CN105219868A - Herba Anoectochili roxburghii anthrax LAMP detection primer and visible detection method thereof - Google Patents

Herba Anoectochili roxburghii anthrax LAMP detection primer and visible detection method thereof Download PDF

Info

Publication number
CN105219868A
CN105219868A CN201510735691.4A CN201510735691A CN105219868A CN 105219868 A CN105219868 A CN 105219868A CN 201510735691 A CN201510735691 A CN 201510735691A CN 105219868 A CN105219868 A CN 105219868A
Authority
CN
China
Prior art keywords
lamp
anthrax
herba anoectochili
anoectochili roxburghii
primer
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201510735691.4A
Other languages
Chinese (zh)
Inventor
陈子岩
张群林
刘小丽
李本金
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Individual
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Priority to CN201510735691.4A priority Critical patent/CN105219868A/en
Publication of CN105219868A publication Critical patent/CN105219868A/en
Pending legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Botany (AREA)
  • Mycology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a kind of Herba Anoectochili roxburghii anthrax LAMP detection primer and visible detection method thereof, be exclusively used in Herba Anoectochili roxburghii anthrax specific detection.Main employing devises a kind of LAMP primer of Herba Anoectochili roxburghii anthrax, and after LAMP constant-temperature amplification, color reaction or agarose gel electrophoresis detect, and can be observed green fluorescence or occur the distinctive trapezoid belt of LAMP.LAMP primer of inventing and using method thereof can be used to the plant of Herba Anoectochili roxburghii anthrax contagion in production practice quick, sensitive, detect accurately, can be used for the early diagnosis of field diseases and the monitoring of germ and qualification, the control for Herba Anoectochili roxburghii anthrax provides reliable technology and theoretical foundation simultaneously.

Description

Herba Anoectochili roxburghii anthrax LAMP detection primer and visible detection method thereof
Technical field
Herba Anoectochili roxburghii anthrax LAMP detection primer of the present invention and Visual retrieval usage thereof, be exclusively used in Herba Anoectochili roxburghii anthrax high specific, the visual rapid detection of sensitivity, can be used for the early diagnosis of field Herba Anoectochili roxburghii anthrax and the monitoring of germ and qualification simultaneously, belong to that corps diseases detects, qualification and Prevention Technique field.
Background technology
Herba Anoectochili roxburghii is perennial Valuable Herbal Medicine, has another name called Anoectochilus Roxburghii, and also someone is referred to as Rough Melic and gold thread disappears to the marrow, has very high pharmaceutical use, as clearing heat and cooling blood, Eradicates wind dampness removing, cardiac stimulant diuresis, reinforce the kidney, the effect such as flat liver.As the health-care medicinal enjoying high praise in recent years, businessman have developed many related productss to this, be subject to extensively liking of human consumer, but wild Herba Anoectochili roxburghii is harsh to the requirement of growing environment, add artificial excessively excavating, faced the condition of extinction, at present, artificial culture is the best approach solved the problem.The cultivation technique of Herba Anoectochili roxburghii is also very ripe, but the disease problem of Herba Anoectochili roxburghii also highlights day by day, occur in Herba Anoectochili roxburghii planting greenhouse that Herba Anoectochili roxburghii is transplanted rear anthrax and seriously occurred, the pathogenic bacteria of anthrax is colletotrichum gloeosporioides Penz, the classification of this germ belongs to mycota, Deuteromycotina, Coelomycetes, the thorn dish spore Pseudomonas of Melanconiales, Melanconiaceae and disk spore belong to, the temperature of colletotrichum gloeosporioides Penz mycelia optimum growth is 28 DEG C, conidium produces and the optimum temperuture of sprouting is 28 DEG C to 32 DEG C, and relative humidity is 85%.It is large that current Herba Anoectochili roxburghii produces upper anthrax onset area, and infection velocity is fast, badly influences the yield and quality of Herba Anoectochili roxburghii.Meanwhile, owing to lacking effective disease early diagnosis technology at present, after morbidity, blindly a large amount of use chemical control also causes the pesticide residue of Herba Anoectochili roxburghii, causes food-safety problem.Therefore, develop the Rapid&Early diagnosis of Herba Anoectochili roxburghii disease and monitor in time, to guarantee Herba Anoectochili roxburghii health produce and food safety most important.
Current Defect inspection method mainly adopts the technology such as traditional pathogen separation detection method and Molecular Detection.Traditional detection method is consuming time, effort, and detected result reliability is low, the sensitivity of immunology detection technology is lower, and the making processes of antibody is consuming time, complicated, testing cost is high, although round pcr fast, accurately, needs expensive plant and instrument, testing cost is high, is not suitable for applying in department of basic unit.And the ring mediated isothermal amplification (loop-mediatedisothermalamplification that nearest scientists is developed, LAMP) technology is a kind of high efficiency nucleic acid isothermal amplification method, a large amount of amplifications of product are realized in the method short period of time, remolding sensitivity PCR is high, and simple operating steps, without the need to specific installation, detected result can be judged by naked eyes, and pole is suitable for applying in production department of basic unit.This research is based on ring mediated isothermal amplification (LAMP) technology, set up the Visual retrieval of Herba Anoectochili roxburghii anthrax, according to LAMP technology principle, choose the Internal Transcribed Spacer (InternalTranscribedSpacer on the ribosomal gene of Herba Anoectochili roxburghii anthrax bacteria, ITS) 6 regions of target sequence, and then design 4 Auele Specific Primers, by the optimization to reaction system and reaction conditions, with the fluorescence developing indicator effect of fluorexon (Calcein), set up visual LAMP detection technique.This system detects Herba Anoectochili roxburghii anthrax has high specificity and susceptibility, detects and is limited to 10fg, more highly sensitive than Standard PCR 1000 times.And develop visual quick detection kit on this basis.This technology is the rapid detection means that a kind of simple to operate, sensitivity and specificity are high; Without the need to special instruments and equipment, the quick detection kit simultaneously developed is applicable to carrying out testing and monitoring on the spot during field Herba Anoectochili roxburghii is produced, thus ensures that Herba Anoectochili roxburghii health is produced and food safety.
At present, being first carry out germ separation to the traditional detection authentication method of Plant diseases, by cultivating the germ being separated also purifying, observing, the qualification work on completion morphology.Meanwhile, by pathogenic bacteria tieback in plant, carry out pathogenic checking.Finally, classification and status that existing grouped data determines to cause the pathogenic bacteria of disease is contrasted.This method is widely used all the time as the most basic pathogen identification method, there is very strong practicality, one of the qualification of pathogenic bacteria and the method for Defect inspection, but the method is subject to the impact of human factor and environment, very high requirement is had to the experimental skill of operator and practical experience, very consuming time, the requirement of quick test cannot be reached.
Immunology detection technology (Immunologicaltechnology) has simple to operate, high specificity, and the advantage that detection time is short, is applicable to exploitation detection kit.But it can not increase to detected object, so sensitivity is high not as good as nucleic acid detection technique.In addition, the making processes of antibody is consuming time, complicated, improves the cost of detection.These 2 shortcomings limit promoting the use of of immunology detection technology.
Polymerase chain reaction (PolymeraseChainReaction, PCR) be a kind of technology utilizing archaeal dna polymerase a large amount of amplified target sequence in vitro, this technology is one of the most conventional method of Pathogen test, is widely used in Pathogen identification, variation detects equimolecular biological study.PCR detection technique is highly sensitive, high specificity, become one of important technology of detection of pathogens, mainly comprise Standard PCR, nest-type PRC (Nest-PCR) and real-time fluorescence quantitative PCR etc., main shortcoming needs to rely on the plant and instrument such as PCR, is unfavorable for that basic unit applies on producing.
Ring mediated isothermal amplification (Loop-mediatedIsthermalAmplification, LAMP) technology is a kind of up-to-date easy, quick, the accurate and cheap nucleic acid Efficient amplification method (Notomi developed by Japanese Scientists etal., 2000).LAMP technology is a kind of novel nucleic acid constant-temperature amplification method.This technology under isothermal conditions, can make product be increased in a large number at short notice, in short 30min ~ 60min, just can realize 10 9-10 10amplification doubly has very high sensitivity and specificity simultaneously, and easy and simple to handle, and detected result can judge by naked eyes, detects by an unaided eye and whether produces magnesium pyrophosphate precipitation, can judge whether target sequence exists after reaction terminates.Also can add fluorescent indicator in reaction solution, make the visual inspection of reaction result more convenient, directly perceived and reliable.
LAMP technology is simple to operate, rapidly and efficiently, and detection specificity is very strong, and its maximum advantage can carry out amplified reaction at constant temperature exactly, without the need to special experimental installation, compared to regular-PCR technology, its have many good qualities (table 1).
Table 1.LAMP technology and Standard PCR Technical comparing
To sum up, the detection of current Plant diseases mainly contains traditional detection and molecular Biological Detection.Wherein, traditional detection method is consuming time, effort, and detected result reliability is often lower; Molecular biological assay mainly contains Standard PCR, Nest-PCR and qPCR etc., PCR method can detect cause of disease quickly and accurately, but need particular instrument equipment, and testing cost is higher, be not suitable for applying of basic unit's inspection and quarantine department, make the field state of an illness be difficult to obtain detecting in time, accurately, seriously hinder Herba Anoectochili roxburghii industry development.Seriously occur in Fujian Province based on current Herba Anoectochili roxburghii anthrax, therefore, the detection technique setting up a set of easy, quick, accurate and effective, economic Herba Anoectochili roxburghii anthrax is extremely important.This technology can be applicable to Herba Anoectochili roxburghii anthrax bacteria cause disease show disease before early monitoring, for determining that disease control best period has important effect, for the formulation of control strategy provides technical support.Because LAMP reaction is simple, quick, efficient, economic dispatch feature, thus there is application prospect very widely.Current LAMP detects and is mainly used in people and animals' pathogen, food safety and sanitary detection, and in phytopathogen detects, report is few, and the detection of Herba Anoectochili roxburghii anthrax is not reported both at home and abroad.
Summary of the invention
The object of the invention is cycle length, detection method poor specificity needed for the traditional detection method for Herba Anoectochili roxburghii anthrax in prior art, PCR detects to be needed to rely on the equipment such as amplification instrument, and the problem that sensitivity is low, the visible detection method of a kind of LAMP detection primer of Herba Anoectochili roxburghii anthrax and reliable results, easy handling, high specificity, highly sensitive Herba Anoectochili roxburghii anthrax is provided.
Realize object of the present invention to comprise the following steps:
The design of 1.LAMP primer
According to Herba Anoectochili roxburghii anthrax bacteria rrna the Internal Transcribed Spacer (rDNA-ITS) sequence highly divergent isolate and kind internal stability between fungi kind, PrimerExplorerV4 software design is adopted Herba Anoectochili roxburghii anthrax bacteria to be had to the LAMP detection primer of specific amplified effect, comprise 2 outer primers (F3 and B3) and 2 inner primers (FIP and BIP), primer sequence is respectively:
F3:ATGCCTGTTCGAGCGTCA;
B3:TCCGAGGTCAACCTTTGGAA
FIP:GCCACTACCTTTGAGGGCCTAC-TTTCAACCCTCAAGCTCTGC
BIP:CGGAGCCTCCTTTGCGTAGTAA-GGGTTTTACGGCAAGAGTCC)
2. the foundation of Herba Anoectochili roxburghii anthrax rapid detection system
LAMP detects: containing 20mMTris-HCl, 10mM (NH in 25 μ l reaction systems 4) 2sO 4, 10mMKCl, 8mMMgSO 4, trimethyl-glycine 0.8mol/L, bstarchaeal dna polymerase is 8U, dNTPs1.0mmol/L, F3 and B3 is each 1.6mmol/L of 0.2mmol/L, FIP and BIP, fluorexon 50 μm of ol/L, Manganous chloride tetrahydrate 500 μm of ol/L, TWeen-200.1%, template DNA 50 ~ 100ng, and insufficient section aseptic double-distilled water is supplied; LAMP reaction conditions is at 63-65 DEG C of incubation 45-60min, 85 DEG C of deactivation 5-10min.
Described detection method is fluorescence dye visual observations method or agarose gel electrophoresis method.Described fluorescence dye visual observations method: after LAMP reaction, colour developing result is observed green fluorescence and is judged as the positive, is orangely judged as feminine gender.Described agarose gel electrophoresis method: get 2 μ lPCR amplified production 2% agarose gel electrophoresis and detect, be judged as the positive if there is the distinctive trapezoid belt of LAMP, do not occur that amplified band is judged as feminine gender.
The application of described Herba Anoectochili roxburghii anthrax LAMP detection primer in the early diagnosis of field Herba Anoectochili roxburghii anthrax and the monitoring of germ and qualification.
The method can be used for the highly sensitive rapid detection of the plant carried disease germs.Set up that Herba Anoectochili roxburghii anthrax is quick, easy, high specificity, highly sensitive Monitoring techniques system, the early monitoring before showing disease for Herba Anoectochili roxburghii anthrax, determines that disease control best period tool is of great significance.
Guardian technique of the present invention is primer sequence and the amplification method thereof of the efficient specific amplified of Herba Anoectochili roxburghii anthrax bacteria.In order to verify the specificity that Herba Anoectochili roxburghii anthrax detects, the present invention tries material with the 25 strain Herba Anoectochili roxburghii anthrax bacterias and 28 kinds of other pathogenic fungies that gather separation for supplying, and carries out LAMP checking to the specificity detected.
LAMP detects: containing 20mMTris-HCl, 10mM (NH in 25 μ l reaction systems 4) 2sO 4, 10mMKCl, 8mMMgSO 4, trimethyl-glycine 0.8mol/L, bstpolysaccharase is 8U, dNTPs1.0mmol/L, F3 and B3 is each 1.6mmol/L of 0.2mmol/L, FIP and BIP, fluorexon 50 μm of ol/L, Manganous chloride tetrahydrate 500 μm of ol/L, TWeen-200.1%, template DNA 50 ~ 100ng, and insufficient section aseptic double-distilled water is supplied; LAMP reaction conditions is at 63-65 DEG C of incubation 45-60min, 85 DEG C of deactivation 5-10min.
Except 25 strain Herba Anoectochili roxburghii anthrax bacterias colour developing results can be observed green fluorescence or agarose gel electrophoresis and detect and occur the distinctive trapezoid belt of LAMP, the colour developing result that have detected 28 kinds of other fungal bacterial strains is orange or agarose gel electrophoresis does not occur amplified band.This illustrates that this primer can be used to detection that in production practice, Herba Anoectochili roxburghii anthrax is fast and reliable and qualification.
When there is the detection of anthrax bacteria in for Herba Anoectochili roxburghii tissue, adopt NaOH rapid cleavage method to extract the DNA of Herba Anoectochili roxburghii anthrax bacteria, detailed process is as follows: the sick leaf of Herba Anoectochili roxburghii or sick stem are cleaned, dried, clip site of pathological change by (1); (2) 10 μ l(0.5mol/LNaOH, 0.5%PVP are added by the sick leaf of 1mg) metering, be fully milled to paste by organizing, centrifugal 5min in 12,000g whizzer; (3) Tris-HCl(pH8.0 of supernatant 20 μ l and isopyknic 0.1mol/L is got) mix; (4) dilute 10 times, 100 times, 1000 times liquid, get 1 μ l stoste respectively, 10 times, 100 times, 1000 times liquid increase as pcr template.
Detect by following LAMP reaction system and the designed primer of reaction conditions:
1. 20mMTris-HCl, 10mM (NH is contained in LAMP reaction system 25 μ l:25 μ l reaction system 4) 2sO 4, 10mMKCl, 8mMMgSO 4, trimethyl-glycine 0.8mol/L, bstarchaeal dna polymerase is 8U, dNTPs1.0mmol/L, F3 and B3 is each 1.6mmol/L of 0.2mmol/L, FIP and BIP, fluorexon 50 μm of ol/L, Manganous chloride tetrahydrate 500 μm of ol/L, TWeen-200.1%, template DNA 50 ~ 100ng, and insufficient section aseptic double-distilled water is supplied; LAMP reaction conditions is at 63-65 DEG C of incubation 45-60min, 85 DEG C of deactivation 5-10min.
2., after LAMP reaction, colour developing result observes green fluorescence, or gets 2 μ l amplified production 2% agarose gel electrophoresis and detect, and the distinctive trapezoid belt of LAMP appears in result, can judge to there is Herba Anoectochili roxburghii anthrax bacteria in described Herba Anoectochili roxburghii tissue; Otherwise there is not Herba Anoectochili roxburghii anthrax bacteria in described Herba Anoectochili roxburghii tissue.
beneficial effect of the present invention:the inventive method is applicable to detection and the qualification of the LAMP visual fast and stable of Herba Anoectochili roxburghii anthrax-bacilus in plant, has important practical value for the microbial disease control of Herba Anoectochili roxburghii anthrax in medicinal plant plantation.The present invention compared with prior art, has following technical superiority and positively effect:
1, reliable results: the LAMP detection primer gone out designed by the present invention, the 25 strain Herba Anoectochili roxburghii anthrax bacterias and the morbidity plant tissue that have gathered separation have carried out testing authentication, and therefore result reliability has sufficient guarantee;
2, high specificity: LAMP primer of the present invention designs 4 Auele Specific Primers for 6 different zones in Herba Anoectochili roxburghii anthrax bacteria rrna the Internal Transcribed Spacer (rDNA-ITS) sequence, in 6 regions, any region and primer do not mate and all can not carry out nucleic acid amplification, therefore high specificity.
3, highly sensitive: LAMP can reach 10fg to the detection sensitivity of Herba Anoectochili roxburghii anthrax bacteria on DNA level, detect high 1000 times than Standard PCR.
4, practicality is good: the LAMP primer gone out designed by the present invention, can be used for the highly sensitive rapid detection of Herba Anoectochili roxburghii anthrax, and therefore present method is practical, can meet Herba Anoectochili roxburghii anthrax and carry out fast and reliable detection and the needs of qualification;
5, fast easy and simple to handle: application the inventive method, carry out detection to Herba Anoectochili roxburghii anthrax to complete in 1 hour, and LAMP nucleic acid amplification carries out under isothermal conditions, only need a thermostatic equipment, do not need complicated plant and instrument and expensive molecular agents, result naked eyes are directly visible.
Accompanying drawing explanation
Fig. 1 is the LAMP detected result figure of Herba Anoectochili roxburghii anthrax of the present invention.Fig. 1 (left side) represents agarose gel electrophoresis detected result, and wherein: swimming lane M is DL2000DNAmarker, swimming lane 1 is positive control (Herba Anoectochili roxburghii anthrax DNA), and swimming lane 2 is negative control (d.d.H 2o); Fig. 1 (right side) represents colour developing result, and wherein: the 1st pipe is positive control, the 2nd pipe is negative control (see embodiment 1).
Fig. 2 is the LAMP specific detection result figure of Herba Anoectochili roxburghii anthrax of the present invention.Fig. 2 (a) represents agarose gel electrophoresis detected result, Fig. 2 (b) represents visual colour developing result, and wherein: swimming lane M is DL2000DNAmarker, swimming lane 1 is negative control, swimming lane 2-7 is Herba Anoectochili roxburghii anthrax bacteria DNA, and swimming lane 8-13 is shown in embodiment 2 for other fungal bacterial strains DNA().
Fig. 3 is the LAMP susceptibility detected result figure of Herba Anoectochili roxburghii anthrax of the present invention.Fig. 3 (on) represent PCR detect amplification after agarose gel electrophoresis detected result, Fig. 3 (under) represent LAMP amplification after colour developing result, wherein: swimming lane M is DNAmarker, swimming lane 1 – 10 template DNA concentration is respectively 1000ng, 100ng, 10ng, 1ng, 100pg, 10pg, 1pg, 100fg, 10fg, 1fg, 100ag, 10ag/25 μ LLAMP reaction system.(see embodiment 3).
Embodiment
Technology contents of the present invention comprises the LAMP detection primer of Herba Anoectochili roxburghii anthrax, and LAMP primer and sequence thereof are respectively:
F3:ATGCCTGTTCGAGCGTCA;
B3:TCCGAGGTCAACCTTTGGAA
FIP:GCCACTACCTTTGAGGGCCTAC-TTTCAACCCTCAAGCTCTGC
BIP:CGGAGCCTCCTTTGCGTAGTAA-GGGTTTTACGGCAAGAGTCC
Utilize LAMP primer to detect Herba Anoectochili roxburghii anthrax colour developing result and can be observed green fluorescence or the distinctive trapezoid belt of LAMP appears in agarose gel electrophoresis.
Main agents: bstarchaeal dna polymerase large fragment is purchased from NEB company of Britain; DNAmarker is purchased from precious biotechnology Dalian company limited; All the other reagent are all purchased from raw work biology (Shanghai) Technology Co., Ltd..Primer synthesizes by giving birth to work biology (Shanghai) Technology Co., Ltd..
the Visual retrieval of embodiment 1:LAMP primer pair Herba Anoectochili roxburghii anthrax
1. the LAMP visual of Herba Anoectochili roxburghii anthrax detects
1. LAMP reaction system: containing 20mMTris-HCl, 10mM (NH in 25 μ L reaction systems 4) 2sO 4, 10mMKCl, 8mMMgSO 4, trimethyl-glycine 0.8mol/L, bstarchaeal dna polymerase is 8U, dNTPs1.0mmol/L, F3 and B3 is each 1.6mmol/L of 0.2mmol/L, FIP and BIP, fluorexon 50 μm of ol/L, Manganous chloride tetrahydrate 500 μm of ol/L, TWeen-200.1%, template DNA 50 ~ 100ng, and insufficient section aseptic double-distilled water is supplied; LAMP reaction conditions is at 63-65 DEG C of incubation 45-60min, 85 DEG C of deactivation 5-10min.
2. after LAMP reaction, colour developing result is observed green fluorescence and is judged as the positive, is orangely judged as feminine gender.Or get 2 μ l amplified production 2% agarose gel electrophoresis and detect, be judged as the positive if there is the distinctive trapezoid belt of LAMP, do not occur that amplified band is judged as feminine gender.
2. detected result
Visual retrieval: positive control (the Herba Anoectochili roxburghii anthrax DNA) result that develops the color can be observed green fluorescence or agarose gel electrophoresis detection occurs outside the distinctive trapezoid belt of LAMP, negative control (d.d.H 2o) result that develops the color is orange or agarose gel electrophoresis does not occur amplified band.(partial results is shown in Fig. 2), illustrates that this primer has very strong specificity.
the specific amplification of embodiment 2:LAMP primer pair Herba Anoectochili roxburghii anthrax
1. the LAMP specific detection of Herba Anoectochili roxburghii anthrax
1. LAMP reaction system: containing 20mMTris-HCl, 10mM (NH in 25 μ l reaction systems 4) 2sO 4, 10mMKCl, 8mMMgSO 4, trimethyl-glycine 0.8mol/L, bstarchaeal dna polymerase is 8U, dNTPs1.0mmol/L, F3 and B3 is each 1.6mmol/L of 0.2mmol/L, FIP and BIP, fluorexon 50 μm of ol/L, Manganous chloride tetrahydrate 500 μm of ol/L, TWeen-200.1%, template DNA 50 ~ 100ng, and insufficient section aseptic double-distilled water is supplied; LAMP reaction conditions is at 63-65 DEG C of incubation 45-60min, 85 DEG C of deactivation 5-10min.
2. after LAMP reaction, colour developing result is observed green fluorescence and is judged as the positive, is orangely judged as feminine gender.Or get 2 μ l amplified production 2% agarose gel electrophoresis and detect, be judged as the positive if there is the distinctive trapezoid belt of LAMP, do not occur that amplified band is judged as feminine gender.
2. detected result
The specificity detected: except 25 strain Herba Anoectochili roxburghii anthrax bacterias colour developing results can be observed green fluorescence or agarose gel electrophoresis and detect and occur the distinctive trapezoid belt of LAMP, the colour developing result that have detected 28 kinds of other fungal bacterial strains is orange or agarose gel electrophoresis does not occur amplified band.(partial results is shown in Fig. 2), illustrates that this primer has very strong specificity.
the susceptibility of embodiment 3:LAMP primer pair Herba Anoectochili roxburghii anthrax detects
1. the LAMP susceptibility of Herba Anoectochili roxburghii anthrax detects
Adopt 10 times of concentration series dilution methods that the Herba Anoectochili roxburghii anthrax bacteria DNA of extraction is diluted to 1000ng, 100ng, 10ng, 1ng, 100pg, 10pg, 1pg, 100fg, 10fg, 1fg, 100ag, 10ag, totally 9 different concns gradients.
1. LAMP reaction system: containing 20mMTris-HCl, 10mM (NH in 25 μ l reaction systems 4) 2sO 4, 10mMKCl, 8mMMgSO 4, trimethyl-glycine 0.8mol/L, bstarchaeal dna polymerase is 8U, dNTPs1.0mmol/L, F3 and B3 is each 1.6mmol/L of 0.2mmol/L, FIP and BIP, fluorexon 50 μm of ol/L, Manganous chloride tetrahydrate 500 μm of ol/L, TWeen-200.1%, template DNA 50 ~ 100ng, and insufficient section aseptic double-distilled water is supplied; LAMP reaction conditions is at 63-65 DEG C of incubation 45-60min, 85 DEG C of deactivation 5-10min.
2. after LAMP reaction, colour developing result is observed green fluorescence and is judged as the positive, is orangely judged as feminine gender.Or get 2 μ l amplified production 2% agarose gel electrophoresis and detect, be judged as the positive if there is the distinctive trapezoid belt of LAMP, do not occur that amplified band is judged as feminine gender.
2. detected result: Herba Anoectochili roxburghii anthrax LAMP susceptibility detects, colour developing result can be observed green fluorescence or the distinctive trapezoid belt of LAMP appears in agarose gel electrophoresis, and detection sensitivity can reach 10fg, 1000 times (see figure 3)s sensitiveer in regular-PCR.
The foregoing is only preferred embodiment of the present invention, all equalizations done according to the present patent application the scope of the claims change and modify, and all should belong to covering scope of the present invention.
SEQUENCELISTING
<110> Chen Zi rock, Zhang Qunlin, Liu little Li, Li Benjin
<120> Herba Anoectochili roxburghii anthrax LAMP detection primer and visible detection method thereof
<130>4
<160>4
<170>PatentInversion3.3
<210>1
<211>18
<212>DNA
<213> artificial sequence
<400>1
atgcctgttcgagcgtca18
<210>2
<211>20
<212>DNA
<213> artificial sequence
<400>2
tccgaggtcaacctttggaa20
<210>3
<211>42
<212>DNA
<213> artificial sequence
<400>3
gccactacctttgagggcctactttcaaccctcaagctctgc42
<210>4
<211>42
<212>DNA
<213> artificial sequence
<400>4
cggagcctcctttgcgtagtaagggttttacggcaagagtcc42

Claims (4)

1. a Herba Anoectochili roxburghii anthrax LAMP detection primer, is characterized in that: described LAMP primer is as follows:
F3:ATGCCTGTTCGAGCGTCA;
B3:TCCGAGGTCAACCTTTGGAA;
FIP:GCCACTACCTTTGAGGGCCTAC-TTTCAACCCTCAAGCTCTGC;
BIP:CGGAGCCTCCTTTGCGTAGTAA-GGGTTTTACGGCAAGAGTCC。
2. a LAMP detection method for Herba Anoectochili roxburghii anthrax, is characterized in that: utilize the LAMP primer described in claim 1 to carry out LAMP reaction, containing 20mMTris-HCl, 10mM (NH in 25 μ L reaction systems 4) 2sO 4, 10mMKCl, 8mMMgSO 4, trimethyl-glycine 0.8mol/L, bstarchaeal dna polymerase is 8U, dNTPs1.0mmol/L, F3 and B3 is 0.2mmol/L, the each 1.6mmol/L of FIP and BIP, fluorexon 50 μm of ol/L, Manganous chloride tetrahydrate 500 μm of ol/L, TWeen-200.1wt.%, template DNA 50 ~ 100ng, insufficient section aseptic double-distilled water is supplied; LAMP reaction conditions is at 63-65 DEG C of incubation 45-60min, 85 DEG C of deactivation 5-10min.
3. Herba Anoectochili roxburghii anthrax LAMP visual detection method according to claim 2, is characterized in that: after LAMP reaction, and colour developing result is observed green fluorescence and is judged as the positive, is orangely judged as feminine gender; Or get 2 μ l amplified production 2% agarose gel electrophoresis and detect, as occurred, trapezoid-shaped strips is judged as the positive, does not occur then being judged as feminine gender.
4. the application of Herba Anoectochili roxburghii anthrax LAMP detection primer as claimed in claim 1 in the early diagnosis of field Herba Anoectochili roxburghii anthrax and the monitoring of germ and qualification.
CN201510735691.4A 2015-11-03 2015-11-03 Herba Anoectochili roxburghii anthrax LAMP detection primer and visible detection method thereof Pending CN105219868A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201510735691.4A CN105219868A (en) 2015-11-03 2015-11-03 Herba Anoectochili roxburghii anthrax LAMP detection primer and visible detection method thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201510735691.4A CN105219868A (en) 2015-11-03 2015-11-03 Herba Anoectochili roxburghii anthrax LAMP detection primer and visible detection method thereof

Publications (1)

Publication Number Publication Date
CN105219868A true CN105219868A (en) 2016-01-06

Family

ID=54989134

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201510735691.4A Pending CN105219868A (en) 2015-11-03 2015-11-03 Herba Anoectochili roxburghii anthrax LAMP detection primer and visible detection method thereof

Country Status (1)

Country Link
CN (1) CN105219868A (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106755339A (en) * 2016-11-30 2017-05-31 福建省农业科学院植物保护研究所 Cucumber anthracnose LAMP detection primer and its application
CN108998565A (en) * 2018-09-28 2018-12-14 杭州师范大学 A kind of molecular specificity labeled primers and its discrimination method of anoectochilus formosanus
CN110734922A (en) * 2019-10-29 2020-01-31 吉林大学 Detection method of Colletotrichum camelliae

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103290099A (en) * 2012-02-24 2013-09-11 中国科学院微生物研究所 Quick molecular detection kit for colletotrichum kahawae and application thereof
CN104975109A (en) * 2015-08-07 2015-10-14 福建省农业科学院果树研究所 Elsinoe ampelina LAMP (loop-mediated isothermal amplification) detection primer set and detection method thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103290099A (en) * 2012-02-24 2013-09-11 中国科学院微生物研究所 Quick molecular detection kit for colletotrichum kahawae and application thereof
CN104975109A (en) * 2015-08-07 2015-10-14 福建省农业科学院果树研究所 Elsinoe ampelina LAMP (loop-mediated isothermal amplification) detection primer set and detection method thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
ZIYAN CHEN等: "RAPID AND VISUAL DETECTION OF COLLETOTRICHUM GLOEOSPORIOIDES ON ANOECTOCHILUS USING LOOP-MEDIATED ISOTHERMAL AMPLIFICATION ASSAY", 《INT. J. PHYTOPATHOL》 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106755339A (en) * 2016-11-30 2017-05-31 福建省农业科学院植物保护研究所 Cucumber anthracnose LAMP detection primer and its application
CN106755339B (en) * 2016-11-30 2019-11-19 福建省农业科学院植物保护研究所 Cucumber anthracnose LAMP detection primer and its application
CN108998565A (en) * 2018-09-28 2018-12-14 杭州师范大学 A kind of molecular specificity labeled primers and its discrimination method of anoectochilus formosanus
CN110734922A (en) * 2019-10-29 2020-01-31 吉林大学 Detection method of Colletotrichum camelliae

Similar Documents

Publication Publication Date Title
CN106987653B (en) LAMP (loop-mediated isothermal amplification) detection primer for potato late blight bacteria and visual detection method thereof
CN106434993B (en) For detecting LAMP primer composition object and its application of cucumber fusarium axysporum
CN101974650B (en) Polymerase chain reaction (PCR) method for detecting fusarium oxysporum and kit
CN105331714B (en) A kind of peronophythora litchi LAMP primer and its rapid detection method
CN108220474A (en) A kind of LAMP detection primer of Fusarium graminearum and its application
CN108676910A (en) A kind of LAMP detection primer of fusarium prolifertum and its application
CN101974651B (en) Fluorescence quantitative polymerase chain reaction (PCR) detection method and detection kit for phytophthora capsici leonian
CN105219868A (en) Herba Anoectochili roxburghii anthrax LAMP detection primer and visible detection method thereof
CN104313128B (en) Method based on loop-mediated isothermal amplification technique detection Fusarium graminearum and Primer composition
CN105256060A (en) PCR detection primer and method for anoectochilus roxburghii colletotrichum orbiculare
CN108531627A (en) One kind is for detecting the streptococcic RPA fluorescent quantitations primer pair of B races, probe, kit and detection method
CN101812541B (en) Lentinus edodes virus detection kit and method
CN108796118B (en) Potato early blight bacterium loop-mediated amplification detection primer and detection method thereof
CN104946760B (en) A kind of method and dedicated kit for detecting Pythium inflatum
CN111850155A (en) Application of specific target primer in simultaneous and rapid identification of two pathogenic bacteria of strawberry infection
CN111534626A (en) LAMP (loop-mediated isothermal amplification) detection primer composition for pythium bellatus, detection kit and visual detection method of LAMP detection primer composition
CN104195254B (en) Method based on loop-mediated isothermal amplification technique detection Herba Equiseti Hiemalis&#39;s Fusariumsp and Primer composition
CN106435005A (en) Roxburgh anoectochilus terminal bud stalk rot pathogen LAMP (loop-mediated isothermal amplification) detection primer and detection method thereof
CN114395617B (en) LAMP (loop-mediated isothermal amplification) visual rapid detection method and application of powdery mildew of strawberry
CN105331716A (en) Phytophthora vignae LAMP (loop-mediated isothermal amplification) detection primers and phytophthora vignae LAMP detection method
CN108411017A (en) Detect the LAMP primer and method of pseudomonas syringae tomato pvs oryzae and oryzicola
CN106399529B (en) A kind of Phyllosticta musarum molecular detection primer and detection method
CN111088392B (en) LAMP (loop-mediated isothermal amplification) detection primer for detecting peanut black rot and detection method thereof
CN113005218A (en) LAMP (loop-mediated isothermal amplification) detection primer, kit and detection method for fusarium solani
CN113373258A (en) LAMP detection primer for alternaria solanacearum on thin shell, and establishment method and application of detection system

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication

Application publication date: 20160106

RJ01 Rejection of invention patent application after publication