CN106148333A - A kind of detection method of prorocentrum minimum - Google Patents
A kind of detection method of prorocentrum minimum Download PDFInfo
- Publication number
- CN106148333A CN106148333A CN201610817655.7A CN201610817655A CN106148333A CN 106148333 A CN106148333 A CN 106148333A CN 201610817655 A CN201610817655 A CN 201610817655A CN 106148333 A CN106148333 A CN 106148333A
- Authority
- CN
- China
- Prior art keywords
- primer
- detection
- lamp
- prorocentrum
- prorocentrum minimum
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Botany (AREA)
- Mycology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides the detection method of a kind of prorocentrum minimum, devise three couples of LAMP primer FIP, BIP, LF, LB, F3 and B3, wherein FIP is 5 ' end biotin labeling primers, LF is 5 ' end Fluorescein isothiocyanate FITC label probes, preparation is containing three pairs of primers and the LAMP reaction system step of sample template, LAMP reaction system is expanded, then uses LFD ELISA test strip, and carried out sensitivity and Evaluation on specificity subsequently.The present invention has the higher specificity of method, sensitivity, practicality and the convenience than existing conventional art PCR detection prorocentrum minimum, can be conducive to detection and control the outburst of prorocentrum minimum in actual on-site field use, carrying out prevention in advance.The detection to harmful algae prorocentrum minimum of the method for the utilization present invention, can effectively prevent harmful algae prorocentrum minimum that extensive red tide occurs, and this is significant to protection China ocean and aquaculture.
Description
Technical field
The invention belongs to harmful algae detection technique field, be specifically related to a kind of harmful algae prorocentrum minimum
The detection method of Prorocentrum minimum (Pavillard) Schiller.
Background technology
Prorocentrum minimum Prorocentrum minimum (Pavillard) Schiller is that one common are poison red tide
Dinoflagellate, it belongs to Prorocentrum, Prorocentrum micans section, Prorocentrum.This kind is littoral kind, is distributed widely in the whole world.China is littoral
Distribution is had with inner bay.Prorocentrum minimum is a kind of common red tide algae kind, a kind of main species when being China's breakout of red tide.
Dagu, China Tianjin mouth is neighbouring and Hong Kong Waters once occurred prorocentrum minimum tide, causes a large amount of fish kills.Prorocentrum minimum
Form is small, and similar to other Prorocentrum micans kinds, differentiates difficulty by morphology under the microscope, needs observer to enrich
Experience.But present stage, mainly observe its morphological feature by microscope for detecting the method for prorocentrum minimum.Therefore,
Needs find one faster, more convenient, are more suitable for the detection method of prorocentrum minimum.
Summary of the invention
It is an object of the invention to provide the detection method of a kind of quick detection harmful algae prorocentrum minimum, to realize micro-
Little Prorocentrum micans carries out field quick detection safe, special, quick, sensitive, simple, thus makes up existing traditional sensing techniques
Not enough.
Present invention firstly provides a kind of loop-mediated isothermal amplification (LAMP) primer group detecting prorocentrum minimum, include following drawing
Thing:
F3 primer PS-F3:5 '-GGCCTTGTTCGACCGC-3 ' (SEQ ID NO:1),
B3 primer PS-B3:5 '-ACCAGGCCACCACCGA-3 ' (SEQ ID NO:2),
FIP primer PS-FIP:
5′-CGTCACCCATGCCCTGGTTGTTGCCGCGCCATGATGTG-3′(SEQ ID NO:3)、
BIP primer PS-BIP:5 '-ATTTCCCGCCGCAGTACCTGCCCAGGATGCGCCACAT-3 ' (SEQ ID NO:
4)、
LF primer PS-LF:5 '-TGCTCAAAGTCAGCACGGAA-3 ' (SEQ ID NO:5)
LB primer PS-LB:5 '-CCGTCGTGCTGCGTGAT-3 ' (SEQ ID NO:6)；
As preferably, the sequence of FIP primer PS-FIP is as follows:
5′-CGTCACCCATGCCCTGGTTGTTGCCGCGCCATGATGTG-3′(SEQ ID NO:7)、
The sequence of BIP primer PS-BIP is as follows:
5′-ATTTCCCGCCGCAGTACCTGCCCAGGATGCGCCACAT-3′(SEQ ID NO:8)。
Preferred as embodiment, the 5 ' ends of PS-FIP carry out biotin labeling, and the 5 ' ends of LF primer PS-LF carry out different sulfur
Cyanic acid fluorescein FITC labelling；
The present invention also provides for a kind of method detecting harmful algae prorocentrum minimum, including the steps
1) preparation LAMP reaction system:
Each primer final concentration of: each 1.6 μm ol/L of inner primer PS-FIP and PS-BIP, outer primer PS-F3 and PS-B3 is each
0.2 μm ol/L, each 0.8 μm ol/L of ring primer PS-LF and PS-LB；Buffer forms and concentration is: Tris-HCl (pH 8.8)
20mmol/L, KCl 10mmol/L, MgSO48mmol/L, (NH4)2SO410mmol/L, the Tween20 of 0.1%, Betaine
0.8mol/L, dNTPs1.4mmol/L；8U Bst archaeal dna polymerase and 2 μ L sample DNA profilings, add distilled water and make reaction system total
Volume is 25 μ L；
2) LAMP reaction system amplification: above-mentioned reaction system is carried out nucleic acid amplification reaction, and amplified reaction is temperature required is
61 DEG C-65 DEG C, amplified reaction required time is 30min-60min；
3) LFD detection: take 8 μ L nucleic acid amplification products and product is joined mixing in 100 μ L Buffer, then LFD is tried
Paper slip is dipped vertically into color developing detection in mixed solution, judges amplification by test strips.
Wherein the optimal reactive temperature described in step 2 is 63 DEG C, and the optimal reaction time is 45min.
The LAMP-LFD detection method of prorocentrum minimum provided by the present invention has the advantage that
One, high sensitivity, can compare normal PCR to 66pg/ μ L, its detection sensitivity to the detection minimum rate of accumulation of prorocentrum minimum
Detection sensitivity high 10 times.
Two, strong specificity, specific primer used sets according to six zoness of different in the ITS gene of prorocentrum minimum
Meter, wherein LF is simultaneously as DNA specific probe, this detection specificity than Standard PCR strong a lot.
Three, the detection time is shorter, within about 50 minutes, can obtain testing result, saves 2-4h than the Standard PCR detection time.
Four, instrument and equipment requires low, it is not necessary to PCR instrument, electrophresis apparatus and gel imaging system, only needs a thermostatic heater
Detection can be completed.
Five, easy and simple to handle, result presents substantially, and whole detection process is not related to complex and expensive instrument and equipment, slightly has
The personnel of molecular biology mechanism can complete whole operation；Testing result is clearly obvious, directly observes by the naked eye and can sentence
Not.
Six, safer to experimenter and environment, detection process is made without gel electrophoresis therefore does not use EB etc. poisonous
Reagent.
In sum, the present invention have than existing conventional art PCR detection prorocentrum minimum the higher specificity of method,
Sensitivity, practicality and convenience, can be conducive to detection in actual on-site field use and control the quick-fried of prorocentrum minimum
Send out, carry out prevention in advance.The detection to harmful algae prorocentrum minimum of the method for the utilization present invention, can effectively prevent harmful algae
There is extensive red tide in class prorocentrum minimum, this is significant to protection China ocean and aquaculture.
Accompanying drawing explanation
Fig. 1: the LAMP-LFD primer of prorocentrum minimum ITS gene and probe design diagram, primer and probe are by square frame
Iris out,
Fig. 2: PCR-AGE detection prorocentrum minimum sensitivity map,
Fig. 3: LAMP detection prorocentrum minimum sensitivity map,
Fig. 4: LAMP-LFD detection prorocentrum minimum sensitivity map,
In Fig. 2 and Fig. 4, swimming lane M is DL2000DNA marker, and NC is negative control, and 1 swimming lane is 10 ° of (template concentrations
66ng/ μ L), 2-8 swimming lane is followed successively by 10-1、10-2、10-3、10-4、10-5、10-6、10-7The genomic DNA of dilution again.
Fig. 5: PCR-AGE detection prorocentrum minimum specificity figure,
Fig. 6: LAMP detection prorocentrum minimum specificity figure,
The specificity figure of Fig. 7: LAMP-LFD detection prorocentrum minimum；
In Fig. 5 and Fig. 7, swimming lane M is DL2000DNA marker, and NC is negative control, and 1-8 swimming lane is followed successively by: small former
Dinoflagellate, Alexandrium tamarense, Prorocentrum donghaiense, ocean Prorocentrum, prorocentrum minimum, red algae different gulf algae, Skeletonema Costatum, rice
Family name triumphant human relations algae.
Detailed description of the invention
LAMP-LFD technology is ring mediation horizontal temperature amplification technique (Loop-mediated isothermal
Amplification) the detection skill of a kind of novelty combined with horizontal mobility test strips (Lateral flow dipstick)
Art, the amplification of nucleic acid horizontal stroke temperature and visualization ELISA test strip are organically combined by this technology.Loop-mediated isothermal amplification technique (LAMP),
Have only under the conditions of constant temperature (60 DEG C 65 DEG C) be incubated dozens of minutes, required genes of interest can be expanded to 109Level.Horizontal
To flowing test strips (LFD), merge immunochromatography technique and molecular biology method, coloured inspection can have been formed on paper slip
Survey line is such that it is able to specifically detect this target product.Ring mediation horizontal temperature amplification technique (LAMP) and horizontal mobility test strips
(LFD) technology be combineding with each other, makes LAMP amplified production Site Detection visualize, and testing result is substantially directly perceived, by naked eyes is
Can recognize, LAMP-LFD associated methods safely, quickly, efficiently, high sensitivity and without equipment and technical limitations, there are other technologies
Irreplaceable advantage.
The present invention solves the technical scheme that above-mentioned technical problem used and includes three below part: 1, provide 3 to being used for
The LAMP primer sequence of prorocentrum minimum, i.e. length are respectively the oligonucleotide of 20bp, 18bp, 32bp, 42bp, 22bp and 21bp
Sequence, the most named PS-F3, PS-B3, PS-FIP, PS-BIP, PS-LF and PS-LB；2, preparation LAMP reaction system, passes through
Sample template is expanded by LAMP response procedures, determines optimal reaction system and reaction condition；3, PS-LF is designed as
DNA probe, is analyzed LAMP amplification in conjunction with LFD technology.
8 kinds of algaes used in the present invention: prorocentrum minimum (Prorocentrum minimum (Pavillard)
Schiller), Alexandrium tamarense (Alexandrium tamarense), Prorocentrum donghaiense (Prorocentrum
Donghaiense), ocean Prorocentrum (Prorocentrum micans), prorocentrum minimum (Prorocentrum
Minimum), heterosigma akashiwo (Heterosigma akashiwo), Skeletonema Costatum (Skeletonema costatum), rice
Family name's triumphant human relations algae (Karenia mikimotoi) above microalgae algae kind is provided by Marine Biological Lab of University Of Ningbo algae kind room,
Cultivating sea water (salinity 25 ‰) and boil cooling after 0.45 μm acetate fiber membrane filtration, culture fluid uses Zhejiang Marice Lives Academy three
Number formula of liquid (NMB 3#).Algae kind is cultivated in 2500mL conical flask under daylight lamp illumination, intensity of illumination 45～55 μm ol/
(m2 s), light dark period 12: 12, cultivation temperature is (20 ± 2) DEG C.
Below in conjunction with embodiment, the present invention is described in further detail.
Embodiment 1:LAMP-LFD technology for detection is harmful to the method for prorocentrum minimum and sets up
Takara MiniBEST Universal Genomic DNA Extraction Kit Ver.50 purchases precious biological
Engineering (Dalian) company limited DNA (deoxyribonucleic acid) amplification kit, Rong Yan biotechnology (Chinese) company limited, LFD detects examination
Paper slip is purchased from Milenia Biotec GmbH company (Milenia GenLine HybriDetect MGHD1, Germany).
1, the design of LAMP primer
After applicant carries out homology analysis to the IST gene of the prorocentrum minimum disclosed in NCBI, and compare with micro-
The sequence of the IST gene of little Prorocentrum micans allied species, thus design and filter out following 3 pairs of primers, primer sequence is as follows:
PS-F3:5′-AAGCATGCCTTCTTCAGTGT-3′
PS-B3:5′-CTGGAGCAGGCTACGAGT-3′
PS-FIP:
5′-TGACACACAAACACGCACCCATTGATTTTCATGCCCCTGACG-3′
PS-BIP:5′-TGGCCTTTGACGCATTCAGTGTACACAACGAAAGAGACACCG-3′
PS-LB:5′-TAGCGTCTCCAACGAGCAACT-3′
PS-LF:5′-GACAGCACCAAGAGAAGACTTG-3′
Wherein PS-FIP is 5 ' end biotin labeling primers, and PS-LF is 5 ' end Fluorescein isothiocyanate FITC label probes；
The ITS gene LAMP amplimer sequence location of prorocentrum minimum is as shown in Figure 1.According to above-mentioned primer sequence, raw at Dalian treasured
Thing company carries out LAMP primer synthesis.
2, LAMP amplified conditions optimization
Amplified conditions optimization is carried out as template using the genomic DNA of prorocentrum minimum.LAMP method DNA amplification reaction reagent
Box is purchased from Bo Ao bio tech ltd.First preparation has optimal amplification efficiency and detects specific reaction system, this
LAMP reaction system in invention is: each primer concentration is: each 1.6 μm ol/L of FIP-bio and BIP, each 0.2 μm ol/ of F3 and B3
Each 0.8 μm ol/L of L, LF-fitc and LB；Buffer forms and concentration is: Tris-HCl (pH 8.8) 20mmol/L, KCl
10mmol/L, MgSO4 8mmol/L, (NH4) 2SO4 10mmol/L, Tween20 0.1%, Betaine 0.8mol/L,
dNTPs 1.4mmol/L；8U Bst archaeal dna polymerase；Genomic DNA template 2 μ l.Require that preparation reaction is mixed according to above-mentioned system
Compound, is dispensed into after mixing in aseptic PCR pipe, and reaction cumulative volume is 25 μ l.LAMP-LFD reaction system is shown in Table 1.
Table 1:LAMP-LFD reaction system
In course of reaction, expand and too high or too low for temperature be all unfavorable for that LAMP reacts.The primer that the application present invention provides
The reaction system that present invention determine that with employing, reacts LAMP under the conditions of being respectively compared different temperatures (61 DEG C, 63 DEG C, 65 DEG C)
Impact, is monitored in real time amplified reaction by real-time transmissometer and finally determines that optimum reacting time and reaction are temperature required.
63 DEG C are finally selected, the optimum reaction condition that 45min expands as follow-up LAMP by interpretation.
3, LFD detection
After LAMP amplification terminates, take 8 μ L amplified productions and join mixing in 100 μ L Buffer solution, by LFD test strips
It is dipped vertically in mixed liquor, observes whether ELISA test strip band develops the color.If detection band colour developing represents small primitive nail in this sample
The testing result of algae is positive, if do not developed the color, represents that the testing result of this sample prorocentrum minimum is feminine gender.
Embodiment 2
By the LAMP-LFD technology of the present invention, harmful algae prorocentrum minimum sensitivity is measured
1, the prorocentrum minimum genomic DNA extracted with reference to DNA extraction kit description, the small primitive nail that will be extracted
The genomic DNA template original concentration (74ng/ μ L) of algae presses 10 times of gradient dilutions, respectively as reaction template.
2, by LAMP, LAMP-LFD and PCR method, prorocentrum minimum is carried out detection and compare sensitivity.
The genomic DNA of above-mentioned gradient dilution is used as PCR reaction template by 2.1, utilizes above-mentioned special primer F3 and B3 to enter
Row amplification, reaction system is: each 1 μ L of 20 μm ol/L F3 and 20 μm ol/L B3, Premix Taq enzyme (TaKaRa) 25 μ L, small
Prorocentrum micans template 3 μ L, distilled water is settled to 50 μ L systems.PCR reaction condition after optimization: 95 DEG C of 5min of denaturation；95℃
40s, 51 DEG C of 40s, 72 DEG C of 90s, 30 circulations；72 DEG C extend 10min.Amplified production is tied with 1% agarose gel electrophoresis detection
Really (Fig. 2).
2.2 by the genomic DNA of above-mentioned gradient dilution be used as LAMP template carry out nucleic acid amplification test, result is shown in Fig. 3.
6 primers of 2.3 LAMP provided according to the present invention combine LFD technology by the genome after above-mentioned gradient dilution
The template that DNA reacts as LAMP expands, and the LFD methods analyst LAMP reaction provided by the present invention, result is shown in Fig. 4.
10 times of gradient dilutions of prorocentrum minimum genomic DNA template it is demonstrated experimentally that LAMP-LFD and LAMP detection minimum
Diluted concentration is 10-4, template concentrations is 7.4pg/ μ L.PCR amplification least concentration is 74pg/ μ L.It is sensitive that LAMP-LFD detects
Degree than and high 1 order of magnitude of conventional PCR method, it is sensitive that the above results shows when the primer sets of the present invention ensure that detection
Property.
Embodiment 3
By the LAMP-LFD technology of the present invention, harmful algae prorocentrum minimum specificity is measured
Choose prorocentrum minimum (Prorocentrum minimum (Pavillard) Schiller), tower agate Alexandria
Algae (Alexandrium tamarense), Prorocentrum donghaiense (Prorocentrum donghaiense), ocean Prorocentrum
(Prorocentrum micans), prorocentrum minimum (Prorocentrum minimum), heterosigma akashiwo (Heterosigma
Akashiwo), Skeletonema Costatum (Skeletonema costatum), Michaelis triumphant human relations algae (Karenia mikimotoi) 8 kinds are often
See marine harmful algae as LAMP-LFD specific test algae, wherein distilled water is negative control.Extract the genome of algae
DNA, amplified production observes amplification with LFD test strips and 1% agarose gel electrophoresis respectively.Testing result is shown in Fig. 5-7, says
The LAMP-LFD detection method of the prorocentrum minimum that the bright present invention provides can guarantee that the specificity to harmful algae prorocentrum minimum
Detection, not relevant to other algae generation cross reaction.
Embodiment 4
For improving further the sensitivity of LAMP amplification, according to the primer of Previous designs, for PS-FIP and PS-BIP I
The base in its primer is transformed, improved primer sequence is as follows:
PS-FIP-1:
5′-TGACACACAAACACGCACCCATTGATTATCATGCCTCTGACG-3′
PS-BIP-1:5′-TGGCCTATGACGCATTCAGAGTACACTACGAATGAGACACCG-3′
Improved primer is utilized to carry out specificity and the sensitivity technique of LAMP amplification.Amplification reaction system is except implementing
Outside in example 1, two primer PS-FIP and PS-BIP are replaced by PS-FIP-1 and PS-BIP-1 respectively, other are the most constant, amplification and LFD
Detection process also keeps consistent.With for compared with carrying out the LAMP-LFD before primer transformation, the improved LAMP-LFD of primer is spy
The opposite sex test experience in transformation before result consistent.But it is in terms of sensitivity technique, compared with the primer do not transformed, sensitive
Degree rises again 1 order of magnitude, improves 2 orders of magnitude than conventional PCR method sensitivity.The above results show engineered after
The primer sets of the present invention can further improve susceptiveness during detection in the case of ensureing that specific detection is constant.
Embodiment 5
LAMP-LFD is to the detection application of harmful algae in each marine site
The DNA profiling of each sample is extracted with the RNA isolation kit in embodiment 1.And by the LAMP-LFD method designed
Whether detection seawater sample exists harmful algae prorocentrum minimum；Detect by the PCR method in case study on implementation 2 simultaneously.
Each sample make respectively 3 parallel, testing result is as shown in table 2.
Table 2:LAMP-LFD and PCR method are to the testing result of harmful algae prorocentrum minimum in each marine site
Note :+. positive；. negative
The above results shows that the result that the primer sets of the present invention and detection method are obtained is consistent with the result of PCR, it was demonstrated that
The reliability of the present invention.
Claims (8)
1. a LAMP primer group, it is characterised in that described primer sets includes:
F3, sequence be GGCCTTGTTCGACCGC,
B3, sequence be ACCAGGCCACCACCGA,
FIP, sequence be CGTCACCCATGCCCTGGTTGTTGCCGCGCCATGATGTG,
BIP, sequence be ATTTCCCGCCGCAGTACCTGCCCAGGATGCGCCACAT,
LF, sequence be TGCTCAAAGTCAGCACGGAA,
LB, sequence is CCGTCGTGCTGCGTGAT.
2. primer sets as claimed in claim 1, it is characterised in that the sequence of described FIP is CGTCACCCATGCCCTGGTT
GTTGCCGCGCCATGATGTG。
3. primer sets as claimed in claim 1, it is characterised in that the sequence of described BIP is ATTTCCCGCCGCAGTACCT
GCCCAGGATGCGCCACAT。
4. primer sets as claimed in claim 1 or 2, it is characterised in that the 5 ' end biotin labelings of described FIP.
5. primer sets as claimed in claim 1, it is characterised in that the 5 ' end FITC labellings of described LF.
6. the application in detection prorocentrum minimum of the primer sets described in claim 1.
7. the test kit detecting prorocentrum minimum, it is characterised in that it is arbitrary that described test kit includes claim 1-5
Primer sets described in Xiang.
8. the method detecting harmful algae prorocentrum minimum, it is characterised in that described method includes the steps:
1) preparation LAMP reaction system:
Each primer final concentration of: each 1.6 μm ol/L of inner primer PS-FIP and PS-BIP, each 0.2 μ of outer primer PS-F3 and PS-B3
Each 0.8 μm ol/L of mol/L, ring primer PS-LF and PS-LB；Buffer forms and concentration is: Tris-HCl (pH 8.8)
20mmol/L, KCl 10mmol/L, MgSO48mmol/L, (NH4)2 SO410mmol/L, the Tween20 of 0.1%, Betaine
0.8mol/L, dNTPs 1.4mmol/L；8U Bst archaeal dna polymerase and 2 μ L sample DNA profilings, add distilled water and make reaction system
Cumulative volume is 25 μ L；
2) LAMP reaction system amplification: above-mentioned reaction system is carried out nucleic acid amplification reaction, amplified reaction is temperature required is 61 DEG C-
65 DEG C, amplified reaction required time is 30min-60min；
3) LFD detection: take 8 μ L nucleic acid amplification products and product is joined mixing in 100 μ L Buffer, then by LFD test strips
It is dipped vertically into color developing detection in mixed solution, judges amplification by test strips.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610817655.7A CN106148333A (en) | 2016-09-12 | 2016-09-12 | A kind of detection method of prorocentrum minimum |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610817655.7A CN106148333A (en) | 2016-09-12 | 2016-09-12 | A kind of detection method of prorocentrum minimum |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106148333A true CN106148333A (en) | 2016-11-23 |
Family
ID=57341226
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610817655.7A Pending CN106148333A (en) | 2016-09-12 | 2016-09-12 | A kind of detection method of prorocentrum minimum |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106148333A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106701927A (en) * | 2016-12-09 | 2017-05-24 | 国家开发投资公司 | Rapid detection of gold algae method and test kit based on cyclo-mediated isothermal expansion |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105177135A (en) * | 2015-09-09 | 2015-12-23 | 宁波大学 | Detection method of karlodinium micrum |
-
2016
- 2016-09-12 CN CN201610817655.7A patent/CN106148333A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105177135A (en) * | 2015-09-09 | 2015-12-23 | 宁波大学 | Detection method of karlodinium micrum |
Non-Patent Citations (1)
| Title |
|---|
| 侯建军等: "用PCR扩增裸甲藻和微小原甲藻rRNA基因的方法研究", 《 湖北民族学院学报(自然科学版)》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106701927A (en) * | 2016-12-09 | 2017-05-24 | 国家开发投资公司 | Rapid detection of gold algae method and test kit based on cyclo-mediated isothermal expansion |
| CN106701927B (en) * | 2016-12-09 | 2020-09-29 | 国投生物科技投资有限公司 | Method and kit for rapidly detecting chrysophyceae through loop-mediated isothermal amplification |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105177135B (en) | A kind of detection method of Small nodule | |
| CN105603124B (en) | LAMP primer group and detection method for the detection of I subgroup aviadenovirus | |
| CN105316422A (en) | Kit for rapidly detecting pathogeny of acute hepatopancreatic necrosis disease of prawns and application of kit | |
| CN108060257A (en) | It is a kind of that strong male rotten mould Primer composition and its detection method are detected based on loop-mediated isothermal amplification technique | |
| CN105039541A (en) | Primer and probe sequence used for LAMP-LFD detection of vibrio fluvialis and application of primer and probe sequence | |
| CN108588277A (en) | A kind of canine distemper virus visualization nucleic acid detection method | |
| CN104789658B (en) | A kind of ring isothermal duplication primer of quick detection citrus Tylenchulus Semipenetrans and its application | |
| CN104818339B (en) | A kind of detection method of real-time fluorescent RCR ulcer bacteria | |
| CN103952472B (en) | For the primer of Streptococcus iniae LAMP-LFD Visual retrieval and the application of probe and primer and probe | |
| CN107502678A (en) | A kind of method and device for detecting blue algae producing microcystic toxins | |
| CN105445248A (en) | Method for rapid determination of cyanobacteria cell apoptosis rate | |
| CN104531885A (en) | Aeromonas veronii rapid detection primer, kit and application | |
| CN106434956A (en) | Detection method of heterosigma akashiwo | |
| CN103451310B (en) | Gene chip capable of simultaneously detecting various vibrios and method for detecting vibrios | |
| CN101768636A (en) | Composition and kit for detecting vibrio cholerae and detection method | |
| CN106148333A (en) | A kind of detection method of prorocentrum minimum | |
| CN106167799A (en) | A kind of detection method of Michaelis triumphant human relations algae | |
| CN106636082A (en) | Marine prorocentrum detection method | |
| CN106755366A (en) | A kind of detection method of Alexandrium tamarense | |
| CN106755379A (en) | 4 kinds of Aspergillus are synchronously quantified and the dimer of Genotyping is mutated fluorescent primer quantifying PCR method | |
| CN105543221B (en) | A kind of LAMP kit and its primer special for identifying birds gender | |
| CN108676921A (en) | A kind of LAMP primer group and detection method and its application for aviadenovirus detection | |
| CN101768633A (en) | Composition for detecting O139 group vibrio cholerae, kit and detection method | |
| CN106520941A (en) | Detection method for prorocentrum donghaiense | |
| CN104388578B (en) | Utilize cross primer and the method for double probe constant-temperature amplification detection NOS terminator |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20161123 |