CN106191080A - CYP78A gene is increasing Semen Maydis plant height and the application strengthened in plant growing way - Google Patents
CYP78A gene is increasing Semen Maydis plant height and the application strengthened in plant growing way Download PDFInfo
- Publication number
- CN106191080A CN106191080A CN201510230547.5A CN201510230547A CN106191080A CN 106191080 A CN106191080 A CN 106191080A CN 201510230547 A CN201510230547 A CN 201510230547A CN 106191080 A CN106191080 A CN 106191080A
- Authority
- CN
- China
- Prior art keywords
- gene
- plant
- cyp78a
- semen maydis
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Abstract
The invention discloses a kind of CYP78A gene and increasing Semen Maydis plant height and the application strengthened in plant growing way, the aminoacid sequence of described CYP78A gene code is one of following or has the aminoacid sequence of more than 75% homology: SEQ ID NO:1, SEQ ID NO:2 or SEQ ID NO:3；The present invention provides a kind of new opplication of CYP78A gene, by process LAN CYP78A gene in Semen Maydis, improves plant height and the growth potential of Semen Maydis, and then the Biomass of raising Semen Maydis, and finally realizes corn yield increasing；, improve as one meanwhile, CYP78A gene is imported milpa with TEL gene association, it is achieved plant plant height increases, blade broadens, growth potential increases, Biomass increases, and ear of maize change is big, seed becomes big or becomes character mutation how.
Description
(1) technical field
The present invention relates to the application of a kind of CYP78A gene, particularly increasing Semen Maydis plant height and strengthening in plant growing way
Application.
(2) background technology
Along with the demand of grain is continuously increased by the mankind, the cultivation of high-yield crop is more and more important.Transgenic technology is
Through being widely used for improveing the character of crops, as obtain insect resistance capacity, antiweed ability, strengthen drought-resistant, anti-
Condition of disease power etc..High yield is also the important content of transgenic crop improvement.Such as, transgene expression one plant is utilized
Transcription factor (Transcription factor) yield (U.S.Pat.No.7,598,529,4) of crops can be improved.
Crop yield is a complicated quantitative trait, by the most polygenic regulation and control (Xing and Zhang, (2010)
Annual Review of Plant Biology,61:421-442).Therefore, study and excavate the new of major application value
Gene or the New function of known, and it is the most highly desirable to utilize these genes to improve crop yield.
20th century 50～the sixties, first developmental stage that the practice of China combines with plant type theory is to downgrade to educate
Kind, the research center in this stage is the plant height of crop, makes resistance to fertilizer, lodging resistance and the dense planting of kind by reducing plant height
Property be obviously enhanced, and then improve leaf area index and biological yield, thus improve the yield of crop groups.But, with
Deeply developing with production practices of plant type theoretical research, plant height had new understanding, of short stem mainly improve through
Ji coefficient, biological yield there is no significant change, it is believed that to have bigger breakthrough must have on biological yield greatly in yield
The raising of amplitude.Suitably increase some plant heights, leaf area density, beneficially CO can be reduced2Diffusion and middle and lower part leaf
The light of sheet, is clearly favourable to Biomass and later stage Grain Filling.Also there are some researches prove, plant height is with biological simultaneously
Amount is in significant positive correlation, and especially under high-yield condition, relation is the closest, and Biomass increase be grain number per spike with
The material base that mass of 1000 kernel increases.Therefore, excavating and utilize plant height controlling gene is to improve crop biomass and yield
One important channel.
Cytochrome P450 is pheron family maximum in plant, takes on important function in plant.P450
Be mainly characterized by P450 albumen known to all structures, all contain a conservative heme-binding domain, this
Domain contains conservative FxxGxRxCxG sequence.P450 has and is catalyzed activity widely, the reaction class of its catalysis
Type is extensively complicated, such as the epoxidation reaction of thiazolinyl, and the hydrocarbonylation effect of alkyl, nitrogen, sulfur, the de-alkyl effect of oxygen position,
The Oxidation of alkyl, peroxidation, desulfidation, the carbon-to-carbon rupture of oxidisability, oxidisability deamination, de-
Halogen and dehydrogenation etc. be kind more than 10.The function of plant cytochrome P450 mainly can be classified as two big classes: 1) participates in biology and closes
One-tenth approach, 2) participate in biologic detoxication approach.Participate in biosynthesis pathway plant P450 phenylpropyl alcohol alkanes, alkaloid,
Play an important role in the synthesis of terpenoid, raw cyanines glucosides class, phytohormone etc. (He et al., (2008) Pharmaceutical
Biotechnology,15:142-147)。
CYP78A is a subtribe of P450 family, has important function (Bak et al., (2011) The
Arabidopsis Book/American Society of Plant Biologists,9:e0144).Plant CYP78A gene
In, the ratio that functional study launches is CYP78A gene C YP78A1 in Semen Maydis earlier.This gene is mainly being sent out
The inflorescence educated is expressed, the metabolism of fatty acid may be participated in, but owing to not having the mutant of correspondence, CYP78A1 is at jade
Concrete function in meter is unclear (Imaishi et al., (2000) Biosci Biotech Bioch, 64:1696-1701).Intend
Cyp78a11/plastochron1 (pla1) mutant in cyp78a5/kluh (klu) mutant of south mustard and Oryza sativa L.
Show blade initial accelerate and organ diminish isophenous change (Kawakatsu et al., (2006) Plant Cell, 18:
612-625；Xiong et al.,(2006)Cell Research,16:267-276).Contrary, process LAN in arabidopsis
After CYP78A5 or CYP78A9 gene, the organ of plant becomes big (Anastasiou et al., (2007)
Developmental Cell,13:843-856).KURATA NORI etc. find process LAN CYP78A11 in Oryza sativa L.
After gene, size and the weight of grain all increase, and to the method Shen utilizing CYP78A11 gene to increase rice grain weight
Please patent (Japan Patent No.2004-017246).Li Yunhai etc. find the CYP78A6 gene in arabidopsis and
CYP78A9 gene has the function of similar regulation and control seed size, and big to utilizing CYP78A gene regulation seed
Little method application patent (U.S.Pat.No.PCT/GB2013/050072).
Although existing research find plant CYP78A gene have regulation and control blade initial (Kawakatsu et al.,
(2006)Plant Cell,18:612-625；Xiong et al., (2006) Cell Research, 16:267-276) and seed big
Little function (Anastasiou et al., (2007) Developmental Cell, 13:843-856；Japan Patent No.
2004-017246；U.S.Pat.No.PCT/GB2013/050072), but CYP78A effect in different plants also
Differ.Particularly can not deduce it to growth, growth and the yield of Semen Maydis from the function of Oryza sativa L. CYP78A
Impact.Such as, the correlational study on Oryza sativa L. does not find that this gene dramatically increases plant height and strengthens raw in the past
Function in terms of growing way, and present invention firstly discloses the expression of raising CYP78A gene in Semen Maydis and can increase strain
High, enhancing plant strain growth gesture.
The Mei2 homologous genes " terminal ear1 " (ZmTE1) of Semen Maydis is in the bud of plant and the separate living tissue of root
Expressing, the space structure of the leaf morphology and leaf growth that lose the mutant Zea mays of ZmTE1 gene function becomes
Change, illustrate its may participate in determine plant leaf grow on stem space structure (Veit et al., (1998) Nature,
393:166-168).The function of the homologous genes OsTEL of the Mei2 in Oryza sativa L. is similar with Semen Maydis ZmTE1.
Kawakatsu etc. find that the blade of the rice mutant losing OsTEL gene (being also called PLA1) function forms speed
Degree is accelerated, and blade maturation speed is accelerated, illustrate its have regulation and control blade is formed and blade is ripe function (Kawakatsu,
et al.,(2006)Plant Cell,18:612-625).Recently, it has been found that TEL gene have regulation and control plant strain growth gesture,
Seed size or the function of the character such as seed amount, yield.In plant, process LAN TEL gene can make the life of crop
Growing way strengthens, seed becomes big or quantity change is many, yield increases (Internationl Pat.No.PCT/CN2012/087069).
Present invention firstly discloses utilize simultaneously CYP78A subtribe protein and peptide and TEL polypeptide obtain plant height increase,
The method that growth potential strengthens, ear of maize becomes bioengineered corn big, that Biomass improves and yield increases.
(3) summary of the invention
It is an object of the present invention to provide the new opplication of a kind of CYP78A gene, particularly for regulation and control Semen Maydis plant height and growth
The application of gesture.
The technical solution used in the present invention is:
The present invention provides a kind of CYP78A gene increasing Semen Maydis plant height and the application strengthened in plant growing way.
The CYP78A albumen that the present invention provides can be from any plant, preferably is selected from grass, such as from beautiful
Rice, Oryza sativa L., Sorghum vulgare Pers. or Semen Tritici aestivi, particularly preferably from Oryza sativa L. or Semen Maydis.It is general it is contemplated that these are from different plants
Homologous protein there is same or like function, the most equally utilize the agronomy of these improvement of genes plants
Shape.Further, even if the function of these albumen unpredictable, one of ordinary skill in the art can be according to the present invention
The method provided and prior art measure whether they have the function promoting that plant growing and photosynthesis strengthen.This
Bright most preferably CYP78A gene is that (nucleotide homology reaches 85% for the gene in one of following source or its homologous sequence
Above): (aminoacid sequence is shown in SEQ ID NO:1 to Semen Maydis (Zea maize) CYP78A1, nucleotides sequence
Be classified as shown in SEQ ID NO:4), (aminoacid sequence is the CYP78A11 gene of Oryza sativa L. (Oryza sativa)
Shown in SEQ ID NO:2, nucleotides sequence is classified as shown in SEQ ID NO:5) and Sorghum vulgare Pers. (Sorghum bicolor)
CYP78A1L gene (aminoacid sequence is shown in SEQ ID NO:3, and nucleotides sequence is classified as SEQ ID NO:6).
The polynucleotide sequence of code book invention CYP78A albumen can have multiple different variation, polynucleotide sequence
Variation include but not limited to: 1) different and obtain different many nucleoside owing to encoding same amino acid whose codon
Acid sequence, these sequential codings have the protein and peptide of identical activity；2) genetic polymorphism of biology is derived from
Multiformity between Different Individual or the colony of (Genetic Polymorphism), i.e. same plant；3) logical
Cross manual operation and import the variation of polynucleotide sequence.The artificial this variation imported can be random variation, it is possible to
To be directed variation targetedly.It is prominent that one of ordinary skill in the art just can produce point by the method for molecular biology
Become, insertion or deletion mutation etc..The variation being imported polynucleotide sequence by manual operation also includes passing through Gene
The methods such as Shuffling obtain the heterozygous genes still with normal function.Such as U.S.Pat.No.2002/0058249；
Stemmer(1994)Proc.Natl.Acad.Sci.USA,91:10747-10751；Stemmer(1994)Nature,
370:389-391；Crameri et al.(1997)Nature Biotech.,15:436-438；Moore et al.(1997)J.
Mol.Biol.,272:336-347；Zhang et al.(1997)Proc.Natl.Acad.Sci.USA,94:4504-4509；
Crameri et al.(1998)Nature,391:288-291；and U.S.Pat.NOs.5,605,793and 5,837,458.
The polynucleotide sequence of CYP78A gene of the present invention, one of ordinary skill in the art generally can utilize
PCR method, DNA hybridization method etc. are cloned into corresponding homologous genes from a kind of plant.There is provided according to the present invention
Polynucleotide sequence design primer, homogenic some or all of sequence can be obtained by PCR method.
And once obtain the partial sequence of this gene, it is possible to it is cloned into full-length gene by different methods.On the other hand,
The polynucleotide utilizing the present invention to provide prepare probe, can pass through the DNA hybridization method DNA from a kind of plant
In library, clone obtains its homologous genes.
The polypeptide of CYP78A gene code of the present invention may be used for regulating and controlling the plant height of Semen Maydis, growth potential, blade face
Long-pending, ear of maize size, Biomass and yield, the polypeptide of preferably CYP78A gene code is one of following or has 75%
The aminoacid of above homology: SEQ ID NO:1, SEQ ID NO:2 or SEQ ID NO:3, most preferably CYP78A
The polypeptide of gene code is one of following SEQ ID NO:1, SEQ ID NO:2 or SEQ ID NO:3, described application side
Method includes expression or the activity improving CYP78A gene in Semen Maydis, and concrete grammar includes: 1) builds and comprises the present invention and carry
The expression cassette of the polynucleotide sequence of confession；The polynucleotide sequence that expression cassette can be expressed by one or several control
(such as promoter and terminator) obtains with CYP78A1 or its homologous genes functional connection；The present invention carries especially
Supply to utilize CYP78A1 or the expression cassette of its homologous genes itself, i.e. comprised promoter and the termination of these genes itself
The whole DNA fragmentation of son；2) expression cassette is imported in plant, and obtain expression；Especially by utilizing gene
Expression regulation sequence, makes the gene of importing expression characteristic over time and space gene raw with in it identical or class
Seemingly, to reduce the unfavorable shadow that plant may be produced by non-tissue specificity overexpression CYP78A1 or its homologous genes
Ring.
CYP78A1 or the method for its homologous genes process LAN plant qualification that the present invention obtains include: observe plant table
Type, spraying herbicide, molecule thing method etc., certainly, can be used together in actual applications in a variety of ways.By
The CYP78A1 or its homologous genes process LAN plant and the adjoining tree that there is provided in the present invention have obvious phenotype poor
Different, can be distinguished by naked eyes.The milpa that CYP78A1 or its homologous genes are expressed show as plant height increase or
Growth potential increases or blade broadens or Biomass increases or be provided simultaneously with above two or two or more phenotypes becomes
Change.If marker gene and genes of interest close linkage, genes of interest can be identified by the method for spraying herbicide.
Such as, CYP78A1 or its homologous genes are built with the Antiglyphosate gene (EPSPS) carrier as selection markers
On, the plant of resistance glyphosate is probably the plant of CYP78A1 or its homologous genes process LAN.Identify
CYP78A1 or its homologous genes process LAN plant can also use molecular biology method, and these methods mainly include
The technology such as Southern hybrid method and PCR, the DNA of detection target gene；Quantitative fluorescent PCR or quantitative PCR etc.
Technology, the level of detection target gene mRNA；Western hybrid method and enzyme-linked immunosorbent assay (ELISA) etc.
Technology, the protein level of detection target gene.
Further, CYP78A gene of the present invention is increasing Semen Maydis plant height, is strengthening answering in plant growing way and yield
With being by hybridizing or alternate manner proceeds to milpa by CYP78A gene and TEL gene, it is achieved corn plants
Height, growing way and the increase of yield.The present invention by improve in Semen Maydis CYP78A gene and the expression of TEL gene or
Activity, it is possible to make the increase of Semen Maydis plant height, growth potential strengthen, blade area becomes big, ear of maize becomes greatly, seed becomes big or becomes
Many, Biomass increases and yield increases, and concrete grammar includes: 1) builds and comprises the polynucleotide sequence that the present invention provides
Row expression cassette, expression cassette can by one or several control express polynucleotide sequences (such as promoter and
Terminator) obtain with CYP78A or its homologous genes and TEL or its homologous genes functional connection respectively.
Invention especially provides and utilize CYP78A1 or its homologous genes, and ZmTE1 or the table of its homologous genes itself
Reach frame, i.e. comprise the promoter of these genes itself and the whole DNA fragmentation of terminator；2) by CYP78A1 or
Its homogenic expression cassette and ZmTE1 or its homogenic expression cassette build and import to plant on same carrier
In thing, or by CYP78A1 or its homogenic expression cassette and ZmTE1 or its homogenic expression cassette respectively
Build the method and other method passing through to infect altogether or hybridize on two independent carriers again above two table
Reach frame and import in same plant, the final plant obtaining raising above two gene expression simultaneously.Especially by profit
With gene expression regulating and controlling sequence, make the gene of importing expression characteristic gene raw with in it over time and space identical,
Possible to reduce non-tissue specificity overexpression CYP78A1 or its homologous genes and ZmTE1 or its homologous genes
The adverse effect that plant is produced.At present, polygenes converts mainly following several method: hybrid method (Cao, j., et.
Al., (2002) Theor.Appl.Genet., 105:258-264), again conversion method (Rosati, C., 2003, Mol.Breed,
12:197-208), cotransformation method, gene connection method (Halpin, (2005) Plant Biotechnology J, 3:141-155)
With polycistron transgemic approach (Halpin et al., (2001) Plant Mol Biol, 47:295-310) etc..
Improve CYP78A (preferably CYP78A1) or its homologous genes while the present invention obtains and TEL is (excellent
Select ZmTE1) or the plant method that carries out identifying expressed of its homologous genes include observing plant phenotype, spraying herbicide,
Molecule thing method etc..Certainly, can be used together in a variety of ways in actual applications.
Due to CYP78A (preferably CYP78A1) or its homologous genes process LAN plant and TEL (preferably ZmTE1)
Or its homologous genes process LAN plant in phenotype, there were significant differences, can be distinguished by naked eyes.Carry so have simultaneously
The plant of the phenotype after high both gene expression is likely to improve the expression of both genes simultaneously.Such as, improve
The milpa that CYP78A (preferably CYP78A1) or its homologous genes are expressed shows as plant height to be increased or blade change
Wide or growth potential increases or Biomass increases or is provided simultaneously with above two or two or more character mutation；Carry
The maximum character mutation of the milpa that high TEL (preferably ZmTE1) or its homologous genes are expressed be ear of maize become big and
Seed becomes big or becomes many.The plant that simultaneously improve above-mentioned two genoids expression then has plant height increase, blade broadens,
Growth potential increases or Biomass increases and ear of maize change is big, seed becomes big or becomes character mutation how.
If CYP78A (preferably CYP78A1) or its homologous genes and TEL (preferably ZmTE1) or its with
When source gene builds respectively on two using different anti-herbicide genes as the carrier of selection markers, in view of labelling base
Cause and genes of interest close linkage, can identify genes of interest by the method for spraying herbicide, spray two kinds of herbicides
After remain to survive transfer-gen plant be that two target genes all exist.Such as, by CYP78A11 or its homologous genes
Build with on the Antiglyphosate gene (EPSPS) carrier as selection markers, and ZmTE1 or its homologous genes
Build with on anti-grass fourth phosphine (Bar) carrier as selection markers.Not only the transgenic of resistance glyphosate but also anti-grass fourth phosphine was planted
Strain is then likely to improve the expression of two genes simultaneously.
Identify and improve CYP78A (preferably CYP78A1) or its homologous genes and TEL (preferably ZmTE1) simultaneously
Or its homologous genes express plant can also use molecular biology method, these methods mainly include that Southern hybridizes
The technology such as method and PCR, detects the DNA of two target genes respectively；Quantitative fluorescent PCR or quantitative PCR etc.
Technology, detects the level of two target gene mRNA respectively；Western hybrid method and enzyme-linked immunosorbent assay
(ELISA) technology such as, detects the protein level of two target genes respectively.
The polynucleotide that the present invention provides can be cloned in plasmid vector, obtains massive duplication in cell.Utilize
This DNA recombinant technique, the polynucleotide that the present invention obtains can be with promoter and the terminator merit controlling gene expression
Can connect and constitute expression cassette in property ground.The connection of called function ground refers to that promoter and terminator can play control with it even
The expression of the polynucleotide connect.Generally promoter is connected to 5 ' ends, and terminator is connected to 3 ' ends.
The promoter of control gene expression is the technology that those skilled in the art is the most already known.The summary of Potenza etc.
Be discussed in detail and summarize research about promoter (Potenza et al (2004) In Vitro Cell Dev Biol-Plant,
40:1-22).Promoter include constitutive expression promoter, tissue express especially promoter, can be with abduction delivering
Promoter etc..
Invention especially provides and derive from CYP78A1 or its homologous genes and ZmTE1 or it homogenic opens
Mover.The region of promoter can be determined by test.General promoter can be the reading frame of coded protein
The DNA fragmentation of at least 0.25kb, 0.5kb, 1.0kb, 2.0kb or 3.0kb outside 5 ' ends.CYP78A1 or its homology
Gene and ZmTE1 or its homogenic natural promoter except can be used to the expression controlling itself gene with
Outward, it is also possible to be functionally connected with the homologous genes of other plant, other plant controls the expression of these genes,
To obtain the transgenic plant of improvement.The such as promoter of Oryza sativa L. CYP78A11 is used for controlling corn C YP78A1 gene
Expression in Semen Maydis, and the promoter of rice Os TEL is for controlling Semen Maydis ZmTE1 gene table in Semen Maydis
Reach.
The promoter controlling the gene that the present invention provides can also is that the special startup of tissue-specific promoter, such as STM
Son (U.S.Pat.No.5880330), ARSK1 root specific expression promoter (United States Patent Application
20040067506), AP1 floral meristem promoter (Sasaki, Katsutomo, et al. (2011) Plant
biotechnology,28:181-188).These promoteres can cause CYP78A1 or its homologous genes and ZmTE1
Or its homologous genes is specific expressed in some are organized, thus promote the growth of these specific tissues.
The promoter controlling the gene that the present invention provides can also is that constitutive promoter, such as cauliflower mosaic virus
CaMV 35S promoter (Terada and Shimamoto, (1990) Molecular&General Genetics, 220:
389-392), actin 1 promoter (Mcelroy et al., (1990) The Plant Cell, 2:163-171) of Oryza sativa L..These
Promoter can cause CYP78A1 or its homologous genes and ZmTE1 or its homologous genes at most of group of plant
In knitting specific expressed, thus promote the growth of these tissues.
The terminator controlling gene expression can be to provide the native terminator of gene, it is also possible to is other of kindred plant
Gene or the terminator of other plant gene.Conventional terminator includes the Octopine synzyme deriving from Agrobacterium
Terminator and nopaline synzyme terminator etc..List of references includes: Guerineau et al. (1991) Mol.Gen.
Genet.,262:141-144；Proudfoot(1991)Cell,64:671-674；Sanfacon et al.(1991)Genes
Dev.,5:141-149；Mogen et al.(1990)Plant Cell,2:1261-1272；Munroe et al.(1990)Gene,
91:151-158；Ballas et al.(1989)Nucleic Acids Res.,17:7891-7903；and Joshi et al.(1987)
Nucleic Acids Res.,15:9627-9639。
In order to improve gene expression in target plant, the polynucleotide sequence of gene can modify further and
Change.These changes include deleting intron, removing some sequences that may affect gene normal expression, as hiding
The PolyA signal sequence etc. of non-maturation.Codon service condition according to target plant, encodes same protein polypeptide
Polynucleotide sequence can optimize, to improve its expression in target plant.
Another aspect of the present invention is the gene utilizing the present invention to provide, and finds this gene position in genome
Put, then pinpoint insertion technology by DNA, by the regulating and controlling sequence of gene expression, such as the 35S enhancer of CaMV,
It is inserted on the site that can strengthen gene expression of the present invention.One enhancer tends to affect the table of neighbouring gene
Reaching, some enhancers can improve the expression of the gene at a distance of 20kb or farther.The DNA fixed point of plant is inserted at present
Technology the most ripe (Townsend, Jeffrey A., et al. (2009) Nature, 459:442-445；Jiang,W.,et
al.(2013).Nat.Biotechnol.,31:233–239；Cong,L.et al.(2013)Science,339:819–823).
Therefore, the method utilizing fixed point to insert, enhancer is inserted near CYP78A gene it is possible to improve this gene
Express.
The present invention can also comprise a selectable marker gene expression cassette for the carrier building gene expression frame simultaneously.This
Individual selectable marker gene can be used to the cell selecting to have converted, and conventional gene includes antibiotics resistance gene, as
Neomycin phosphotransferase II (NEO) and hygromycin phosphotransferase (HPT), anti-remove
Grass agent gene, such as Antiglyphosate gene EPSPS etc..Other selectable marker genes may also serve as what the present invention converted
Select gene.
The gene that the present invention provides can import plant thus obtains the high yield plant of transgenic, these plants include but not
Be limited to Semen Maydis, Semen Tritici aestivi, Fructus Hordei Vulgaris, Sorghum vulgare Pers., Oryza sativa L., Caulis Sacchari sinensis, Semen sojae atricolor, Radix Dauci Sativae, Rhizoma Solani tuber osi, Cotton Gossypii, Helianthi,
Brassica campestris L, Oak Tree, turfgrass, herbage.
One of ordinary skill in the art can utilize prior art to be imported to by the polynucleotide that the present invention provides at present
Plant is expressed.The more commonly used method be ballistic methods (Klein et al, 1987, Nature (London),
327:70-73；U.S.Pat.No.4,945,050)) or agriculture bacillus mediated method ((De Blaere et al, 1987, Meth.
Enzymol.,143:277).But the invention is not restricted to this method.
Method for transformation and the step of different plants are different.Generally using wider method is by Agrobacterium or gene
Rifle imports the immature embryo of plant, mature embryo, undifferentiated callus or protoplast.Then with corresponding screening
Culture medium carries out screening and culturing.Carrying out breaking up and obtaining conversion bud, being obtained with by root media cultivation can again
Transgenic seedling with plantation.Further, antiweed transgenic plant can be screened by herbicide spraying, such as, spray
Execute nicosulfuron and can kill not genetically modified Oryza sativa L..The plant that the present invention relates to include but not limited to Oryza sativa L., Semen Maydis,
Sorghum vulgare Pers., Caulis Sacchari sinensis, Cotton Gossypii, Semen Tritici aestivi, Semen sojae atricolor, Brassica campestris L, turfgrass or herbage.
Compared with prior art, the beneficial effects are mainly as follows: the present invention provides the one of CYP78A gene
Plant new opplication, by process LAN CYP78A gene in Semen Maydis, improve plant height and the growth potential of Semen Maydis, and then improve
The Biomass of Semen Maydis, and finally realize corn yield increasing；CYP78A gene and TEL gene association are imported Semen Maydis plant
Strain, it is achieved plant plant height increases, blade broadens, growth potential increases, Biomass increases, and ear of maize becomes greatly, seed
Become big or become character mutation how.
(4) accompanying drawing explanation
The T-DNA structural representation of Fig. 1: plant conversion carrier pCambia1300-G10-pCYP78A1-CYP78A1, beautiful
Rice CYP78A1 gene, the nucleotides sequence of CYP78A1 gene is classified as SEQ ID NO:4, including coding region and termination
The nucleotides sequence of son is classified as shown in SEQ ID NO:7.
The T-DNA structural representation of Fig. 2: plant conversion carrier pCambia1300-G10-pCYP78A11-CYP78A11,
The nucleotides sequence of Oryza sativa L. CYP78A11 gene is classified as shown in SEQ ID NO:5, including coding region and the nucleoside of terminator
Acid sequence is shown in SEQ ID NO:8.
The Maize Seedling plant of Fig. 3: CYP78A gene overexpression, wherein CK is comparison, and T is CYP78A1 gene mistake
Express plant.
Fig. 4: CYP78A gene and TEL gene add the milpa of strongly expressed simultaneously, and wherein CK is comparison, and T is for turning
Gene plant.
(5) detailed description of the invention
Below in conjunction with specific embodiment, the present invention is described further, but protection scope of the present invention is not limited in
This:
Molecular biology and biochemical method that following example of the present invention are used are known technology.?
The Current Protocols in Molecular Biology that Ausubel writes John Wiley and Sons company publishes
The Molecular that Cold Spring Harbor Laboratory Press (2001) publishes is write with J.Sambrook etc.
The documents such as Cloning:A Labortory Manual, 3rd ED. are all discussed in detail.
Embodiment 1. corn C YP78A gene--the structure of CYP78A1 Overexpression vector
Corn C YP78A1 gene coding region (nucleotide sequence is as shown in SEQ ID No.4) and terminator DNA
Fragment is obtained by synthetic, its nucleotide sequence such as SEQ ID No.7, this fragment can by BamHI and
Obtain after KpnI enzyme action.
The promoter fragment pCYP78A1 of CYP78A1 gene is obtained by PCR.2 primers of PCR are respectively
It is: pCYP78A1-F (5 '-AAGCTTCTCAAGACTCCTAATTCTCAGC-3 ') and pCYP78A1-R
(5’-AGATCTTTCTGGCTAGCTGCTTCTAGTAGC-3’).Primer has separately designed HindIII and
BglII restriction enzyme site.With Semen Maydis (B73) genome as template, the DNA fragmentation of the about 1.9kb that PCR obtains
Rear clone, in pMD-18-T-Vector carrier (TaKaRa), measures sequence, finally obtains such as nucleotide sequence
For the promoter sequence shown in SEQ ID NO.9, this fragment can utilize HindIII and BglII enzyme action to obtain.
The reaction system of PCR is: 5x PrimeSTARTM Buffer(Mg2+Plus) (purchased from TaKaRa company),
10μl；DNTP Mixture (each 2.5mM), 4 μ l；Primer pCYP78A1-F (10 μMs), 1 μ l；Primer
PCYP78A1-R (10 μMs), 1 μ l；Template DNA 100ng；PrimeSTARTM HS DNA Polymerase(2.5
U/ μ l), 0.5 μ l；Sterile purified water, adding to final volume is 50 μ l.
The condition of PCR is: 95 DEG C of denaturations 2min；94 DEG C of degeneration 30sec, 58 DEG C of annealing 30sec, 72
DEG C extend 2min, 32 circulations；72 DEG C extend 10min.
The structure of Agrobacterium T-DNA vectors:
The all DNA sequence of binary vector pCambia1300-pZmUbi-G10 as shown in SEQ ID NO.11,
This carrier comprises a glyphosate-tolerant gene (EPSPS), as the marker gene converted；Comprise HindIII and KpnI
Site, as the cloning site of genes of interest.HindIII and BglII enzyme action obtains the promoter of CYP78A1 gene
The CYP78A1 gene coding region obtained after fragment and BamHI and KpnI enzyme action and terminator DNA fragmentation
It is simultaneously connected in the pCambia1300-pZmUbi-G10 of HindIII and KpnI enzyme action, it is thus achieved that include resistance to
The T-DNA carrier of glyphosate gene and CYP78A1 gene.The T-DNA of this carrier comprises following gene knot
Structure: " promoter-CYP78A1 gene-terminator-promoter-glyphosate-tolerant gene-terminator ".This carrier is named
For: pCambia1300-G10-pCYP78A1-CYP78A1 (Fig. 1).Finally, the method turned by electricity is this
T-DNA plasmid proceeds in Agrobacterium LB4404, and by the card containing 15 μ g/ml tetracyclines and 50 μ g/mL, that is mould
The YEP solid medium of element filters out positive colony, and protects bacterium, for ensuing Plant Transformation.
The structure of embodiment 2. Oryza sativa L. CYP78A gene C YP78A11 Overexpression vector
Oryza sativa L. CYP78A11 gene coding region (nucleotides sequence is classified as shown in SEQ ID NO.5) and terminator DNA
Fragment is obtained by PCR.2 primers of PCR are respectively: CYP78A11-F1
(5 '-GGATCCAACAATGGCAATGGCCACCGCCAC-3 ') and CYP78A11-R1
(5’-GGTACCCATCTCACAAGCTCACACGGC-3’).With main kind show water 134 base that transplants rice seedlings in Zhejiang
Because group is template, the DNA fragmentation of the about 2.2kb that PCR obtains is cloned into pMD-18-T-Vector carrier
(TaKaRa), in, sequence is measured, it is thus achieved that the DNA fragmentation as shown in SEQ ID NO.8, this DNA fragmentation
In addition to the coding amino acid whose DNA sequence of Oryza sativa L. CYP78A11, further comprises an intron and terminator.
The reaction system of PCR is: 5x PrimeSTARTM Buffer(Mg2+Plus) (purchased from TaKaRa company), 10 μ l；
DNTP Mixture (each 2.5mM), 4 μ l；Primer CYP78A11-F1 (10 μMs), 1 μ l；Primer CYP78A11-R1
(10 μMs), 1 μ l；Template DNA 100ng；PrimeSTARTMHS DNA Polymerase (2.5U/ μ l),
0.5μl；Sterile purified water, adding to final volume is 50 μ l.The condition of PCR is: 95 DEG C of denaturations 2min；94℃
Degeneration 30sec, 62 DEG C of annealing 30sec, 72 DEG C extend 140sec, 32 circulations；72 DEG C extend 10min.
The promoter fragment pCYP78A11 of Oryza sativa L. CYP78A11 gene is obtained by PCR.2 of PCR are drawn
Thing is respectively: pCYP78A11-F1 (5 '-GGTACCGATTAGATAAAGCCACTTCCAC-3 ') and
pCYP78A11-R1(5’-GGATCCAGGTGTTTGTGGTTTTGCTTGTG-3’).Primer sets respectively
Count KpnI and BamHI restriction enzyme site.Genome C YP78A11 base with the main kind show water 134 that transplants rice seedlings in Zhejiang
Because template, the DNA fragmentation of the about 1.9kb that PCR obtains is cloned into pMD-18-T-Vector carrier
(TaKaRa), in, sequence is measured, it is thus achieved that the promoter sequence as shown in SEQ ID NO.10.PCR's is anti-
The system is answered to be: 5x PrimeSTARTM Buffer(Mg2+Plus) (purchased from TaKaRa company), 10 μ l；dNTP
Mixture (each 2.5mM), 4 μ l；Primer pCYP78A11-F1 (10 μMs), 1 μ l；Primer pCYP78A11-R1
(10 μMs), 1 μ l；Template DNA 100ng；PrimeSTARTMHS DNA Polymerase (2.5U/ μ l),
0.5μl；Sterile purified water, adding to final volume is 50 μ l.The condition of PCR is: 95 DEG C of denaturations 2min；94
DEG C degeneration 30sec, 62 DEG C of annealing 30sec, 72 DEG C extend 2min, 32 circulations；72 DEG C extend 10min.
The structure of Agrobacterium T-DNA vectors:
The all DNA sequence of binary vector pCambia1300-pZmUbi-G10 as shown in SEQ ID NO.11,
This carrier comprises a glyphosate-tolerant gene (EPSPS), as the marker gene converted；Comprise KpnI site, make
For the purpose of the cloning site of gene.PCambia1300-pZmUbi-G10 after KpnI enzyme action, dephosphorylation,
Carrier as clone is connected jointly with 2 genes of interest fragments through suitable enzyme action.2 fragments of genes of interest
It is the promoter (pCYP78A11) through KpnI and BamHI enzyme action respectively and includes genes of interest coding region
Fragment with terminator.The clone obtained has 2 different possibilities, selects following gene in T-DNA by enzyme action
The clone of structure: " promoter-CYP78A11 gene-terminator-promoter-glyphosate-tolerant gene-terminator ".This
Carrier is named: pCambia1300-G10-pCYP78A11-CYP78A11 (Fig. 2).Finally, turned by electricity
Method proceeds to this T-DNA plasmid in Agrobacterium LB4404, by containing 15 μ g/ml tetracyclines and 50 μ g/mL
The YEP solid medium of kanamycin filter out positive colony, and protect bacterium, for ensuing Plant Transformation.
Embodiment 3.
(1) corn transformation
The method for transformation of Semen Maydis comparative maturity, such as Frame etc. describe the method utilizing Agrobacterium-mediated Transformation Semen Maydis
(Frame et al.,(2002)Plant Physiol,129:13-22).Take respectively containing carrier pCambia1300-G10-
The Agrobacterium of pCYP78A1-CYP78A1 and pCambia1300-G10-pCYP78A11-CYP78A11 (i.e. contains
The Agrobacterium of T-DNA carrier) draw plate, choose single colony inoculation, prepare conversion and use Agrobacterium.Take 8-10 after pollination
It Hi-II corncob.Collect all of immature embryo (size is 1.0-1.5mm).To carry containing T-DNA
The Agrobacterium of body and immature embryo co-culture 2-3 days (22 DEG C).Shift immature embryo to calli induction media
(culture medium contains the Timentin of 200mg/L, is used for killing Agrobacterium, with reference to (Frame et al., (2002) Plant
Physiol, 129:13-22)), 28 DEG C of light culture 10-14 days.All of wound healing is forwarded to final concentration 2mM
(Frame et al., (2002) Plant Physiol, 129:13-22), 28 DEG C of light culture in the screening culture medium of glyphosate
2-3 week.
Shift all of tissue to the fresh screening culture medium containing final concentration 2mM glyphosate, 28 DEG C of light culture 2-3
Week.Then, (Frame et al., (2002) Plant in the embryonal connective tissue survived after shifting all screenings to regeneration culture medium
Physiol, 129:13-22), 28 DEG C of light culture 10-14 days, one strain of every ware.Transfer embryonal connective tissue is to fresh
On regeneration culture medium, 26 DEG C of illumination cultivation 10-14 days.Shift all full-grown plants to root media
(Frame et al., (2002) Plant Physiol, 129:13-22), 26 DEG C of illumination cultivation are until root development is complete, then
It is transplanted to individual plant in greenhouse cultivate, the antiweed ability of detection transgenic corns.With the Meng Shandou's of dilution 300 times
The gyphosate solution of 41% sprays, rear blade jaundice in 7 days, withered for feminine gender；The same with spray clear water comparison growing way
For positive plant.
(2) qualification of CYP78A gene transgenic Semen Maydis
By said method, respectively obtain containing conversion carrier pCambia1300-G10-pCYP78A1-CYP78A1,
PCambia1300-G10-pCYP78A11-CYP78A11 and comprise only the empty carrier of riddled basins EPSPS
Transgenic corn plant.By T0 for the transgenic containing CYP78A gene in plantlet of transplant to greenhouse, to 7 leaf phases
Milpa and the growth potential of empty vector control plant and plant height compare analysis.We obtain 60
CYP78A1 process LAN plant (named ZmCYP) has 32 plant strain growth gesture to compare with comparison be obviously enhanced,
Plant height is compared with comparison and is dramatically increased, and typical phenotype is shown in figure (Fig. 3).The plant height in two of which typical case's strain period of maturation is such as
Table 1.
Table 1:
| Strain | Plant height (cm) |
| CK | 221.5±8.3 |
| ZmCYP12 | 246.2±9.4 |
| ZmCYP55 | 248.6±8.5 |
* CK is the transgenic corn plant of the empty carrier comprising only riddled basins EPSPS；ZmCYP is carrier
The T-DNA transformed plant of pCambia1300-G10-pCYP78A1-CYP78A1, wherein ZmCYP numbering (12,55) below
It is to different lines random number, in order to distinguish different transformation events.
The character mutation of CYP78A11 gene overexpression milpa is similar with ZmCYP, 55 CYP78A11 mistakes
Having 30 plant strain growth gesture to compare with comparison in expression plant to be obviously enhanced, plant height is compared with comparison and is dramatically increased.
CYP78A similarities and differences in phenotype in Oryza sativa L. and Semen Maydis are expressed in order to compare increase, existing with reference to this laboratory
Rice conversion method (Internationl Pat.No.PCT/CN2012/087069), we convert obtain 45
Turn the independent rice conversion body of CYP78A1 gene and 30 independent rice conversion bodies turning CYP78A11 gene.Knot
Fruit finds that these transformant rice and empty vector control transformant are the most notable in terms of plant height and plant strain growth gesture
Difference.
Embodiment 4.
(1) hybridization of transgenic corns
The CYP78A gene overexpression jade converting out by the method for embodiment 3 in transgenic corns experimental plot
TEL gene overexpression milpa (the Internationl Pat.No. obtained before rice plant and applicant
PCT/CN2012/087069) different blocks it is planted in respectively.Before flowering with Corii Caprae seu Ovis paper bag turning of will hybridizing
The female flower of gene corn plant and male flower bagging respectively.At Semen Maydis Post flowering, CYP78A gene transgenic Semen Maydis
Pollen is awarded the female of TEL gene transgenic Semen Maydis and is taken or the pollen of TEL gene transgenic Semen Maydis is awarded
CYP78A gene transgenic Semen Maydis is female to be taken.By the time the maize cob after pollination is in the milk and after maturation, adopts solarization
Dry, for breeding and research further.
(2) enhance the qualification of the Semen Maydis of CYP78A gene and TEL gene expression simultaneously
Molecular biology method: from CYP78A gene transgenic Semen Maydis and TEL gene transgenic corn hybridization offspring
The middle method with the primer employing quantitative fluorescent PCR being respectively directed to two target gene designs identifies ZmTE1 gene
Milpa with CYP78A1 gene process LAN simultaneously.
The primer identifying ZmTE1 gene expression is: ZmTE1-RT-F:TGCATCCAATCCAACGAGTG and
ZmTE1-RT-R:GCGATGTCAGGTTGACGAAG；
The primer identifying CYP78A1 gene expression is: ZmCYP-RT-F:TACGACCCAAGCAACGTCAC
With ZmCYP-RT-R:ACGTCGACGAAGTCAG CATT.
In the process LAN plant of above-mentioned 2 genes, the relative expression quantity of ZmTE1 gene and CYP78A1 gene is with empty
Vehicle Control plant is compared increases at least 3 times respectively.
Phenotypic Observation method: the character mutation of TEL gene overexpression plant is that plant uprises, ear of maize becomes big, and seed becomes big
Or become many；The character mutation of CYP78A gene overexpression plant is that plant uprises, and growth potential strengthens.Enhance simultaneously
ZmTE1 gene expression is compared with empty vector control plant with the Semen Maydis of CYP78A1 gene expression, and plant height increases, raw
Growing way strengthens, and ear of maize becomes big, and the seed on ear of maize becomes big or becomes many, and yield increases, and typical phenotype is shown in figure (Fig. 4).
Claims (8)
1.CYP78A gene is increasing Semen Maydis plant height and the application strengthened in plant growing way.
Apply the most as claimed in claim 1, it is characterised in that described CYP78A gene source is in grass.
Apply the most as claimed in claim 2, it is characterised in that described grass is Semen Maydis, Oryza sativa L., Sorghum vulgare Pers. or little
Wheat.
Apply the most as claimed in claim 1, it is characterised in that under the aminoacid sequence of described CYP78A gene code is
One of row or there is the aminoacid sequence of more than 75% homology: SEQ ID NO:1, SEQ ID NO:2 or SEQ ID
NO:3。
Apply the most as claimed in claim 1, it is characterised in that the nucleotides sequence of described CYP78A gene be classified as following it
One or there is the nucleotide sequence of more than 85% homology: SEQ ID NO:4, SEQ ID NO:5 or SEQ ID NO:6.
Apply the most as claimed in claim 1, it is characterised in that described application is to be planted by CYP78A channel genes Semen Maydis
Strain, it is achieved Semen Maydis plant height and the increase of growing way.
Apply the most as claimed in claim 6, it is characterised in that described CYP78A gene proceeds to the method for milpa and is:
1) CYP78A gene nucleotide series is connected with promoter and terminator, construction expression frame；2) expression cassette is imported to
In milpa, and obtain expression.
Apply the most as claimed in claim 1, it is characterised in that described application is to be joined with TEL gene by CYP78A gene
Close and import same milpa, it is achieved the increase of Semen Maydis plant height, growing way and yield.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510230547.5A CN106191080A (en) | 2015-05-07 | 2015-05-07 | CYP78A gene is increasing Semen Maydis plant height and the application strengthened in plant growing way |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510230547.5A CN106191080A (en) | 2015-05-07 | 2015-05-07 | CYP78A gene is increasing Semen Maydis plant height and the application strengthened in plant growing way |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106191080A true CN106191080A (en) | 2016-12-07 |
Family
ID=57459339
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510230547.5A Pending CN106191080A (en) | 2015-05-07 | 2015-05-07 | CYP78A gene is increasing Semen Maydis plant height and the application strengthened in plant growing way |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106191080A (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109112146A (en) * | 2018-07-17 | 2019-01-01 | 华中农业大学 | Control clone and the Breeding Application of the gene qSLWA9 of cabbage type rape silique length and grain principal characteristic shape |
| CN109207508A (en) * | 2018-08-03 | 2019-01-15 | 浙江大学 | A method of improving crop yield |
| CN109880832A (en) * | 2019-04-09 | 2019-06-14 | 西南大学 | Rice leaf Leaf angle mutated gene PLA1 and its application |
| CN112813074A (en) * | 2021-02-10 | 2021-05-18 | 浙江大学 | Method for specifically regulating and controlling rice CYP78A11 gene expression and plant transformation vector |
| CN113122568A (en) * | 2019-12-31 | 2021-07-16 | 杭州瑞丰生物科技有限公司 | Method for improving corn biomass |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013091563A1 (en) * | 2011-12-23 | 2013-06-27 | Hangzhou Leadgene Limited Inc. | Methods for improving crop yield |
-
2015
- 2015-05-07 CN CN201510230547.5A patent/CN106191080A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013091563A1 (en) * | 2011-12-23 | 2013-06-27 | Hangzhou Leadgene Limited Inc. | Methods for improving crop yield |
Non-Patent Citations (5)
| Title |
|---|
| ALEXANDROV, N.N.等: "ACG43035.1,cytochrome P450 CYP78A1 [Zea mays]", 《GENBANK》 * |
| LARKIN, J.C.等: "L23209.1,Zea mays cytochrome P-450 (cyp78) mRNA, complete cds", 《GENBANK》 * |
| MANAKI MIMURA: "Rice PLASTOCHRON genes regulate leaf maturation downstream of the gibberellin signal transduction pathway", 《PLANTA》 * |
| MIYOSHI, K.等: "AB096259.1，Oryza sativa Japonica Group PLA1 mRNA for cytochrome P450 78A11, complete cds", 《GENBANK》 * |
| PATERON, A.H.等: "XM_002464606.1，Sorghum bicolor hypothetical protein, mRNA", 《GENBANK》 * |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109112146A (en) * | 2018-07-17 | 2019-01-01 | 华中农业大学 | Control clone and the Breeding Application of the gene qSLWA9 of cabbage type rape silique length and grain principal characteristic shape |
| CN109112146B (en) * | 2018-07-17 | 2021-07-13 | 华中农业大学 | Cloning and breeding application of gene qSLWA9 for controlling pod length and grain weight traits of brassica napus |
| CN109207508A (en) * | 2018-08-03 | 2019-01-15 | 浙江大学 | A method of improving crop yield |
| CN109880832A (en) * | 2019-04-09 | 2019-06-14 | 西南大学 | Rice leaf Leaf angle mutated gene PLA1 and its application |
| CN113122568A (en) * | 2019-12-31 | 2021-07-16 | 杭州瑞丰生物科技有限公司 | Method for improving corn biomass |
| CN112813074A (en) * | 2021-02-10 | 2021-05-18 | 浙江大学 | Method for specifically regulating and controlling rice CYP78A11 gene expression and plant transformation vector |
| CN112813074B (en) * | 2021-02-10 | 2023-02-10 | 浙江大学 | Method for specifically regulating and controlling rice CYP78A11 gene expression and plant transformation vector |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105624188B (en) | A kind of SPL18 gene is improving the application in plant products | |
| CN103589749A (en) | Methods for enhancing stress tolerance in plants | |
| CN106191080A (en) | CYP78A gene is increasing Semen Maydis plant height and the application strengthened in plant growing way | |
| WO2016017641A1 (en) | Plant body ideal for high-density planting and use thereof | |
| CN111593058B (en) | Bna-miR169n gene and application thereof in controlling drought resistance of brassica napus | |
| WO2022135246A1 (en) | R gene for controlling matching of soybean-rhizobium, protein and use thereof | |
| CN114736915B (en) | Verticillium dahliae VdNRPS2 gene antipathogen target gene fragment and interference vector and application thereof | |
| CN114752599B (en) | Verticillium dahliae VdNRPS3 gene antipathogen target gene fragment, interference vector and application thereof | |
| CN110106183A (en) | A kind of anti-herbicide gene and its application | |
| CN106544344A (en) | A kind of application of tissue-specific promoter in regulation and control crop yield | |
| CN113621625B (en) | Application of sesame SiERF103 gene in enhancing plant resistance | |
| CN105586346A (en) | Tobacco gene NtTCTP and application thereof | |
| CN116694652B (en) | Verticillium dahliae VdNRPS4 gene antipathogenic target gene fragment, interference vector and application | |
| EP1457564B1 (en) | Production of plants having improved rooting efficiency and vase life using stress-resistance gene | |
| CN116574731A (en) | Promoter for CRISPSR/Cas 9 gene editing of white birch and application thereof | |
| CN102732553B (en) | Improve the gene engineering method and material of plant products | |
| CN116926088B (en) | Verticillium dahliae VdNRPS6 gene antipathogenic target gene fragment, interference vector and application thereof | |
| CN110760524B (en) | Specific DNA fragment com58276 and application thereof in regulating and controlling plant stress resistance | |
| CN114591984B (en) | Application of OsAP79 gene in inducing rice to resist brown planthoppers | |
| CN115011607B (en) | Sesame fertility regulation gene and expression vector and application thereof | |
| CN114835787B (en) | Application of Quercus suberectus QsSRO1 gene and encoding protein thereof in plant stress resistance | |
| CN115011631B (en) | Protein for regulating drought resistance of corn at seedling stage, and coding gene and application thereof | |
| CN116640768B (en) | Wheat powdery mildew resistance gene PmTR1 and application thereof | |
| CN114606244B (en) | Astragalus sinicus AGL18 gene and application thereof | |
| CN114908106B (en) | Rose salt tolerance gene RrLBD40 and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20161207 |
|
| RJ01 | Rejection of invention patent application after publication |