same as the second embodiment 1 except that:

and (3) adding 20 mu l of the pretreated mixed solution of 7a-1, 7a-2, 21-1 and 21-2 into the reaction system, uniformly mixing by vortex for 5s, placing into a constant-temperature mixer, and incubating at 37 ℃ for 20min at the rotating speed of 400rpm to perform HCR reaction.

3、

1) fluorescence labeling: same as one of embodiment 2;

2) Luminex detection of fluorescence signals: same as one of embodiment 2;

the results are shown in FIG. 6, the fluorescence intensity of the two miRNAs in single index detection is similar to that of the multiple detection, and the method has no cross interference among signals in the multiple detection.

And drawing a standard curve of the miR-21 in multiple detection. As shown in FIG. 7, the fluorescence intensity and content of miR-21 are linearly related in the range of 10fM to 10nM, and are expressed as log₁₀I＝0.1781log₁₀C+1.4703(R²0.93904) where I is the fluorescence intensity and C is the concentration of miRNAs. It can be seen that the present method has excellent quantification capability for each miRNAs even if 2 miRNAs are detected simultaneously.

Claims

1. A method for detecting the content of a target miRNA in an RNA to be detected, which is not used for disease diagnosis and treatment, comprising the steps of:

The probe M, probe 1 and probe 2 for each target miRNA are as follows:

the specific binding is complementary; the single-stranded DNA molecule a is complementarily paired with the single-stranded DNA molecule a, and the single-stranded DNA molecule c is complementarily paired with the single-stranded DNA molecule c;

Each target miRNA corresponds to one microsphere;

The fluorescence color of each microsphere is different;

C. substituting the fluorescence intensity of the target miRNA in the RNA to be detected into the standard curve to obtain the content of the target miRNA in the RNA to be detected;

The step 2) comprises the following steps a-c:

c. Uniformly mixing the probe 1 solution corresponding to the target miRNA, the probe 2 solution corresponding to the target miRNA and different systems containing the sample-microsphere-probe compound to obtain a reaction system 3, and carrying out HCR reaction to obtain different HCR reaction products;

the 5 'end and the 3' end of the probe 1 and the probe 2 are labeled with biotin;

The fluorescence-labeled marker is streptomycin-phycoerythrin;

The reaction condition of the mark is incubation for 30min at 20 ℃ under the rotation speed of 200 rpm;

The method also comprises the following steps between the step 1) and the step 2): and performing denaturation annealing on the probe M, the probe 1 and the probe 2 to obtain a treated probe M, a treated probe 1 and a treated probe 2.

2. The method of claim 1, wherein:

in the step 2), the solute ratios of the added solutions are as follows:

the probe M comprises the following components: the target miRNA standard solutions with different concentrations are as follows: the probe 1: the probe 2 is 100 fmol: 2500: 5X 10^-7pmol-5×10^-2 pmol：500 fmol：500 fmol；

Between steps 2) and 3), the following steps are also included: sequentially blocking and washing the HCR reaction product;

In the step 3), a flow type fluorescence detector is adopted for detection.

3. The method of claim 2, wherein:

the concentration of the probe M solution is 10 nM; the adding volume of the probe M solution is 10 mu l;

Or, the concentration of the microsphere solution is 2.5 multiplied by 10⁵per ml, said microspheresThe volume of the solution added was 10. mu.l;

Or, the concentration of the target miRNA standard solutions with different concentrations is 10^-1 pM-10⁴pM, the adding volume of the target miRNA standard solution with different concentrations is 5 mul;

4. A method according to claim 2 or 3, characterized in that:

The reaction conditions are all incubation for 1h at 37 ℃ at the rotating speed of 400 rpm;

5. The method of claim 1, wherein:

The RNA to be detected is derived from a cell-free body fluid sample.

6. The method of claim 5, wherein:

the cell-free body fluid sample is isolated serum or isolated plasma.

7. The method of claim 1, wherein:

The target miRNA is let-7a or miR 21;