CN106636329B - Specific method for detecting trace circulating tumor cells in blood of mammal - Google Patents
Specific method for detecting trace circulating tumor cells in blood of mammal Download PDFInfo
- Publication number
- CN106636329B CN106636329B CN201610858045.1A CN201610858045A CN106636329B CN 106636329 B CN106636329 B CN 106636329B CN 201610858045 A CN201610858045 A CN 201610858045A CN 106636329 B CN106636329 B CN 106636329B
- Authority
- CN
- China
- Prior art keywords
- circulating tumor
- tumor cells
- pdn
- dna1
- blood
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6804—Nucleic acid analysis using immunogens
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56966—Animal cells
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Organic Chemistry (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Hematology (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Urology & Nephrology (AREA)
- Biomedical Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Pathology (AREA)
- Cell Biology (AREA)
- Medicinal Chemistry (AREA)
- General Physics & Mathematics (AREA)
- Biophysics (AREA)
- Food Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Virology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Hospice & Palliative Care (AREA)
- Oncology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a specificity method for detecting trace circulating tumor cells in blood of mammals, a DNA nano device (PDN) designed according to the method can be specifically combined with high-expression protein on the surface of the circulating tumor cells, and the circulating tumor cells combined with the PDN are separated from the blood by utilizing an immunomagnetic bead separation technology. PDN can be subjected to rolling circle amplification under the action of enzyme and primers, and an amplification product can be combined with a molecular beacon to realize the release and detection of fluorescence. The fluorescence intensity is directly related to the quantity of PDN, thereby achieving the purpose of ultra-sensitively detecting trace circulating tumor cells in blood. The detection method of the invention not only ensures that the detection becomes ultra-sensitive and has more specificity, but also does not need expensive instruments such as a PCR instrument and the like, effectively reduces the detection cost, improves the detection efficiency and has very high clinical application value.
Description
Technical Field
The invention relates to a specificity method for detecting micro Circulating Tumor Cells (CTC) in blood of mammals.
Background
The general term "cancer" is used to refer broadly to all malignant tumors, and tumor metastasis is one of the difficulties in tumor research work, and over 90% of cancer patients die from tumor metastasis. Metastasis is a fundamental biological feature of malignant tumors and is a major cause of treatment failure and death in the vast majority of clinical tumor patients. The tumor cells invade the peripheral tissues of the primary tumor cells, enter the blood and lymphatic system to form circulating tumor cells CTC, are transported to a far-end tissue, exude, adapt to a new microenvironment, and finally form a metastasis. Therefore, the early detection of CTC in blood plays an important guiding role in patient prognosis judgment, curative effect evaluation and individualized treatment.
Currently, emerging CTC detection technologies have become a research hotspot and are entering clinical applications. Established CTC detection methods include: polymerase chain reaction and flow cytometry (Cell search system). However, the high cost, labor and time of the instrument still severely limits the clinical application of CTCs as an indicator for early diagnosis of tumors. Therefore, it is necessary to provide a method for detecting a trace amount of CTCs, which is low in cost, simple in operation, high in sensitivity, and strong in specificity.
In recent years, nucleic acid aptamers have attracted much attention. The aptamer is a small section of oligonucleotide sequence (RNA and ssDNA) obtained by in vitro screening, has a special tertiary structure, and can be combined with corresponding ligand with strong specificity and high affinity. As a novel functional molecular probe, the aptamer is considered to be an ideal substitute of an antibody due to the characteristics of easy synthesis and modification, strong stability, low cost and the like. It can be seen that aptamer technology and its application in the biomedical field are widely used for specific recognition of target cells (especially cancer cells), diagnostic therapy, biosensing, etc.
Based on the characteristic that the aptamer can specifically recognize cancer cells, and meanwhile, the immunomagnetic bead separation technology is combined to separate circulating tumor cells in blood. The immunomagnetic bead separation technology is an immunological detection method and an antigen purification means with strong specificity, high sensitivity and good purification. At present, the technology has made great progress in the aspects of cell separation, protein, immunology, microbiological detection and the like, and is one of the technologies with the most popularization value. The method is characterized in that the immunomagnetic bead separation cell is based on the fact that cell surface antigen can be combined with specific monoclonal antibody connected with magnetic beads, in an external magnetic field, the cell connected with the magnetic beads through the antibody is adsorbed and retained in the magnetic field, and the cell without the surface antigen has no magnetism because the cell cannot be combined with the specific monoclonal antibody connected with the magnetic beads and does not stay in the magnetic field, so that the cell can be separated.
Rolling Circle Amplification (RCA) is a highly efficient isothermal nucleic acid Amplification means, and can achieve exponential Amplification of DNA or RNA in a short time, effectively amplify signals by combining with biomarkers, etc., and greatly enhance detection sensitivity. In recent years, RCA has been widely used in the fields of functional nucleic acid preparation, biosensing, nano-materials, and the like. Meanwhile, the development of the RCA technology benefits from the characteristics of high sensitivity and high specificity of the RCA technology, and the RCA technology can be combined with other high and new technologies (such as a surface modification technology, a fluorescence detection technology, a nanotechnology and the like) to open up better application prospects.
the method combines the characteristic of aptamer specific recognition and corresponding ligand, and combines the capture technology of immunomagnetic beads and RCA technology for detecting the trace CTC, and has the characteristics of strong specificity, high sensitivity, short detection time and low cost.
Disclosure of Invention
The invention aims to provide a specific method for detecting trace CTC in blood of mammals.
The technical scheme adopted by the invention is as follows:
(1) Designing and synthesizing a trace circulating tumor cell surface high-expression protein high-specificity binding proper ligand AP: designing an aptamer AP capable of being highly specifically combined with a protein to be detected by taking the highly expressed protein on the surface of peripheral blood CTC of a blood sample as a template based on a Cell-SELEX technology;
Designing primers DNA1 and DNA2 which can be connected with AP into a plurality of rings according to the base complementary pairing principle; wherein, the DNA1 and the DNA2 have two sections of identical sequence fragments of (I) and (II), rolling circle amplification primers (RCA primers) are designed according to the fragment of (I), and Molecular Beacons (MB) are designed according to the fragment of (II);
(2) The aptamer AP is subjected to cyclization reaction to obtainCAP, ring Generation Using the same methodCDNA1 and LoopCDNA2；
(3) preparing a DNA nano device PDN: subjecting the product obtained in step (2)CAP、CDNA1、CMixing and hybridizing the DNA2 in a molar ratio of 1:1:1-1:5:5 to obtain a DNA nano device (PDN);
(4) Separation of the mononuclear cell layer where the trace circulating tumor cells are located: processing a blood sample to be detected by using a gradient separation liquid, and separating out a mononuclear cell layer where target CTC is located;
(5) labeling target cells CTC in the monocyte layer with a DNA nano-device PDN: mixing and co-incubating the cells separated in the step (4), the product PDN in the step (3) and specific immunomagnetic beads;
(6) Separating PDN marked CTC by an immunomagnetic bead method: eluting the incubation liquid in the step (5) by using an immunomagnetic bead separation technology to obtain target cells combined with PDN;
(7) the rolling circle amplification method is used for measuring the cell number of the trace circulating tumor cells: adding RCA primer into the product obtained in the step (6) to perform rolling circle amplification, adding the molecular beacon MB into the rolling circle amplification product to incubate, opening the hairpin structure of the MB under the competition effect of base complementation, and detecting the fluorescence value after the release of the fluorescence signal so as to judge the number of CTC.
The method of the invention can be used for rapidly and efficiently detecting the number of CTC in the peripheral blood of cancer patients. The detection method of the invention avoids the problems of using large-scale expensive instruments such as a PCR instrument, a flow cytometer and the like, consuming long time and the like, and effectively reduces the detection cost of the circulating tumor cells CTC in the peripheral blood of cancer patients.
The detection method is cheap and simple, and compared with the existing detection method, the new method has the characteristics of short time, high specificity and ultrasensitiveness. The invention can be used for detecting trace CTC in peripheral blood of cancer patients.
drawings
FIG. 1: the individual components of the PDN and the electropherogram of the PDN (12% polyacrylamide gel) are shown in the invention. In the figure: DNA Molecular Weight standards (Low Molecular Weight DNA Ladder) from marker lane; lane 1 is:CDNA 2; 2 swimmingThe method comprises the following steps:CDNA 1; lane 3 is:CAP; lane 4 is:CDNA1+CDNA 2; lane 5 is: PDN.
FIG. 2: panel A shows fluorescence values as a function of cell number and panel B shows a standard curve of fluorescence maximum absorbance at 518nm as a function of CTC number.
Detailed Description
example 1
The invention will be better illustrated with reference to the following examples.
Establishment of new method for detecting CTC in peripheral blood of breast cancer patient
First, primer design
an aptamer EAD capable of being specifically combined with an Epcam protein is designed by taking a highly expressed protein Epcam on the surface of CTC (CTC) of a patient blood sample to be detected as a template and based on a Cell-SELEX technology, and the sequence of the EAD is as follows: CACTACAGAGGTTGCGTCTGTCCCACGTTGTCATGGGGGGTTGGCCTGGAATCAATCTGAATCAATCTACGACGTACTCCTAACTAGCT, respectively;
Designing primers DNA1 and DNA2 which can be connected with EAD into a plurality of rings according to the base complementary pairing principle; the DNA1 and the DNA2 have two sections of identical sequence segments of (I) and (II), rolling circle amplification primers (RCA primers) are designed according to the segment of (I), and Molecular Beacons (MB) are designed according to the segment of (II).
the primer sequences used were as follows:
DNA1：
TAGACTTAGTTAGATGCTGCTCCGCCCGTCCCACGTACTTTTTATGTTCTCTCTCTTGCCTCTGtcccacgtccgtctc
DNA2：
GGCAAGAGAGAGAACATAAATCCGCCCGTCCCACGTACTTATCTGAATCAATCTACGACGtcccacgtccgtctc
RCA-primer：AGGGTGCAGGCAGAG
MB：(FAM)GAGTCGCTCCGCCCGTCCCACGTACTTTTAAG GCGACTC(DABCYL)
Second, aptamer cyclization and PDN synthesis
Performing cyclization reaction on EAD diluted to 10 mu M to obtain ringCEAD, ring formation Using the same methodCDNA1 and LoopCDNA 2; then the obtainedCEAD、CDNA1 andCDNA2 was mixed at a 1:3:3 molar ratio under the following reaction conditions: annealing at 90 ℃ for 5min, cooling to room temperature, and reacting at 37 ℃ for 1h to obtain a PDN product.
The cyclization reaction comprises the following specific steps:
(1) phosphorylation reaction: taking 1.5ml centrifuge tube, adding ddH respectively2O 76.5μl、10×Polynucleotide Kinase Buffer 10μl、ATP 3μl、T4polynucleotide Kinase 3. mu.l and Aptamer 7.5. mu.l, the total amount was 100. mu.l. Mixing, placing in constant temperature metal bath at 37 deg.C, oscillating for 30min, annealing at 90 deg.C for 5min, and cooling to room temperature.
(2) Ligase ligation: to the above aptamer phosphorylation product were added 10 XLigase Buffer 15. mu.l, Templete 10. mu.l and ddH2O21 mu l, mixing evenly, putting the mixture into a constant temperature metal bath for annealing at 90 ℃ for 5min, and oscillating and reacting at 55 ℃ for 2 h. After the reaction product is cooled to room temperature, T is added4Reacting 4 mu l of DNA Ligase in a metal bath at 16 ℃ for 2h, inactivating the DNA Ligase for 10min at 65 ℃ after the reaction is finished, and cooling the reaction product to room temperature.
(3) De-templete: adding ddH into the reaction system2O 27μl、10×T4Polymer ase Buffer 15. mu.l and T43 mul of Polymerase, mixing uniformly, carrying out oscillation reaction for 16h at the constant temperature of a metal bath at 37 ℃, inactivating for 10min at 85 ℃ after finishing, and cooling to room temperature.
(4) And (3) purifying a product: about 200. mu.l of the above reaction system was added with 1/10 volumes of 3M sodium acetate solution (20. mu.l) and 2.5 volumes of absolute ethanol (500. mu.l), mixed well, placed at-20 ℃ for 1h vertically, after completion, centrifuged at 15,000g at 4 ℃ for 30min, the supernatant was discarded, and the bottom precipitate was retained. The precipitate was broken up with 500. mu.l of 70% ethanol (-20 ℃), centrifuged at 15,000g at 4 ℃ for 30min, the supernatant discarded, the bottom precipitate retained and the procedure repeated once. Finally, the product was spin dried in a vacuum pump centrifuge concentrator. When in use, 50 μ l ddH is added2dissolving O to obtain the final product.
selection of immunomagnetic beads
Finished product immunomagnetic beads that can be combined with CTCs are ordered according to the type of CTC desired to be detected.
Fourth, establishment of CTC detection standard curve
breast cancer BT474 cells were placed in the blood to mimic CTCs.
BT474 cells (the number of the cells is 0, 10, 50, 100, 500 and 1.0 multiplied by 10) with different concentration gradients3、5.0×103、1.0×104、5.0×104、1.0×106) Incubate with 10. mu.l PDN for 2h at 37 ℃ respectively. The low-speed centrifugation was repeated 3 times to wash away unbound PDN. 10 μ M RCA-primer 6 μ L was left to stand at room temperature for 0.5h in the incubation solution, followed by addition of 10 μ M RCA-primer 6 μ L, 10 mM dNTP 3 μ L, 5 u/. mu.L phi29 polymerase 0.5 μ L, phi29 DNApolymerase buffer (10 ×) 5 μ L and ddH2o A total volume of 200. mu.L was subjected to a rolling circle reaction at 37 ℃ for 4 hours.
Adding MB 6 muL diluted to 10 muM into the rolling ring reaction product of the step, annealing for 5min at 90 ℃, standing for 1h at room temperature, and detecting the fluorescence value by using a fluorescence spectrometer (the fluorescence detection condition is that the emission wavelength is 518nm, the detection range is 500-600nm, and the room temperature).
The graph of the fluorescence value versus the number of cells and the CTC assay standard curve obtained in this way are shown in fig. 2, and it can be seen that the fluorescence value increases with the increase in the number of cells. Correlation coefficient R of linear regression equation from standard curve2It can be seen that BT474 cell numbers have a linear positive correlation with fluorescence values, so this regression equation can be used for the calculation of CTC numbers in blood samples.
Application of PDN in clinical blood sample detection
The results of the tests carried out on blood samples of three clinical patients with breast cancer, randomized and different stages of the tumor, according to the method of the invention, were shown in Table 1, by substituting the fluorescence values detected (maximum absorbance at 518 nm) into the standard curve and calculating the number of CTCs contained in the blood samples.
TABLE 1 results of this method on the detection of CTC in samples of cancer patients at random different stages
As can be seen from the results of clinical blood sample detection, the number of CTC detected by the method of the present invention is consistent with the tumor stage of cancer patients, so the method of the present invention has high clinical application value.
The method can realize strong specificity of detection according to the protein highly expressed on the surface of CTC and the circular specific aptamer designed by the Cell-SELEX technology, and performs fluorescence detection based on the application of RCA (Rolling circle amplification) of polycyclic connection, thereby greatly improving the detection efficiency and realizing the ultra-sensitive detection of 10 CTC in blood. The method of the invention avoids the problems of using large expensive instruments such as a PCR instrument, a flow cytometer and the like, consuming long time and the like, effectively reduces the detection cost of the CTC of the circulating tumor cells in the peripheral blood of the cancer patient, and realizes the trace detection of the CTC in the peripheral blood of the cancer patient.
The above description is only a preferred embodiment of the present invention, and all equivalent changes and modifications made in accordance with the claims of the present invention should be covered by the present invention.
<110> Fuzhou university
<120> a specific method for detecting trace circulating tumor cells in blood of mammals
<130> 5
<160> 5
<170> PatentIn version 3.3
<210> 1
<211> 89
<212> DNA
<213> EAD
<400> 1
cactacagag gttgcgtctg tcccacgttg tcatgggggg ttggcctgga atcaatctga 60
atcaatctac gacgtactcc taactagct 89
<210> 2
<211> 79
<212> DNA
<213> DNA1
<400> 2
tagacttagt tagatgctgc tccgcccgtc ccacgtactt tttatgttct ctctcttgcc 60
tctgtcccac gtccgtctc 79
<210> 3
<211> 75
<212> DNA
<213> DNA2
<400> 3
ggcaagagag agaacataaa tccgcccgtc ccacgtactt atctgaatca atctacgacg 60
tcccacgtcc gtctc 75
<210> 4
<211> 15
<212> DNA
<213> RCA-primer
<400> 4
agggtgcagg cagag 15
<210> 5
<211> 39
<212> DNA
<213> MB
<400> 5
gagtcgctcc gcccgtccca cgtactttta aggcgactc 39
Claims (1)
1. A kit for detecting trace circulating tumor cells in blood of a mammal is characterized in that: a method of performing the kit comprising the steps of:
(1) Designing and synthesizing a trace circulating tumor cell surface high-expression protein high-specificity binding proper ligand AP;
(2) the aptamer AP is subjected to cyclization reaction to obtainCAP；
(3) Preparing a DNA nano device PDN;
(4) Separating a mononuclear cell layer where trace circulating tumor cells are located;
(5) Marking target trace circulating tumor cells in a monocyte layer by a DNA nano device PDN;
(6) Separating trace circulating tumor cells marked by PDN of the DNA nano device by an immunomagnetic bead method;
(7) Measuring the number of micro-circulating tumor cells by a rolling circle amplification method;
the aptamer AP in the step (1) is designed and synthesized by taking a trace amount of circulating tumor Cell surface high-expression protein as a template based on a Cell-SELEX technology;
the preparation method of the DNA nano device PDN in the step (3) comprises the following steps: designing primers DNA1 and DNA2 which can be connected with AP into a plurality of rings according to the base complementary pairing principle, wherein the DNA1 and the DNA2 have two sections of identical sequence fragments of firstly and secondly; circularization of DNA1 and DNA2 to obtainCDNA1 andCDNA2, willCAP、CDNA1、Cmixing the DNA2 according to the molar ratio of 1:1:1-1:5:5, and hybridizing to obtain a DNA nano device PDN;
the primer RCAprimer used for the rolling circle amplification in the step (7) is designed according to the same sequence segments of the DNA1 and the DNA 2; the molecular beacon MB used for rolling circle amplification was designed based on the same sequence fragments of DNA1 and DNA 2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610858045.1A CN106636329B (en) | 2016-09-28 | 2016-09-28 | Specific method for detecting trace circulating tumor cells in blood of mammal |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610858045.1A CN106636329B (en) | 2016-09-28 | 2016-09-28 | Specific method for detecting trace circulating tumor cells in blood of mammal |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106636329A CN106636329A (en) | 2017-05-10 |
| CN106636329B true CN106636329B (en) | 2019-12-17 |
Family
ID=58853403
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610858045.1A Active CN106636329B (en) | 2016-09-28 | 2016-09-28 | Specific method for detecting trace circulating tumor cells in blood of mammal |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106636329B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112014563B (en) * | 2020-08-27 | 2022-02-15 | 武汉大学 | Molecular beacon transmission nano probe for directly detecting circulating tumor cells in blood, and preparation method and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103866016A (en) * | 2014-03-07 | 2014-06-18 | 复旦大学附属中山医院 | Circulating tumor cell detection kit and application thereof |
| CN104388563A (en) * | 2014-11-19 | 2015-03-04 | 上海纳米技术及应用国家工程研究中心有限公司 | Method for using DNA tetrahedron as scaffold on nano-particle surface and initiating rolling circle amplification reaction |
-
2016
- 2016-09-28 CN CN201610858045.1A patent/CN106636329B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103866016A (en) * | 2014-03-07 | 2014-06-18 | 复旦大学附属中山医院 | Circulating tumor cell detection kit and application thereof |
| CN104388563A (en) * | 2014-11-19 | 2015-03-04 | 上海纳米技术及应用国家工程研究中心有限公司 | Method for using DNA tetrahedron as scaffold on nano-particle surface and initiating rolling circle amplification reaction |
Non-Patent Citations (4)
| Title |
|---|
| A three-station DNA catenane rotary motor with controlled directionality;Chun-Hua Lu等;《Nano Letters》;20130404;第13卷;2303-2308 * |
| Aptamer-based polymerase chain reaction for ultrasensitive cell detection;Jinzhao Song等;《Chemical Communications》;20120630;第48卷;7465–7467 * |
| Immunomagnetic antibody plus aptamer pseudo-DNA nanocatenane followed by rolling circle amplication for highly-sensitive CTC detection;Jie Wang等;《Biosensors and Bioelectronic》;20180907;第122卷;239-246 * |
| 一种基于适配体修饰磁珠和SERS成像的新颖的CTC分离和检测;孙长龙;《第二十届全国色谱学术报告会及仪器展览会论文集（第三分册）》;20150430;186 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106636329A (en) | 2017-05-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Zhang et al. | Multiplexed detection of microRNAs by tuning DNA-scaffolded silver nanoclusters | |
| TWI623617B (en) | Ovarian cancer-specific aptamers and applications thereof | |
| CN105018590B (en) | Protein ligands and gene detection kit and application at the same time | |
| CN110607270B (en) | Method for jointly characterizing exosome membrane marker and RNA (ribonucleic acid) based on aptamer immune PCR (polymerase chain reaction) | |
| CN103866016A (en) | Circulating tumor cell detection kit and application thereof | |
| CN104726603B (en) | Graphene quantum dot based molecular beacon sensor as well as preparation method and application of sensor | |
| Klebes et al. | Emerging multianalyte biosensors for the simultaneous detection of protein and nucleic acid biomarkers | |
| CN108642164B (en) | MiRNA capture probe, separation and amplification integrated detection method and detection kit | |
| Seo et al. | Isothermal amplification-mediated lateral flow biosensors for in vitro diagnosis of gastric cancer-related microRNAs | |
| CN106636329B (en) | Specific method for detecting trace circulating tumor cells in blood of mammal | |
| CN111944821B (en) | Tissue sample rapid screening of colon cancer aptamer and application of tissue sample rapid screening in detection preparation | |
| CN110592186B (en) | AND molecular logic gate sensing system AND preparation method AND application thereof | |
| CN113265447A (en) | Rolling circle amplification-gold tetrahedron colorimetric detection method and kit for detecting creatine kinase isozyme | |
| CN110553991B (en) | Biological/chemical detection reagent and detection method based on hollow gold nanoparticle-DNA compound | |
| CN109266653B (en) | Reagent, device and method for capturing drug-resistant heterogeneous circulating tumor cells and performing gene analysis | |
| CN114990125A (en) | Aptamer capable of specifically recognizing positive PD-L1 and preparation method and application thereof | |
| Hu et al. | Immunomultiple PCR-based electrochemical and lateral flow strategy for the simultaneous detection of liver cancer tumor markers | |
| CN114561463B (en) | Biosensor for detecting exosomes based on rolling circle and hybridization chain reaction | |
| CN107385048B (en) | Nucleic acid composition, kit and method for detecting dendrobium officinale | |
| Huang et al. | An integrated microfluidic system for early diagnosis of breast cancer in liquid biopsy by using microrna and FET biosensors | |
| Bossmann | Liquid biopsies for early cancer detection | |
| TWI745939B (en) | A sensitive detection method of egfr mutations on circulating tumor cells in cancer patients | |
| CN110938675B (en) | siRNA directed self-assembled quantum dot biosensor and detection method and application thereof | |
| Chen et al. | DNA fragment‐assisted microfluidic chip for capture and release of circulating tumor cells | |
| CN108085386B (en) | The identification of the reference gene of osteosarcoma miRNA detection |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |