CN106167799A - A kind of detection method of Michaelis triumphant human relations algae - Google Patents
A kind of detection method of Michaelis triumphant human relations algae Download PDFInfo
- Publication number
- CN106167799A CN106167799A CN201610817623.7A CN201610817623A CN106167799A CN 106167799 A CN106167799 A CN 106167799A CN 201610817623 A CN201610817623 A CN 201610817623A CN 106167799 A CN106167799 A CN 106167799A
- Authority
- CN
- China
- Prior art keywords
- algae
- michaelis
- human relations
- primer
- detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides the detection method of a kind of Michaelis triumphant human relations algae, devise three couples of LAMP primer FIP, BIP, LF, LB, F3 and B3, wherein FIP is 5 ' end biotin labeling primers, LF is 5 ' end Fluorescein isothiocyanate FITC label probes, preparation is containing three pairs of primers and the LAMP reaction system step of sample template, LAMP reaction system is expanded, then uses LFD ELISA test strip, and carried out sensitivity and Evaluation on specificity subsequently.The present invention has the higher specificity of method, sensitivity, practicality and the convenience than existing conventional art PCR detection Michaelis triumphant human relations algae, can be conducive to detection and control the outburst of Michaelis triumphant human relations algae in actual on-site field use, carrying out prevention in advance.Using the detection of method human relations triumphant to the harmful algae Michaelis algae of the present invention, can effectively prevent harmful algae Michaelis triumphant human relations algae that extensive red tide occurs, this is significant to protection China ocean and aquaculture.
Description
Technical field
The invention belongs to harmful algae detection technique field, be specifically related to a kind of harmful algae Michaelis triumphant human relations algae Karenia
The detection method of mikimotoi.
Background technology
Michaelis triumphant human relations algae Karenia mikimotoi is that one common are poison dinoflagellate, and it belongs to unarmored dinoflagellate mesh
(Gymnodiniales), Kai Lun algae section (Kareniaceae), Caro Trentepohlia (Karlodinium).It is common in temperate zone and heat
The band shallow water along the coast, is a kind of typical fish toxicity red tide algae.In recent years, Michaelis triumphant human relations algae was repeatedly drawn in the Bohai Sea with other algae
Sending out red tide, contaminated area and number of times are gradually increased.As a kind of toxic algae, Michaelis triumphant human relations algae can secrete haemolytic exotoxin, danger
Evil Fish and invertebrates, cause aquaculture organism dead, cause fishery economic to lose, heavy damage marine ecosystems,
Even with the propagation of food chain, threaten the health of the mankind.Therefore, monitoring and the research of human relations algae triumphant to Michaelis is always various countries
The focus of ocean worker.Present stage, mainly observe its morphology spy by microscope for detecting the method for Michaelis triumphant human relations algae
Levy.But owing to Michaelis triumphant human relations phycobiont is small, being difficult to carry out sample treatment and observation, this needs experimenter to possess abundant warp
Test.Accordingly, it would be desirable to find one faster, more convenient, it is more suitable for the detection method of Michaelis triumphant human relations algae.
Summary of the invention
It is an object of the invention to provide the detection method of a kind of quick detection harmful algae Michaelis triumphant human relations algae, to realize rice
Family name triumphant human relations algae carries out field quick detection safe, special, quick, sensitive, simple, thus makes up existing traditional sensing techniques
Not enough.
Present invention firstly provides a kind of loop-mediated isothermal amplification (LAMP) primer group detecting Michaelis triumphant human relations algae, include following drawing
Thing:
F3 primer KM-F3:5 '-GCTTATTTGGCATATTCGTTAG-3 ' (SEQ ID NO:1),
B3 primer KM-B3:5 '-ACTTACCCAATCCCGTGG-3 ' (SEQ ID NO:2),
FIP primer KM-FIP:
5′-GGCCAAAGAATTCACTAGGATAAGC-GTGCTTTGGCTATTTGTGG-3′(SEQ ID NO:3)、
BIP primer KM-BIP:
5′-GACGGCTGCTGAAGCATCTC-TTTGCACCAAGTTTTTGATCTC-3′(SEQ ID NO:4)、
LF primer KM-LF:5 '-ACAAAGACTGCAGCTGTCAAT-3 ' (SEQ ID NO:5)
LB primer KM-LB:5 '-AAGCACAAGCCTTTACGTTTCTTG-3 ' (SEQ ID NO:6)；
As preferably, the sequence of FIP primer KM-FIP is as follows:
5′-GGCCAAAGAATTCACTAGGATAAGC-GTGCTTTGGCTATTTGTGG-3′(SEQ ID NO:7)、
The sequence of BIP primer KM-BIP is as follows:
5′-GACGGCTGCTGAAGCATCTC-TTTGCACCAAGTTTTTGATCTC-3′(SEQ ID NO:8)。
Preferred as embodiment, the 5 ' ends of KM-FIP carry out biotin labeling, and the 5 ' ends of LF primer KM-LF carry out different sulfur
Cyanic acid fluorescein FITC labelling；
The present invention also provides for a kind of method detecting harmful algae Michaelis triumphant human relations algae, including the steps
1) preparation LAMP reaction system:
Each primer final concentration of: each 1.6 μm ol/L of inner primer KM-FIP and KM-BIP, outer primer KM-F3 and KM-B3 is each
0.2 μm ol/L, each 0.8 μm ol/L of ring primer KM-LF and KM-LB；Buffer forms and concentration is: Tris-HCl (pH 8.8)
20mmol/L, KCl 10mmol/L, MgSO48mmol/L, (NH4)2SO410mmol/L, the Tween20 of 0.1%, Betaine
0.8mol/L, dNTPs 1.4mmol/L；8U Bst archaeal dna polymerase and 2 μ L sample DNA profilings, add distilled water and make reaction system
Cumulative volume is 25 μ L；
2) LAMP reaction system amplification: above-mentioned reaction system is carried out nucleic acid amplification reaction, and amplified reaction is temperature required is
61 DEG C-65 DEG C, amplified reaction required time is 30min-60min；
3) LFD detection: take 8 μ L nucleic acid amplification products and product is joined mixing in 100 μ L Buffer, then LFD is tried
Paper slip is dipped vertically into color developing detection in mixed solution, judges amplification by test strips.
Wherein step 2) described in optimal reactive temperature be 63 DEG C, the optimal reaction time is 45min.
The LAMP-LFD detection method of Michaelis provided by the present invention triumphant human relations algae has the advantage that
One, high sensitivity, the detection minimum rate of accumulation of human relations algae triumphant to Michaelis can compare normal PCR to 64pg/ μ L, its detection sensitivity
Detection sensitivity high 10 times.
Two, strong specificity, specific primer used sets according to six zoness of different in the ITS gene of Michaelis triumphant human relations algae
Meter, wherein LF is simultaneously as DNA specific probe, this detection specificity than Standard PCR strong a lot.
Three, the detection time is shorter, within about 50 minutes, can obtain testing result, saves 2-4h than the Standard PCR detection time.
Four, instrument and equipment requires low, it is not necessary to PCR instrument, electrophresis apparatus and gel imaging system, only needs a thermostatic heater
Detection can be completed.
Five, easy and simple to handle, result presents substantially, and whole detection process is not related to complex and expensive instrument and equipment, slightly has
The personnel of molecular biology mechanism can complete whole operation；Testing result is clearly obvious, directly observes by the naked eye and can sentence
Not.
Six, safer to experimenter and environment, detection process is made without gel electrophoresis therefore does not use EB etc. poisonous
Reagent.
In sum, the present invention have than existing conventional art PCR detection Michaelis triumphant human relations algae the higher specificity of method,
Sensitivity, practicality and convenience, can be conducive to detection in actual on-site field use and control the quick-fried of Michaelis triumphant human relations algae
Send out, carry out prevention in advance.Use the detection of method human relations triumphant to the harmful algae Michaelis algae of the present invention, can effectively prevent harmful algae
There is extensive red tide in class Michaelis triumphant human relations algae, this is significant to protection China ocean and aquaculture.
Accompanying drawing explanation
The LAMP-LFD primer of Fig. 1: Michaelis triumphant human relations algae ITS gene and probe design diagram, primer and probe are by square frame
Iris out,
Fig. 2: PCR-AGE detection Michaelis triumphant human relations algae sensitivity map,
Fig. 3: LAMP detection Michaelis triumphant human relations algae sensitivity map,
Fig. 4: LAMP-LFD detection Michaelis triumphant human relations algae sensitivity map,
In Fig. 2 and Fig. 4, swimming lane M is DL2000DNA marker, and NC is negative control, and 1 swimming lane is 100(template concentrations
64ng/ μ L), 2-8 swimming lane is followed successively by 10-1、10-2、10-3、10-4、10-5、10-6、10-7The genomic DNA of dilution again.
Fig. 5: PCR-AGE detection Michaelis triumphant human relations algae specificity figure,
Fig. 6: LAMP detection Michaelis triumphant human relations algae specificity figure,
The specificity figure of Fig. 7: LAMP-LFD detection Michaelis triumphant human relations algae；
In Fig. 5 and 7, swimming lane M is DL2000DNA marker, and NC is negative control, and 1-8 swimming lane is followed successively by: Michaelis is triumphant
Human relations algae, Alexandrium tamarense, Prorocentrum donghaiense, ocean Prorocentrum, prorocentrum minimum, red algae different gulf algae, Skeletonema Costatum, rice
Family name triumphant human relations algae.
Detailed description of the invention
LAMP-LFD technology is ring mediation horizontal temperature amplification technique (Loop-mediated isothermal
Amplification) the detection skill of a kind of novelty combined with horizontal mobility test strips (Lateral flow dipstick)
Art, the amplification of nucleic acid horizontal stroke temperature and visualization ELISA test strip are organically combined by this technology.Loop-mediated isothermal amplification technique (LAMP),
Have only under the conditions of constant temperature (60 DEG C 65 DEG C) be incubated dozens of minutes, required genes of interest can be expanded to 109Level.Horizontal
To flowing test strips (LFD), merge immunochromatography technique and molecular biology method, coloured inspection can have been formed on paper slip
Survey line is such that it is able to specifically detect this target product.Ring mediation horizontal temperature amplification technique (LAMP) and horizontal mobility test strips
(LFD) technology be combineding with each other, makes LAMP amplified production Site Detection visualize, and testing result is substantially directly perceived, by naked eyes is
Can recognize, LAMP-LFD associated methods safely, quickly, efficiently, high sensitivity and without equipment and technical limitations, there are other technologies
Irreplaceable advantage.
The present invention solves the technical scheme that above-mentioned technical problem used and includes three below part: 1, provide 3 to being used for
The LAMP primer sequence of Michaelis triumphant human relations algae, i.e. length is respectively the oligonucleotide of 20bp, 18bp, 32bp, 42bp, 22bp and 21bp
Sequence, the most named KM-F3, KM-B3, KM-FIP, KM-BIP, KM-LF and KM-LB；2, preparation LAMP reaction system, passes through
Sample template is expanded by LAMP response procedures, determines optimal reaction system and reaction condition；3, KM-LF is designed as
DNA probe, is analyzed LAMP amplification in conjunction with LFD technology.
8 kinds of algaes used in the present invention: Michaelis triumphant human relations algae (Karenia mikimotoi), Alexandrium tamarense
(Alexandrium tamarense), Prorocentrum donghaiense (Prorocentrum donghaiense), ocean Prorocentrum
(Prorocentrum micans), prorocentrum minimum (Prorocentrum minimum), heterosigma akashiwo (Heterosigma
Akashiwo), more than Skeletonema Costatum (Skeletonema costatum), Michaelis triumphant human relations algae (Karenia mikimotoi)
Microalgae algae kind is provided by Marine Biological Lab of University Of Ningbo algae kind room, cultivates sea water (salinity 25 ‰) fine through 0.45 μm acetic acid
Boiling cooling after dimension membrane filtration, culture fluid uses No. three formula of liquid of Zhejiang Marice Lives Academy (NMB 3#).Algae kind is bored at 2500mL
Shape bottle is cultivated under daylight lamp illumination, intensity of illumination 45～55 μm o l/ (m 2 s), light dark period 12: 12, cultivation temperature
For (20 ± 2) DEG C.
Below in conjunction with embodiment, the present invention is described in further detail.
Embodiment 1:LAMP-LFD technology for detection is harmful to the method for Michaelis triumphant human relations algae and sets up
Takara MiniBEST Universal Genomic DNA Extraction Kit Ver.50 purchases precious biological
Engineering (Dalian) company limited DNA (deoxyribonucleic acid) amplification kit, Rong Yan biotechnology (Chinese) company limited, LFD detects examination
Paper slip is purchased from Milenia Biotec GmbH company (Milenia GenLine HybriDetect MGHD1, Germany).
1, the design of LAMP primer
After the IST gene of human relations algae triumphant to the Michaelis disclosed in NCBI carries out homology analysis, and compare human relations triumphant with Michaelis
The sequence of the IST gene of algae allied species, thus design and filter out following 3 pairs of primers, primer sequence is as follows:
KM-F3:5′-AAGCATGCCTTCTTCAGTGT-3′
KM-B3:5′-CTGGAGCAGGCTACGAGT-3′
KM-FIP:
5′-TGACACACAAACACGCACCCATTGATTTTCATGCCCCTGACG-3′
KM-BIP:5′-TGGCCTTTGACGCATTCAGTGTACACAACGAAAGAGACACCG-3′
KM-LB:5′-TAGCGTCTCCAACGAGCAACT-3′
KM-LF:5′-GACAGCACCAAGAGAAGACTTG-3′
Wherein KM-FIP is 5 ' end biotin labeling primers, and KM-LF is 5 ' end Fluorescein isothiocyanate FITC label probes；
The ITS gene LAMP amplimer sequence location of Michaelis triumphant human relations algae is as shown in Figure 1.According to above-mentioned primer sequence, raw at Dalian treasured
Thing company carries out LAMP primer synthesis.
2, LAMP amplified conditions optimization
Amplified conditions optimization is carried out as template using the genomic DNA of Michaelis triumphant human relations algae.LAMP method DNA amplification reaction reagent
Box is purchased from Bo Ao bio tech ltd.First preparation has optimal amplification efficiency and detects specific reaction system, this
LAMP reaction system in invention is: each primer concentration is: each 1.6 μm ol/L of FIP-bio and BIP, each 0.2 μm ol/ of F3 and B3
Each 0.8 μm ol/L of L, LF-fitc and LB；Buffer forms and concentration is: Tris-HCl (pH 8.8) 20mmol/L, KCl
10mmol/L, MgSO4 8mmol/L, (NH4) 2SO4 10mmol/L, Tween20 0.1%, Betaine 0.8mol/L,
dNTPs 1.4mmol/L；8U Bst archaeal dna polymerase；Genomic DNA template 2 μ l.Require that preparation reaction is mixed according to above-mentioned system
Compound, is dispensed into after mixing in aseptic PCR pipe, and reaction cumulative volume is 25 μ l.LAMP-LFD reaction system is shown in Table 1.
Table 1:LAMP-LFD reaction system
In course of reaction, expand and too high or too low for temperature be all unfavorable for that LAMP reacts.The primer that the application present invention provides
The reaction system that present invention determine that with employing, reacts LAMP under the conditions of being respectively compared different temperatures (61 DEG C, 63 DEG C, 65 DEG C)
Impact, is monitored in real time amplified reaction by real-time transmissometer and finally determines that optimum reacting time and reaction are temperature required.
63 DEG C are finally selected, the optimum reaction condition that 45min expands as follow-up LAMP by interpretation.
3, LFD detection
After LAMP amplification terminates, take 8 μ L amplified productions and join mixing in 100 μ L Buffer solution, by LFD test strips
It is dipped vertically in mixed liquor, observes whether ELISA test strip band develops the color.If detection band colour developing represents the triumphant human relations of Michaelis in this sample
The testing result of algae is positive, if do not developed the color, represents that the testing result of this sample Michaelis triumphant human relations algae is feminine gender.
Embodiment 2
It is measured with human relations triumphant to the harmful algae Michaelis algae sensitivity of the LAMP-LFD technology of the present invention
1, the Michaelis triumphant human relations algae genomic DNA extracted with reference to DNA extraction kit description, the triumphant human relations of Michaelis that will be extracted
The genomic DNA template original concentration (74ng/ μ L) of algae presses 10 times of gradient dilutions, respectively as reaction template.
2, carry out detection with LAMP, LAMP-LFD and PCR method human relations triumphant to Michaelis algae and compare sensitivity.
The genomic DNA of above-mentioned gradient dilution is used as PCR reaction template by 2.1, utilizes above-mentioned special primer F3 and B3 to enter
Row amplification, reaction system is: each 1 μ L of 20 μm ol/L F3 and 20 μm ol/L B3, Premix Taq enzyme (TaKaRa) 25 μ L, Michaelis
Triumphant human relations algae template 3 μ L, distilled water is settled to 50 μ L systems.PCR reaction condition after optimization: 95 DEG C of 5min of denaturation；95℃
40s, 51 DEG C of 40s, 72 DEG C of 90s, 30 circulations；72 DEG C extend 10min.Amplified production is tied with 1% agarose gel electrophoresis detection
Really (Fig. 2).
2.2 by the genomic DNA of above-mentioned gradient dilution be used as LAMP template carry out nucleic acid amplification test, result is shown in Fig. 3.
6 primers of 2.3 LAMP provided according to the present invention combine LFD technology by the genome after above-mentioned gradient dilution
The template that DNA reacts as LAMP expands, and the LFD methods analyst LAMP reaction provided by the present invention, result is shown in Fig. 4.
Michaelis 10 times of gradient dilutions of triumphant human relations algae genomic DNA template it is demonstrated experimentally that LAMP-LFD and LAMP detection minimum
Diluted concentration is 10-4, template concentrations is 7.4pg/ μ L.PCR amplification least concentration is 74pg/ μ L.It is sensitive that LAMP-LFD detects
Degree than and high 1 order of magnitude of conventional PCR method, it is sensitive that the above results shows when the primer sets of the present invention ensure that detection
Property.
Embodiment 3
It is measured with the LAMP-LFD technology of present invention human relations triumphant to harmful algae Michaelis algae specific
Choose Michaelis triumphant human relations algae (Karenia mikimotoi), Alexandrium tamarense (Alexandrium
Tamarense), Prorocentrum donghaiense (Prorocentrum donghaiense), ocean Prorocentrum (Prorocentrum
Micans), prorocentrum minimum (Prorocentrum minimum), heterosigma akashiwo (Heterosigma akashiwo), in
Skeletonemacostatum (Skeletonema costatum), 8 kinds of common marine harmful algaes of Michaelis triumphant human relations algae (Karenia mikimotoi)
Class is as LAMP-LFD specific test algae, and wherein distilled water is negative control.Extract the genomic DNA of algae, amplified production
Amplification is observed respectively with LFD test strips and 1% agarose gel electrophoresis.Testing result is shown in Fig. 5-7, illustrates that the present invention provides
The LAMP-LFD detection method of Michaelis triumphant human relations algae can guarantee that the specific detection of human relations algae triumphant to harmful algae Michaelis, not with other
Relevant algae generation cross reaction.
Embodiment 4
For improving further the sensitivity of LAMP amplification, according to the primer of Previous designs, for KM-FIP and KM-BIP I
The base in its primer is transformed, improved primer sequence is as follows:
KM-FIP-1:
5′-TGACACACAAACACGCACCCATTGATTATCATGCCTCTGACG-3′
KM-BIP-1:5′-TGGCCTATGACGCATTCAGAGTACACTACGAATGAGACACCG-3′
Improved primer is utilized to carry out specificity and the sensitivity technique of LAMP amplification.Amplification reaction system is except implementing
Outside in example 1, two primer KM-FIP and KM-BIP are replaced by KM-FIP-1 and KM-BIP-1 respectively, other are the most constant, amplification and LFD
Detection process also keeps consistent.With for compared with carrying out the LAMP-LFD before primer transformation, the improved LAMP-LFD of primer is spy
The opposite sex test experience in transformation before result consistent.But it is in terms of sensitivity technique, compared with the primer do not transformed, sensitive
Degree rises again 1 order of magnitude, improves 2 orders of magnitude than conventional PCR method sensitivity.The above results show engineered after
The primer sets of the present invention can further improve susceptiveness during detection in the case of ensureing that specific detection is constant.
Embodiment 5
LAMP-LFD is to the detection application of harmful algae in each marine site
The DNA profiling of each sample is extracted with the RNA isolation kit in embodiment 1.And by the LAMP-LFD method designed
Whether detection seawater sample exists harmful algae Michaelis triumphant human relations algae；Detect by the PCR method in case study on implementation 2 simultaneously.
Each sample make respectively 3 parallel, testing result is as shown in table 2.
Table 2:LAMP-LFD and PCR method are to the testing result of harmful algae Michaelis triumphant human relations algae in each marine site
Note :+. positive；. negative
The above results shows that the result that the primer sets of the present invention and detection method are obtained is consistent with the result of PCR, it was demonstrated that
The reliability of the present invention.
Claims (8)
1. a LAMP primer group, it is characterised in that described primer sets includes:
F3, sequence be GCTTATTTGGCATATTCGTTAG,
B3, sequence be ACTTACCCAATCCCGTGG,
FIP, sequence be GGCCAAAGAATTCACTAGGATAAGCGTGCTTTGGCTATTTGTGG,
BIP, sequence be GACGGCTGCTGAAGCATCTCTTTGCACCAAGTTTTTGATCTC,
LF, sequence be ACAAAGACTGCAGCTGTCAAT,
LB, sequence is AAGCACAAGCCTTTACGTTTCTTG.
2. primer sets as claimed in claim 1, it is characterised in that the sequence of described FIP is GGCCAAAGAATTCACTAGG
ATAAGCGTGCTTTGGCTATTTGTGG。
3. primer sets as claimed in claim 1, it is characterised in that the sequence of described BIP is GACGGCTGCTGAAGCATCT
CTTTGCACCAAGTTTTTGATCTC。
4. primer sets as claimed in claim 1 or 2, it is characterised in that the 5 ' end biotin labelings of described FIP.
5. primer sets as claimed in claim 1, it is characterised in that the 5 ' end FITC labellings of described LF.
6. the application in detection Michaelis triumphant human relations algae of the primer sets described in claim 1.
7. the test kit detecting Michaelis triumphant human relations algae, it is characterised in that it is arbitrary that described test kit includes claim 1-5
Primer sets described in Xiang.
8. the method detecting harmful algae Michaelis triumphant human relations algae, it is characterised in that described method comprises the steps
1) preparation LAMP reaction system:
Each primer final concentration of: each 1.6 μm ol/L of inner primer KM-FIP and KM-BIP, each 0.2 μ of outer primer KM-F3 and KM-B3
Each 0.8 μm ol/L of mol/L, ring primer KM-LF and KM-LB；Buffer forms and concentration is: Tris-HCl (pH 8.8)
20mmol/L, KCl 10mmol/L, MgSO48mmol/L, (NH4)2SO410mmol/L, the Tween20 of 0.1%, Betaine
0.8mol/L, dNTPs 1.4mmol/L；8U Bst archaeal dna polymerase and 2 μ L sample DNA profilings, add distilled water and make reaction system
Cumulative volume is 25 μ L；
2) LAMP reaction system amplification: above-mentioned reaction system is carried out nucleic acid amplification reaction, amplified reaction is temperature required is 61 DEG C-
65 DEG C, amplified reaction required time is 30min-60min；
3) LFD detection: take 8 μ L nucleic acid amplification products and product is joined mixing in 100 μ L Buffer, then by LFD test strips
It is dipped vertically into color developing detection in mixed solution, judges amplification by test strips.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610817623.7A CN106167799A (en) | 2016-09-12 | 2016-09-12 | A kind of detection method of Michaelis triumphant human relations algae |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610817623.7A CN106167799A (en) | 2016-09-12 | 2016-09-12 | A kind of detection method of Michaelis triumphant human relations algae |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106167799A true CN106167799A (en) | 2016-11-30 |
Family
ID=57376222
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610817623.7A Pending CN106167799A (en) | 2016-09-12 | 2016-09-12 | A kind of detection method of Michaelis triumphant human relations algae |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106167799A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112410456A (en) * | 2020-12-04 | 2021-02-26 | 中国科学院海洋研究所 | Kit and detection method for rapidly detecting Karenia mikimotoi on site |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105177135A (en) * | 2015-09-09 | 2015-12-23 | 宁波大学 | Detection method of karlodinium micrum |
-
2016
- 2016-09-12 CN CN201610817623.7A patent/CN106167799A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105177135A (en) * | 2015-09-09 | 2015-12-23 | 宁波大学 | Detection method of karlodinium micrum |
Non-Patent Citations (1)
| Title |
|---|
| 郑俊斌等: "米氏凯伦藻18S rDNA和转录间隔区序列分析", 《上海海洋大学学报》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112410456A (en) * | 2020-12-04 | 2021-02-26 | 中国科学院海洋研究所 | Kit and detection method for rapidly detecting Karenia mikimotoi on site |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105177135B (en) | A kind of detection method of Small nodule | |
| CN106434993B (en) | For detecting LAMP primer composition object and its application of cucumber fusarium axysporum | |
| CN105525010B (en) | A kind of loop-stem structure combination probe and its application | |
| CN103484571B (en) | LAMP (loop-mediated isothermal amplification) detection primer group, detection kit and detection method for infectious hypodermal and hematopoietic necrosis virus | |
| CN105039541A (en) | Primer and probe sequence used for LAMP-LFD detection of vibrio fluvialis and application of primer and probe sequence | |
| CN104789658B (en) | A kind of ring isothermal duplication primer of quick detection citrus Tylenchulus Semipenetrans and its application | |
| CN108060257A (en) | It is a kind of that strong male rotten mould Primer composition and its detection method are detected based on loop-mediated isothermal amplification technique | |
| CN108588277A (en) | A kind of canine distemper virus visualization nucleic acid detection method | |
| CN104818339B (en) | A kind of detection method of real-time fluorescent RCR ulcer bacteria | |
| CN103627818B (en) | The LAMP kit of detection Main Subtype avian leukosis virus | |
| CN103952472B (en) | For the primer of Streptococcus iniae LAMP-LFD Visual retrieval and the application of probe and primer and probe | |
| CN107502678A (en) | A kind of method and device for detecting blue algae producing microcystic toxins | |
| Patel et al. | Implementation of loop-mediated isothermal amplification methods in lateral flow devices for the detection of Rhizoctonia solani | |
| CN103436628B (en) | Method for rapidly detecting moderately-resistant strain in fusarium graminearum to carbendazim | |
| CN102703609A (en) | Onsite quick detection kit of channel catfish virus and detection method thereof | |
| CN104531885A (en) | Aeromonas veronii rapid detection primer, kit and application | |
| CN102952896A (en) | Universal loop-mediated isothermal amplification kit for detecting influenza A virus and application of universal loop-mediated isothermal amplification kit | |
| CN106434956A (en) | Detection method of heterosigma akashiwo | |
| CN106167799A (en) | A kind of detection method of Michaelis triumphant human relations algae | |
| CN106148333A (en) | A kind of detection method of prorocentrum minimum | |
| CN101921873A (en) | On-site rapid high-sensitivity detection kit of prawn infectivity muscle necrosis virus and detection method thereof | |
| CN104195254B (en) | Method based on loop-mediated isothermal amplification technique detection Herba Equiseti Hiemalis's Fusariumsp and Primer composition | |
| CN103451310B (en) | Gene chip capable of simultaneously detecting various vibrios and method for detecting vibrios | |
| CN103409499A (en) | LAMP (Loop-Mediated Isothermal Amplification) detection method for calcein fluorescence visualization salmonella | |
| CN106636082A (en) | Marine prorocentrum detection method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20161130 |