CN104195254B - Method based on loop-mediated isothermal amplification technique detection Herba Equiseti Hiemalis's Fusariumsp and Primer composition - Google Patents
Method based on loop-mediated isothermal amplification technique detection Herba Equiseti Hiemalis's Fusariumsp and Primer composition Download PDFInfo
- Publication number
- CN104195254B CN104195254B CN201410455196.3A CN201410455196A CN104195254B CN 104195254 B CN104195254 B CN 104195254B CN 201410455196 A CN201410455196 A CN 201410455196A CN 104195254 B CN104195254 B CN 104195254B
- Authority
- CN
- China
- Prior art keywords
- fusariumsp
- primer
- herba equiseti
- semen sojae
- equiseti hiemalis
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses method based on loop-mediated isothermal amplification technique detection Herba Equiseti Hiemalis's Fusariumsp and Primer composition.For detecting the LAMP primer composition thing of Semen sojae atricolor Herba Equiseti Hiemalis's Fusariumsp, it is made up of the ring primer LB shown in ring primer LF, SEQID NO.7 shown in reverse outer primer B3, SEQ ID NO.6 shown in forward outer primer F3, SEQ ID NO.5 shown in reverse inner primer BIP, SEQ ID NO.4 shown in forward inner primer FIP, SEQ ID NO.3 shown in SEQ ID NO.2.Primer composition of the present invention can be applied in the LAMP detection reagent of preparation Semen sojae atricolor Herba Equiseti Hiemalis's Fusariumsp.Test kit of the present invention has good specificity and sensitivity, and amplification quickly, efficiently, and identifies simplicity.The detection system of the present invention is under 62 DEG C of isothermys, and energy is quickly, convenient, efficient, height is special, Semen sojae atricolor Herba Equiseti Hiemalis's Fusariumsp detected with sensitivity.
Description
Technical field
The invention belongs to field of biological detection, relate to method based on loop-mediated isothermal amplification technique detection Herba Equiseti Hiemalis's Fusariumsp
And Primer composition.
Background technology
Semen sojae atricolor Fusarium is to be reported in the U.S. (1), main harm Soybean Root in 1917 by Crommell the earliest
System, affects crop to moisture and the absorption of nutrient.The generation of this disease can make the root activity of soybean plant strain, root weight, root nodule weight, fixed nitrogen
Enzymatic activity and side radical etc. (23) the most influenced to different extents.Disease can make Semen sojae atricolor general underproduction 10%-according to investigations
30%, up to 60% time serious.Know that this disease is distributed in the states such as China, the U.S., India, Japan and Philippine, (16,20,
21,22) it is the important disease having a strong impact on China northeast and Huang-Huai-Hai Soybean production, at Sanjiang Plain in Heilongjiang Province particularly
Seriously.
Semen sojae atricolor Fusarium can be infected by multiple Fusariumsp and cause, and the Fusariumsp that China has reported so far has sharp spore sickle
Spore bacterium (F.oxysporum), Fusarium solani (F.solani), Herba Equiseti Hiemalis's Fusariumsp (F.equiseti), Fusarium graminearum
(F.graninearum), Herba bromi japonici Fusariumsp (F.aveneum), F.semitectum bacterium (F.semitectum) etc..(19) wherein for
The Molecular Detection of Semen sojae atricolor Herba Equiseti Hiemalis's Fusariumsp We conducted a series of research.
Tradition fungus strain authentication method is mainly with morphology as foundation, i.e. by observing colonial morphology and individuality after cultivating
Cell microscopic features, by strain identification to guiding principle, mesh, section, genus and species.But the morphological characteristic of fungus is complicated, and some mushroom form
Feature and physiological and biochemical property are unstable along with the change of environment, therefore, often cause classification system in traditional classification of fungi
That unites is inconsistent.Simultaneously traditional classification authentication method time-consumingly long, sensitivity is low, easily by artificially and the factors such as environment is disturbed
(2), it is impossible to make diagnosis in disease incubation period and initial phase, it is difficult to disease be monitored timely and effectively controls.
Since the eighties in 20th century, along with the fast development of Protocols in Molecular Biology, different kinds of molecules Biological assay
Appearance so that molecular biology play in strain identification and biological classification are studied the most important role (3,5,9,
15).Also make identifying in the qualification based on morphological characteristic and physiological and biochemical index of strain more accurate, reliable simultaneously.
The method being currently used for detecting Semen sojae atricolor Herba Equiseti Hiemalis's Fusariumsp has PCR, a Real-time PCR, molecular marker etc., (8,10) although these
Method is greatly improved on specificity and sensitivity, however it is necessary that and relies on accurate temperature cycling device, and detection process is multiple
Miscellaneous, it is impossible to meet the demand of quickly detection.
Loop-mediated isothermal amplification technique (Loop-mediated isothermal amplification, LAMP) is Japan
A kind of new nucleic acid amplification technologies (12) that can invent of Rong Yan strain formula because it is simple to operate, quick, specificity is high, cost
The advantage such as low, becomes the new nucleic acid amplification technologies that can substitute regular-PCR.It is that 6 regions for target gene design 4 kinds
Special primer, causes self-loopa strand replacement reaction under the effect of Bst Large fragment polymerase, in 60～65 DEG C of scopes 60min,
The magnesium pyrophosphate precipitation being attended by by-product white while a large amount of synthesis target dnas produces.Due to LAMP amplification procedure
Relying on and identify 6 isolated areas of target sequence, so atopic is very strong, and amplification process is to enter under constant temperature
OK, light water bath or have the equipment of stable thermal source just can meet to react requirement, testing cost is substantially reduced.
Additionally, common PCR reaction carries out gel electrophoresis to product easily causes product diffusion, this is laboratory pollution
One main source；And ethidium bromide (EB) has huge poison, can accumulate carcinogenic；Experimenter also can be made by long-term uviol lamp of observing
Become a certain degree of injury.And LAMP reaction only need to be carried out in thermostat water bath, react after terminating by adding SYBR
Green I observe color and change in fluorescence just can direct judged result, greatly reduce the injury to experimenter, and increase
Using value in field.
Summary of the invention
The purpose of the present invention for cycle length needed for the biological detection method of Semen sojae atricolor Herba Equiseti Hiemalis Fusariumsp in prior art, take
Time laborious, loaded down with trivial details, the problem of poor specificity and PCR detection technique need thermal cycler instrument, it is impossible to quickly detection Semen sojae atricolor Herba Equiseti Hiemalis's sickle
The problem of spore bacterium, it is provided that the LAMP primer composition thing of detection Semen sojae atricolor Herba Equiseti Hiemalis's Fusariumsp.
It is a further object of the present invention to provide a kind of method detecting Semen sojae atricolor Herba Equiseti Hiemalis's Fusariumsp.
The purpose of the present invention can be achieved through the following technical solutions:
Semen sojae atricolor Herba Equiseti Hiemalis's Fusariumsp CYP51c gene order shown in SEQ ID NO.1 is wooden LAMP detection Semen sojae atricolor as target
Application in thief's Fusariumsp.
For detecting the LAMP primer composition thing of Semen sojae atricolor Herba Equiseti Hiemalis's Fusariumsp, by the forward inner primer shown in SEQ ID NO.2
Forward outer primer F3, SEQ ID NO.5 shown in reverse inner primer BIP, SEQ ID NO.4 shown in FIP, SEQ ID NO.3
The shown composition of the ring primer LB shown in ring primer LF, SEQ ID NO.7 shown in reverse outer primer B3, SEQ ID NO.6.
The Primer composition of the present invention application in detection Semen sojae atricolor Herba Equiseti Hiemalis's Fusariumsp.
The Primer composition of the present invention application in the LAMP detection reagent of preparation Semen sojae atricolor Herba Equiseti Hiemalis's Fusariumsp.
A kind of LAMP kit detecting Semen sojae atricolor Herba Equiseti Hiemalis's Fusariumsp, containing Primer composition of the present invention.
Described test kit preferably comprises detection solution and dyestuff SYBR Green I；Wherein said detection solution
By: 32mM forward inner primer FIP, 32mM reverse inner primer BIP, 8mM forward outer primer F3,8mM reverse outer primer B3,8mM ring
Primer LF, 8mM ring primer LB, 56mM dNTPs, 0.8M Tris-HCl (pH8.8), 0.4mM KCl, 0.4mM (NH4)2SO4、
0.24mM MgSO4, 4%Triton X-100, Bst DNA polymerase320 unit, add ultra-pure water prepare.
A kind of method detecting Semen sojae atricolor Herba Equiseti Hiemalis's Fusariumsp, takes microbial DNA to be checked, with this DNA as template, described in utilization
Primer composition carries out LAMP；After amplified reaction terminates, add dyestuff SYBR Green I, estimate or at 245nm ripple under daylight
Long ultraviolet light irradiates observes fluorescence；Change with the color of SYBR Green I and fluorescence is strong and weak as result criterion: daylight
Lower range estimation is that yellow green represents that testing result is positive, there is Semen sojae atricolor Herba Equiseti Hiemalis's Fusariumsp, estimates and represent detection in yellow under daylight
Result is negative, there is not Semen sojae atricolor Herba Equiseti Hiemalis's Fusariumsp；Under ultraviolet light, the green fluorescence sending out strong represents test positive, exists
Semen sojae atricolor Herba Equiseti Hiemalis's Fusariumsp, does not has fluorescence to represent and is detected as feminine gender, there is not Semen sojae atricolor Herba Equiseti Hiemalis's Fusariumsp (Fig. 1).
Wherein, LAMP response procedures is preferably: 62 DEG C, 60min.
Beneficial effect
The selection of target gene is one of key factor of LAMP detection.The target gene that regular-PCR is conventional has ribosome
Internal gene transcribed spacers (Internal transcribed space, ITS), but the differentiation sickle that this target can not be the clearest and the most definite
Spore belongs to fungus.The sterol 14 α-demethylase of CYP51 gene code is to be distributed the widest Cytochrome P450 family member, is
Key enzyme in biosterin building-up process.The CYP51 base of multiple copy it is found that in human gene and plant pathogenic fungi
Cause, as copied CYP51A, CYP51B containing two kinds in aspergillosis, rice blast fungus etc..Additionally there are the third copy CYP51C, quilt
Find to be present in specifically in fusarium strain gene.Inventor's early stage is ground with regular-PCR technology for detection Semen sojae atricolor Fusarium oxysporum
Study carefully it was also found that CYP51C gene order high conservative between different strains in Fusarium kind, between kind, there is abundant change,
It is to compare rDNA-ITS, β-tubulin sequence more preferable Molecular Detection target.The present invention analyzes Semen sojae atricolor Herba Equiseti Hiemalis's Fusariumsp
CYP51C gene and other Fusariumsps difference in sequence, select wherein 6 specific regions, devise four specific
LAMP primer and two ring primers, be successfully established the LAMP system of detection Semen sojae atricolor Herba Equiseti Hiemalis's Fusariumsp on this basis.
Compared with prior art, its advantage and good effect show the present invention:
(1) practicality is good.Common PCR reaction carries out gel electrophoresis and easily causes product diffusion product, and this is experiment
One main source of chamber contamination；And ethidium bromide (EB) has huge poison, can accumulate carcinogenic；Long-term observation uviol lamp also can be to reality
The personnel of testing cause a certain degree of injury.And LAMP reaction only need to be carried out in thermostat water bath, reaction terminates to pass through afterwards
The color of SYBR Green I and change in fluorescence just can direct judged result, thus add its using value in field.
(2) constant-temperature amplification.Unlike PCR method have to thermal cycle, thus broken away from the dependence to thermal cycler instrument, as long as
Having stable thermal source LAMP reaction just can occur, extend the scope that LAMP uses greatly, why LAMP can be constant
Thermal source under react and be because with the addition of glycine betaine in LAMP reactant liquor, make double-stranded DNA be in the dynamic equilibrium unwind
In, under the effect of BstDNA polymerase, realize amplification.
(3) accuracy is high.Owing to traditional soybean Herba Equiseti Hiemalis's Fusariumsp detection technique simply determines quarantine according to morphological characteristic
Object, authentication method time-consumingly long, sensitivity is low, easily by artificially and the factors such as environment is disturbed；And the present invention is according to Semen sojae atricolor
The CYP51C sequence of Herba Equiseti Hiemalis's Fusariumsp, this sequence is the most conservative, by Semen sojae atricolor Herba Equiseti Hiemalis in the genome in Semen sojae atricolor Herba Equiseti Hiemalis's Fusariumsp
The CYP51C sequence of Fusariumsp and the CYP51C sequence of other Fusariumsps compare, and choose Semen sojae atricolor Herba Equiseti Hiemalis's Fusariumsp distinctive
The section specific LAMP primer of CYP51C sequential design.LAMP reaction is only by 6 on 4 primer specificity identification target sequences
Vertical region, for 2 isolated areas of PCR primer identification target sequence, specificity and sensitivity are the highest.
Figure of description
Fig. 1 LAMP detection Semen sojae atricolor Herba Equiseti Hiemalis's Fusariumsp positive findings and negative findings schematic diagram.Wherein, A figure is visual observation
Figure, B figure is observed result under ultraviolet light；In every photos, the EP pipe on the left side is positive findings, and the EP pipe on the right is negative findings.
The specificity of Fig. 2 LAMP detection Semen sojae atricolor Herba Equiseti Hiemalis's Fusariumsp
By the bacterial strain of 8 other kinds of Fusarium being amounted to 180 bacterial strains, and with 11 other genus pathogen bacterial strains altogether
Counting 76 bacterial strains and carried out LAMP amplification, specificity LAMP reaction can only produce yellow green in the F.eauiseti bacterial strain for examination
Color change with produce green fluorescence (1-3: Semen sojae atricolor Herba Equiseti Hiemalis's Fusariumsp bacterial strain；4: layer goes out Fusariumsp；5: Fusarium graminearum；6:
Fusarium oxysporum；7: Fusarium solani；8: the rotten Fusariumsp of snow；9: Herba bromi japonici Fusariumsp；10: Fusarium moniliforme；11: yellow fusarium
Bacterium；12: aspergillus oryzae；13: alternaric bacteria；14: glue born of the same parents' anthrax；15: tack anthrax；16: Semen sojae atricolor rest fungus；17: Semen sojae atricolor is intended
Stem point swells maize ear rot bacterium；18: soyabean phytophthora；19: Semen sojae atricolor charcoal rot bacterium；20: rice blast fungus；21: oil bottle mycete；22: ball Tuber Melanosporum；
23-24: negative control.) upper two rows are visual observation, lower two rows are observed result under ultraviolet light.
The sensitivity of Fig. 3 LAMP detection Semen sojae atricolor Herba Equiseti Hiemalis's Fusariumsp
LAMP expands Semen sojae atricolor Herba Equiseti Hiemalis's Fusariumsp variable concentrations genomic DNA；The reaction system of 25 μ L contains respectively
The amplification of 100ng, 10ng, 1ng, 100pg, 10pg, 1pg, 100fg, 10fg DNA.
Color and fluorescence judge the sensitivity colour developing figure of LAMP detection Semen sojae atricolor Herba Equiseti Hiemalis Fusariumsp bacterium.Positive reaction presents yellowish green
Color also has strong green fluorescence, and negative control is yellow, does not show fluorescence.Result shows that the sensitivity that LAMP reacts reaches
10pg.First row is visual observation, and second row is observed result under ultraviolet light.
Semen sojae atricolor Herba Equiseti Hiemalis's Fusariumsp in Fig. 4 LAMP detection disease plant
Take the soy bean plant tissue infected by Herba Equiseti Hiemalis's Fusariumsp, extract genome, carry out LAMP amplification.Color and fluorescence are sentenced
Determine LAMP reaction and can detect the Herba Equiseti Hiemalis's Fusariumsp infected in plant.(1-4: disease plant；5: Herba Equiseti Hiemalis's Fusariumsp genome；6:
Healthy plant；7: negative control.) first row is visual observation, second row is observed result under ultraviolet light.
Detailed description of the invention
Embodiment 1 field gathers detects Semen sojae atricolor Herba Equiseti Hiemalis's Fusariumsp in plant
Semen sojae atricolor Herba Equiseti Hiemalis's Fusariumsp detection kit, including following component:
Four specific primers FIP, BIP, F3, B3 of Semen sojae atricolor Herba Equiseti Hiemalis's Fusariumsp LAMP Molecular Detection and two ring primers
LF, LB:
F3 (forward outer primer): GCGTACCCGGTACCGAAT (18bp, SEQ ID NO.4)；
B3 (reverse outer primer): GGACTGGTGACAGACTTGTT (20bp, SEQ ID NO.5)；
FIP (forward inner primer) (F1C+F2):
GGAGGGTCGAGGGAAGAACTCT-TAGTGCCTCCGTCCCATAC (41bp, SEQ ID NO.2)；
BIP (reverse inner primer) (B1C+B2):
TGGGATCCTCATCGCTGGGA-CCGAAGCCATAATCCACAGT (40bp, SEQ ID NO.3).
LF (ring primer): TGCCAGGAGATGCAAGAAGT (20bp, SEQ ID NO.6)
LB (ring primer): CGAGCCTCTTGAGAAGAACGCC (22bp, SEQ ID NO.7)
Test kit reaction system
1mL detection solution includes: 32mM forward inner primer FIP, 32mM reverse inner primer BIP, 8mM forward outer primer F3,
8mM reverse outer primer B3,8mM ring primer LF, 8mM ring primer LB, 56mM dNTPs, 0.8M Tris-HCl (pH 8.8),
0.4mM KCl、0.4mM(NH4)2SO4、0.24mM MgSO4, 4%Triton X-100, Bst DNA polymerase320 mono-
Position, adds ultra-pure water and is prepared as 1mL detection solution；Dyestuff SYBR Green I25 μ L.Pot-life is 1 year.
Embodiment 2
In order to verify the specificity of LAMP method, select Semen sojae atricolor Herba Equiseti Hiemalis's Fusariumsp bacterial strain, the sickle the most of the same race with Herba Equiseti Hiemalis's fusarium
(layer goes out Fusariumsp to spore bacteria strain；Fusarium graminearum；Fusarium oxysporum；Fusarium solani；The rotten Fusariumsp of snow；Herba bromi japonici Fusariumsp；String
Pearl Fusariumsp；Yellow Fusariumsp), and the bacterial strain (aspergillus oryzae not belonged to together with Semen sojae atricolor point fusarium；Alternaric bacteria；Glue born of the same parents' anthrax
Bacterium；Tack anthrax；Semen sojae atricolor rest fungus；Semen sojae atricolor is intended stem point and swells maize ear rot bacterium；Soyabean phytophthora；Semen sojae atricolor charcoal rot bacterium；Rice blast fungus；Oil bottle
Mycete；Ball Tuber Melanosporum) DNA as template, take 4 μ l DNA solutions, utilize the detection kit of embodiment 1, carry out LAMP anti-
Should, LAMP response procedures: 62 DEG C, 60min.After amplified reaction terminates, add dyestuff SYBR Green I, under daylight range estimation or
245nm wavelength ultraviolet radiation observes fluorescence；Result shows the DNA profiling going to expand Semen sojae atricolor Herba Equiseti Hiemalis's Fusariumsp by LAMP primer
Time, produce the change of yellowish green color and produce green fluorescence；And other bacterial strain is as negative control, color is not had to change
Or strong green fluorescence (Fig. 2).
Embodiment 3
In order to determine the sensitivity of LAMP detection method, by the DNA light splitting light of Semen sojae atricolor Herba Equiseti Hiemalis's Fusariumsp bacterial strain of extraction
Degree meter carries out 10 doubling dilutions with DEPC water after measuring concentration (1 μ g/ μ l), and 70 DEG C preserve as template.Take 10 multiple proportions respectively dilute
Each concentration DNA diluent 4 μ L after releasing is as template, as described in Example 2, carries out LAMP reaction and result is observed.Result
Display LAMP method can detect that concentration is the DNA (Fig. 3) of Semen sojae atricolor Herba Equiseti Hiemalis's Fusariumsp of 10pg
Embodiment 4 is carried disease germs detect Semen sojae atricolor Herba Equiseti Hiemalis's Fusariumsp soil sample from the customs Semen sojae atricolor that enters the territory:
Above-mentioned Semen sojae atricolor Herba Equiseti Hiemalis's Fusariumsp detection kit is used for the method detecting Semen sojae atricolor Herba Equiseti Hiemalis's Fusariumsp, including:
1) enrichment of oospore in soil:
Take pedotheque to be checked 20 grams, grind, successively use the 200 bigger grogs in eye mesh screen place to go, be then passed through 400,
500,800 eye mesh screens filter, and repeatedly rinse with 3 liters of water simultaneously, from 800 mesh sieve online collection oospore, use 1ml aqueous suspension.By
800 eye mesh screens can not be passed through in oospore, so process the effect that can reach to make oospore be enriched with.
2) from trace oospore, DNA is extracted:
The oospore suspended with sterilized water is transferred in the centrifuge tube of 1.5mL, under 12000r.min-1 rotating speed, be centrifuged 5
Minute, pour out liquid；
Add 50 μ L CTAB buffer, grind, add 500 μ L CTAB buffer, water-bath 30 minutes；
Add equal-volume chloroform, at 12000r min-1It is centrifuged 10 minutes under rotating speed, draws supernatant；
Add the 3M NaAc of 1/10 volume, the ethanol without water-ice of 2 times of volumes, precipitation at room temperature 30 minutes, 12000r min-1
It is centrifuged 10 minutes under rotating speed, dry liquids；
Add 1mL70% (V/V) washing with alcohol, 12000r min-1It is centrifuged 10 minutes under rotating speed, dry liquids, dries to nothing
Alcohol smell；
Add 10 μ L aseptic double-distilled waters to dissolve, for the template of LAMP amplification.
3) Semen sojae atricolor Herba Equiseti Hiemalis Fusariumsp LAMP detection, including:
(1) the LAMP detection of Semen sojae atricolor Herba Equiseti Hiemalis Fusariumsp: take 4 μ L DNA solutions, add 18 μ L test kit solution and 3 μ L sterilizings
Deionized water, cumulative volume is 25 μ L；
(2) response procedures is: 62 DEG C, 60min；
(3) detection of amplified production: add 0.25 μ L dyestuff SYBR Green I after amplification as reaction indicator, naked eyes
Observe, and 245nm wavelength ultraviolet radiation observes fluorescence.Change with the color of SYBR Green I and fluorescence is strong and weak as knot
Really criterion.Under daylight, yellow green represents test positive, there is Semen sojae atricolor Herba Equiseti Hiemalis's Fusariumsp, and yellow represents that testing result is
Negative；Under ultraviolet light, strong green fluorescence represents test positive, there is Semen sojae atricolor Herba Equiseti Hiemalis's Fusariumsp, does not has fluorescence to represent inspection
Survey as feminine gender.
Embodiment 5 identifies Semen sojae atricolor Herba Equiseti Hiemalis's Fusariumsp from morbidity soyabean tissue
By the soybean leaves infected by pathogen or rhizome position with after 70% alcohol disinfecting, the NaOH method improved is used to carry
Take DNA.Taking the plant tissue of one section of neopathy, every milligram of tissue adds 10 μ L 0.5mol/L NaOH, fully grinds in mortar
It is transferred to after mill in the centrifuge tube of 1.5mL, 12000r min-1Under rotating speed, centrifugal 5min, takes 5 μ L of supernatant liquid and adds 495 μ
L0.1mmol/L Tris (pH8.0), draws 4uL DNA solution, as described in Example 2, carries out LAMP reaction after mixing, and
With Herba Equiseti Hiemalis's Fusariumsp genome, healthy plant；And blank negative for compareing, result is shown in Fig. 4, it is seen that disease plant pipe is at daylight
Lower range estimation is yellow green, produces green fluorescence under ultraviolet light, identical with the color of Semen sojae atricolor Herba Equiseti Hiemalis's Fusariumsp genome pipe；Prove institute
The cause of disease of detection is Semen sojae atricolor Herba Equiseti Hiemalis's Fusariumsp；Healthy plant and blank negative control are estimated the most in the sunlight as yellow, ultraviolet
Administration unstressed configuration.
Claims (7)
1. for detecting the LAMP primer composition thing of Semen sojae atricolor Herba Equiseti Hiemalis's Fusariumsp, it is characterised in that by shown in SEQ ID NO.2 just
Inwardly forward outer primer F3, SEQ shown in reverse inner primer BIP, SEQ ID NO.4 shown in primers F IP, SEQ ID NO.3
The ring primer LB shown in ring primer LF, SEQ ID NO.7 shown in reverse outer primer B3, SEQ ID NO.6 shown in ID NO.5
Composition.
2. the application in detection Semen sojae atricolor Herba Equiseti Hiemalis's Fusariumsp of the Primer composition described in claim 1.
3. the application in the LAMP detection reagent of preparation Semen sojae atricolor Herba Equiseti Hiemalis's Fusariumsp of the Primer composition described in claim 1.
4. the LAMP kit detecting Semen sojae atricolor Herba Equiseti Hiemalis's Fusariumsp, it is characterised in that containing the primer sets described in claim 1
Compound.
The LAMP kit of detection Semen sojae atricolor Herba Equiseti Hiemalis's Fusariumsp the most according to claim 4, it is characterised in that described reagent
Box comprises detection solution and dyestuff SYBR Green I；Wherein said detection solution by: 32 mM forward inner primer FIP, 32
MM reverse inner primer BIP, 8 mM forward outer primer F3,8 mM reverse outer primer B3,8 mM ring primer LF, 8 mM ring primers
LB, 56 mM dNTPs, the Tris-HCl of 0.8 M pH 8.8,0.4 mM KCl, 0.4 mM (NH4)2SO4、 0.24 mM
MgSO4, 4% Triton X-100, Bst DNA polymerase 320 units/mL, add ultra-pure water prepare.
6. the method detecting Semen sojae atricolor Herba Equiseti Hiemalis's Fusariumsp, it is characterised in that take microbial DNA to be checked, with this DNA as template, profit
LAMP is carried out by the Primer composition described in claim 1；After amplified reaction terminates, add dyestuff SYBR Green I, daylight
Lower range estimation or 245 nm wavelength ultraviolet radiation observe fluorescence；Change with the color of SYBR Green I and fluorescence strong and weak as
Result criterion: estimate under daylight and represent that in yellow green testing result is positive, there is Semen sojae atricolor Herba Equiseti Hiemalis's Fusariumsp, mesh under daylight
Survey and represent that in yellow testing result is negative, there is not Semen sojae atricolor Herba Equiseti Hiemalis's Fusariumsp；Under ultraviolet light, the green fluorescence sending out strong represents
, there is Semen sojae atricolor Herba Equiseti Hiemalis's Fusariumsp, not having fluorescence to represent and be detected as feminine gender in test positive, there is not Semen sojae atricolor Herba Equiseti Hiemalis's Fusariumsp.
The method of detection Semen sojae atricolor Herba Equiseti Hiemalis's Fusariumsp the most according to claim 6, it is characterised in that LAMP response procedures is: 62
DEG C, 60min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410455196.3A CN104195254B (en) | 2014-09-09 | 2014-09-09 | Method based on loop-mediated isothermal amplification technique detection Herba Equiseti Hiemalis's Fusariumsp and Primer composition |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410455196.3A CN104195254B (en) | 2014-09-09 | 2014-09-09 | Method based on loop-mediated isothermal amplification technique detection Herba Equiseti Hiemalis's Fusariumsp and Primer composition |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104195254A CN104195254A (en) | 2014-12-10 |
| CN104195254B true CN104195254B (en) | 2016-08-24 |
Family
ID=52080616
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410455196.3A Active CN104195254B (en) | 2014-09-09 | 2014-09-09 | Method based on loop-mediated isothermal amplification technique detection Herba Equiseti Hiemalis's Fusariumsp and Primer composition |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104195254B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105256049B (en) * | 2015-11-09 | 2019-01-25 | 南京农业大学 | It is a kind of detect yellow Fusariumsp loop-mediated isothermal amplification (LAMP) primer composition and its application |
| CN108315469B (en) * | 2018-04-09 | 2021-10-22 | 中国农业科学院农产品加工研究所 | Primer composition and kit for detecting pathogenic fusarium by loop-mediated isothermal amplification method and application of primer composition and kit |
| CN114045358B (en) * | 2021-10-15 | 2023-08-18 | 南京农业大学 | Primer composition for detecting twelve potato disease pathogenic bacteria based on loop-mediated isothermal amplification technology and detection method |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103352078A (en) * | 2013-07-11 | 2013-10-16 | 南京农业大学 | Method and primer composition for detecting soybean fusarium oxysporum based on LAMP (loop-mediated isothermal amplification) technology |
| CN103409522A (en) * | 2013-08-08 | 2013-11-27 | 黑龙江省科学院微生物研究所 | Method for identifying auricularia auricula-judae white mildew disease caused by infecting fusarium equiseti and fusarium sporotrichioides |
-
2014
- 2014-09-09 CN CN201410455196.3A patent/CN104195254B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103352078A (en) * | 2013-07-11 | 2013-10-16 | 南京农业大学 | Method and primer composition for detecting soybean fusarium oxysporum based on LAMP (loop-mediated isothermal amplification) technology |
| CN103409522A (en) * | 2013-08-08 | 2013-11-27 | 黑龙江省科学院微生物研究所 | Method for identifying auricularia auricula-judae white mildew disease caused by infecting fusarium equiseti and fusarium sporotrichioides |
Non-Patent Citations (1)
| Title |
|---|
| The CYP51C gene,a reliable marker to resolveinter specific phylogenetic relationships within the Fusarium species complex and a novel target for species-specific PCR;Dolores Fernández-Ortuño等;《International journal of food microbiology》;20101231;第144卷(第2期);301-309 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104195254A (en) | 2014-12-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103352078B (en) | Method and primer composition for detecting soybean fusarium oxysporum based on LAMP (loop-mediated isothermal amplification) technology | |
| CN104313128B (en) | Method based on loop-mediated isothermal amplification technique detection Fusarium graminearum and Primer composition | |
| CN104372104B (en) | A kind of LAMP detection primer composition of camphor tree phytophthora and LAMP detection kit thereof and LAMP detection method | |
| CN104774955B (en) | The detection method of a kind of grape seat chamber bacterium | |
| CN108060257A (en) | It is a kind of that strong male rotten mould Primer composition and its detection method are detected based on loop-mediated isothermal amplification technique | |
| CN105238876B (en) | LAMP primer group and its application method for tobacco ralstonia solanacearum detection | |
| CN105331714B (en) | A kind of peronophythora litchi LAMP primer and its rapid detection method | |
| CN104195254B (en) | Method based on loop-mediated isothermal amplification technique detection Herba Equiseti Hiemalis's Fusariumsp and Primer composition | |
| CN104962639B (en) | A kind of the LAMP primer group and detection method of the how main stick spore bacterium of quick detection | |
| CN106381340B (en) | Botrytis cinerea LAMP detection primer, detection kit and its application | |
| CN103243166A (en) | Rapid molecular detection method and application for plasmopara viticola | |
| CN104593502A (en) | Loop-mediated isothermal amplification primer composition capable of detecting colletotrichum truncatum and application thereof | |
| CN104232782B (en) | A kind of detect tobacco soil-borne fungus pathogen PCR primer and application and method | |
| CN104372099B (en) | A kind of LAMP detection primer compositionss of Phytophthora cactorum bacterium and its LAMP detection kit and LAMP detection method | |
| CN106755339B (en) | Cucumber anthracnose LAMP detection primer and its application | |
| CN102010910A (en) | Loop-mediated isothermal amplification technology-based plasmodium genus and species nucleic acid screening method | |
| CN104372092B (en) | The LAMP detection primer composition of a kind of banksia rose phytophthora and LAMP detection kit thereof and LAMP detection method | |
| CN104232748B (en) | Whether a kind of red bayberry nursery stock carries the rapid molecular detection method of wilting germ | |
| CN107828905A (en) | Tobacco smoke pollution LAMP detection primer and detection method | |
| CN104328205B (en) | The foundation of downy mildew of millet bacterium LAMP method for quick | |
| CN106086211A (en) | LAMP primer group, test kit and the detection method of detection Flos Nelumbinis corruption pathogenic bacteria | |
| CN102827939A (en) | Loop-mediated isothermal amplification (LAMP) primer of genetically modified maize BT11 strain, reagent kit and application of LAMP primer | |
| CN105219868A (en) | Herba Anoectochili roxburghii anthrax LAMP detection primer and visible detection method thereof | |
| CN108411017A (en) | Detect the LAMP primer and method of pseudomonas syringae tomato pvs oryzae and oryzicola | |
| CN105039331B (en) | A kind of peronophythora litchi LAMP primer and its quick determination method and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |